Внутрииндивидуальная изменчивость гена малой рибосомной субъединицы у осетровых рыб амура Acipenser Schrenckii Brandt, 1869 и Huso Dauricus (Georgii, 1775)

Тип работы:
Курсовая
Предмет:
Биология


Узнать стоимость

Детальная информация о работе

Выдержка из работы

МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ

Федеральное государственное автономное образовательное учреждение

высшего профессионального образования

ДАЛЬНЕВОСТОЧНЫЙ ФЕДЕРАЛЬНЫЙ УНИВЕРСИТЕТ

КУРСОВАЯ РАБОТА

Внутри-индивидуальная изменчивость гена малой рибосомной субъединицы у осетровых рыб амура Acipenser Schrenckii Brandt, 1869 и Huso Dauricus (Georgii, 1775)

Кафу Наталья Михайловна

г. Владивосток

2013

Оглавление

  • осетровый рыба секвенирование псевдоген
  • Введение
  • 1. Обзор литературы
    • 1.1 Биология, молекулярная эволюция и филогения осетровых рыб
      • 1.1.1 Происхождение и разнообразие
      • 1.1.2 Островые рыбы Амура
      • 1.1.3 Гены ядерной 18S рДНК
      • 1.1.4 Согласованная эволюция
    • 1.2 Краткая характеристика используемых методов и маркеров
      • 1.2.1 Полимеразная цепная реакция
      • 1.2.2 Автоматическое секвенирование ДНК с флуоресцентной меткой
  • 2. Материалы и методы
    • 2.1 Получение геномной ДНК
    • 2.2 PCR-амплификация 18S рДНК
    • 2.3 Клонирование 18S pДНК
    • 2.4 Секвенирование последовательности 18S рДНК
    • 2.5 Обработка данных секвенирования 18S рДНК
    • 2.6 Тесты для псевдогенов
  • 3. Результаты и обсуждение
  • 4. Выводы
  • Список литературы

Введение

Отряд Acipenseriformes (осетры и веслоносы) является древней группой рыб, ведущей свое происхождение из Юрского Периода (Grande, Bemis, 1991). Важными особенностями этой группы рыб являются долгая продолжительность жизни, возможность достижения больших размеров и медленное созревание. Широкое использование осетровых в комерческих целях привело к их масштабному вылову, что резко уменьшило численность этих рыб. В настоящее время весь род включен в списки Международной конвенции по редким видам (CITES). Основными факторами уменьшения численности осетровых рыб являются некоторые биологические особенности этих рыб (прежде всего медленное созревание, размножение с промежутками в несколько лет, миграции), загрязнение и уничтожение естественных мест обитания и нерестилищ, строительство дамб на нерестовых путях и чрезмерный вылов (Krieger et al., 2008; Ludwig, 2008).

Все осетровые являются полиплоидами (4n-8n-16n) и обладают большим (120−500) числом хромосом (Birstein et al., 1993; Fontana et al., 1999). Так же генетические исследования осетровых рыб выявили некоторые особенности, такие как, консервативный характер кариологической (Lanfredi et al., 2001), биохимической (Khabarov et al., 2002) и молекулярной (de la Herran et al., 2001; Krieger, Fuerst, 2000) эволюции, а также множественность аллелей гена ядерной 18S рРНК (Krieger, Fuerst, 2002; 2004), что делает эту группу особенно привлекательной для всестороннего изучения. Эти факторы, возожно, явились причиной относительно простой межвидовой и межродовой гибридизации, усугубляемой перекрытием зон нереста. Гибридизация делает систематику Acipenseridae весьма запутанной (Birstein, 2002).

Предмет нашего исследования — рибосомная ДНК (рДНК) — классический пример генной дупликации, который может быть использован в качестве модели для тестирования теории согласованной эволюции (Hillis, Davis, 1988; Hillis, Dixon, 1991). Эволюционная динамика тандемно-повторяющихся последовательностей мультигенного семейства рДНК вызывает неизменный интерес многих исследователей с момента своего открытия; генные дупликации принято рассматривать как основной эволюционный путь приобретения новых функций (Dame et al., 1984).

Кодирующие регионы рДНК широко используются в качестве молекулярных маркеров для филогенетических исследований эукариот, поскольку большинство их мутаций в результате согласованной эволюции (через механизмы рекомбинации) быстро фиксируются внутри популяции или вида в процессе дифференциации (Hillis, Davis, 1988; Carranza et al., 1996). Интенсивные исследования этих маркеров обнаружили, что у небольшого числа организмов регистрируется несколько (2−3) вариантов ядерного гена 18S рРНК (Kelly, 1997; Muir et al., 2001). Поэтому открытие множественных аллелей этого гена у северо-американских осетровых рыб (род Acipenser) (Krieger, Fuerst, 2002, 2004) оказалось еще более неожиданным; для всех других животных значительная внутри-индивидуальная изменчивость последовательности 18S рДНК не характерна. В настоящее время не существует четкого объяснения данного феномена, а также его отсутствия у ближайших филогенетических родственников осетров, таких как веслоносы (род Polyodon). Среди возможных причин чаще всего приводят полиплоидию (Kelly, 1997; Krieger, Fuests, 2004); бесспорным остается лишь тот факт, что механизмы согласованной эволюции в геномах осетровых рыб не смогли реализоваться в полной мере.

Цель нашей работы состояла в исследовании разнообразия 18S рДНК у двух видов осетровых рыб Амура (Acipenser schrenckii и Huso dauricus), что необходимо для прояснения механизмов генерирующих это разнообразие, а также оценки широты распространения феномена множественности аллелей гена 18S рРНК и его эволюционных последствий у разных представителей животного мира и прежде всего — полиплоидных видов рыб.

В связи с этим были поставлены следующие задачи:

1. Провести амплификацию, клонирование и секвенирование гена 18S рРНК у двух видов осетровых рыб Амура (Acipenser schrenckii и Huso dauricus).

2. По данным секвенирования провести детальный анализ полиморфизма последовательностей 18S рДНК (нуклеотидные замены, вставки/делеции).

3. По данным филогенетического анализа дать функциональную характеристику вариантам гена 18S рРНК.

4. Провести анализ скоростей эволюции последовательностей с разной функциональной значимостью.

1. Обзор литературы

1.1 Биология, молекулярная эволюция и филогения осетровых рыб

1.1.1 Происхождение и разнообразие

Осетры относятся к подклассу Лучеперых рыб (Actinopterygii), появившихся около 350 млн лет назад. Тогда лучеперые представляли из себя примитивные группы толсточешуйных ганоидных рыб. Пик численности и разнообразия лучеперых приходился на Пермский и Триасовый периоды. Затем их численность начала сокращаться и в наше время сохранилось около 50 видов этих некогда многочисленных групп (Bemis et al., 1996).

Лучеперые рыбы составляют свыше 95% процентов ныне живущих рыбообразных и рыб. Опору осевого скелета у них образует костный позвоночник, только у немногих сохраняется хорда. Подкласс Actinopterygii делится на Ганоидных рыб (Ganoidomorpha) и Костистых рыб (Teleostei). Ganoidomorpha включает единственный надотряд Ganoidomorfha, с четырьмя отрядами. Костистые рыбы включают 8 надотрядов и 32 отряда. Таким образом, в настоящее время в подкласс Actinopterygii входит 36 отрядов, группируемых в 9 надотрядов. Ганоидные рыбы представляют собой немногочисленные остатки нескольких древних групп, расцвет которых предшествовал расцвету остальных отрядов лучеперых рыб. К ганоидным рыбам относятся:

1. Осетрообразные, или Хрящевые ганоиды (Acipenseriformes, или Chondrostei)

2. Многоперообразные (Polypteriformes)

3. Амиеобразные (Amiiformes)

4. Панцирникообразные (Lepisosteiformes).

Два последних отряда нередко рассматриваются под общим названием костных ганоидов (Holostei).

В настоящее время отряд Acipenseriformes насчитывает около 24 видов. Из них 4−5 видов находится на грани вымирания, 11 видов под угрозой исчезновения, 9 на грани перехода в статус исчезающих и 1−2 вида находятся в статусе низкого риска. Фауна Российской Федерации представлена 13 видами рыб родов Huso, Acipenser и Pseudoscaphirhynchus.

1.1.2 Островые рыбы Амура

Ниже дано краткое описание осетровых рыб реки Амур (систематика, распространение, образ жизни и статус вида).

Acipenser schrenckii Brandt, 1869 — амурский осетр

Другие названия:

Acipenser sturio (non Linnaeus) — Georgi, 1775: 352 (Шилка);

Acipenser schrenckii Brandt, 1869: 115 (бассейн Амура);

Sturio schenckii — Дыбовский, 1877: 219 (Амур, Уссури, оз. Ханка);

Acipenser schrenckii — Берг, 1909: 20 (бассейн Амура);

Acipenser schrenckii — Богуцкая, Насека, 1996

Описание. По внешнему виду похож на сибирского осетра A. baerii, но жаберные тычинки одновершинные, не веерообразные. Рыло коническое, заостренное. Нижняя губа прервана. В спинном плавнике 35−53 луча, в анальном — 20−32. Спинных жучек 11−17, боковых 32−47, брюшных 6−12. Жаберных тычинок 36−45. Костяной луч грудного плавника очень сильный. Тело между рядами жучек покрыто мельчайшими гребневидными зернышками. Окраска варьирует: спина от серовато-желтой до почти черной, брюхо и бока светлые (Берг, 1948; Никольский, 1956). Относится к 240-хромосомной группе осетров (Васильев, 1985).

Распространение. Бассейн Амура от лимана до верховьев, встречается в Шилке, Аргуни, Ононе, Сунгари, Уссури и оз. Ханка (Берг, 1948; Никольский, 1956). В лимане немногочислен и за пределы опресненной зоны выходит редко, но встречается у берегов Сахалина и заходит в устьевые участки реки северо-западной части острова, изредка попадается в Сахалинском заливе (Атлас пресноводных рыб России, 2002).

Максимальные размеры. Крупный осетр, в прошлом попадались экземпляры длиной до 290 см и массой до 80−160 и даже 200 кг (Берг, 1948). В последние годы в уловах представлены рыбы длинной 90−170 см и массой 6−40 кг в возрасте 12−38 лет.

Образ жизни. Донная промысловая рыба, образующая в Амуре несколько локальных группировок (стад), приуроченных к отдельным участкам реки и впадающим притокам. В лимане Амура обитает немногочисленная полупроходная группировка. Созревает в возрасте не ранее 9−10 лет при длине не менее 108−116 см и массе 6−8 кг. Нерест происходит с конца мая до середины июля на галечниковых участках реки с довольно быстрым течением и глубиной 2−3 м. Плодовитость колеблется в зависимости от размеров самки в пределах 27,6−434 тыс. икринок. Их диаметр 2,5−3,0 мм. Молодь выходит из икры в июне-июле. По достижении длины 2 см она начинает питаться мелкими формами донных беспозвоночных, в основном личинками хирономид. Пищу взрослых осетров составляют более крупные личинки насекомых, мелкая рыба и моллюски (Никольский, 1956).

Статус вида. Ценнейшая промысловая рыба, в прошлом добывалась в значительных количествах. В 1891 г. его уловы доходили до 6 тыс. центнеров, в 1930-е годы они колебались в пределах 140−300 центнеров, с 1945 г. началось резкое снижение уловов, они упали до 8 центнеров (1948). С 1958 г. в бассейне Амура установлен запрет на промысел осетра, который действует и до настоящего времени (китайский лов при этом не прекращался). В начале 70-х годов общая численность осетра в Нижнем муре в возрасте от годовика и старше составила около 145 тыс. экз. (Крыхтин, 1979). За прошедшие годы общая численность амурского осетра не увеличивалась и по последним данным составляет около 130 тыс. экз., но при этом несколько возросло количество взрослых рыб. Их насчитывается около 25 тыс. экз. Вид внесен в Красную книгу МСОП.

В последние десятилетия около 90% популяции составляют молодые неполовозрелые особи 45−65 см длинной; общая численность рыб старше 2 лет — 2000 экз, а производители встречаются единичными экземплярами. Основными ограничивающими факторами, скорее всего, являются ограниченный фонд нерестилищ, интенсивный китайский промысел, загрязнение бассейна Амура (добыча гравия). Основные меры по увеличению численности этого вида — охрана нерестовых рек, работы по искусственному воспроизводству, криоконсервация генома, усиление борьбы с загрязнением вод бассейна Амура.

Huso dauricus (Georgi, 1775) — калуга

Другие названия:

Acipenser dauricus Georgi, 1775: 352 (Амур, Аргунь, Шилка, Онон).

Acipenser orientalis Pallas, 1814: 107 (Амур).

Huso dauricus — Берг, 1911: 146 (Амур, Шилка, Онон); - Берг, 1948: 58.

Описание. Рот большой, полулунной формы, частично переходящий на бока головы. Спинных жучек — 10−16, боковых — 32−46, брюшных — 8−12. В спинном ряду первая жучка наименьшая. Жаберных тычинок 16−22. В спинном плавнике менее 60 лучей (43−57), в анальном — 26−35. Усики сплющены с боков. Жаберные перепонки сращены между собой. Окраска спины серовато-зеленая или серовато-черная, брюхо желтовато-белое или белое (Берг, 1948; Никольский, 1956). Относится к 120 хромосомной группе осетров (Васильев, 1985).

Распространение. Населяет бассейн Амура от лимана до Шилки, Аргуни и Онона. Есть в Сунгари и Уссури. Изредка заходит в озера (Ханка, Болонь, Орель) (Берг, 1948; Никольский, 1956). Молодь обнаружена в северо-западной части Охотского моря, вблизи устьев рек Тауй, Охота, Ульбея, Иня и др. (Черешнев, 1990). Известна калуга у северо-западного побережья Сахалина, (Гриценко, Костюнин, 1979); а также в Сахалинском заливе и в некоторых лагунах северо-восточной части острова (Пильтун, Чайво, Ныйский). Отмечены случаи поимки калуги у берегов Хоккайдо (Атлас пресноводных рыб России, 2002).

Максимальные размеры. Крупнейшая пресноводная рыба, достигающая длины 5 м и массы более 1000 кг. Наиболее крупные особи сосредоточены в лимане Амура. В 1935 г. средняя масса добываемых калуг составляла 114 кг (Никольский, 1956). В 1997—1998 гг. в контрольных уловах в русле Амура калуга была представлена особями длиной от 160−260 см, массой от 20 до 140 кг в возрасте от 12 до 26 лет. В лимане Амура модальные размеры добываемых рыб составили 200−240 см, масса 100−120 кг, возраст 19−28 лет.

Образ жизни. В бассейне Амура образует полупроходную (лиманную) и жилую формы, последняя представлена наиболее крупными особями, обладает более высоким темпом роста и имеет яровую и озимую расы. Растет быстро: лиманная форма к 11−13 годам имеет массу 45 кг, а к 20−22 годам ее масса превышает 100 кг. Возраст созревания сильно растянут. Самки калуги в Среднем Амуре становятся половозрелыми на 11−21-м году жизни при достижении массы 37−110 кг, самцы — на 10−19-м году при массе 26−90 кг. Жилая форма созревает на несколько лет позже: самцы в возрасте 14−21 год, самки — на 17−23-м году жизни. Нерест у одной и той же особи не ежегодный: у самцов интервал составляет в среднем 4 года, у самок — 5 лет. Размножается, как и все осетровые, на галечниковом или песчаном грунте, откладывая донную, приклеивающуюся икру. Плодовитость от 665 до 4100 тыс. икринок. Зрелые икринки имеют диаметр 3,2−4,0 мм. Сроки нереста — май-июнь при температуре воды 12−14°С. Иногда нерест затягивается до июля. Инкубационный период длится 4−6 суток. Вышедшие из икры личинки сносятся вниз по течению Амура, делая, как и все осетровые, характерные свечки, поднимаясь резким движение от дна в толщу воды, а затем опускаясь на дно.

Мальки калуги питаются донными личинками насекомых, креветками, мизидами и очень рано переходят на питание рыбой. Небольшие калужата поедают пескарей, молодь чебака и даже косаток. Взрослая калуга после нереста интенсивно откармливается. В лимане Амура ее пищу составляют дальневосточные лососи (кета, горбуша) во время их нерестового хода в реку. Жилая туводная форма калуги питается пескарями, чебаком, белым амуром, толстолобиком, сазаном и другими рыбами. У калуги отмечен каннибализм: крупные особи нередко поедают молодь своего вида. Зимой калуга концентрируется на ямах, но питаться не прекращает (Никольский, 1956; Атлас пресноводных рыб России, 2002).

Статус вида. Ценнейшая промысловая рыба. В конце XIX-ого века в низовьях Амура ее вылов достигал 580 т. (Никольский, 1956). Запасы калуги были подорваны еще на рубеже XIX-ого и XX-ого веков. Лов осуществлялся самоловной крючковой снастью и крупноячеиными сетями-аханами. К 30−40-м годам XX-ого века уловы упали до 30−80 т. С 1958 г. в бассейне Амура со стороны России промысел осетровых был запрещен, и стадо калуги стало постепенно восстанавливаться.

С 1976 г. открыт строго регламентированный ее промысел в лимане, а с 1991 г. и в русле Амура. Общая численность особей калуги старше одного года в русле и лимане Амура составляет сейчас 100−130 тыс. экз. Промысловый запас лиманной калуги в настоящее время оценивается примерно в 1000 т. Если лиманная форма находится в относительно благополучном состоянии, то этого нельзя сказать о ее речных группировках. Калуга, как и все виды осетровых, включена в Красную книгу МСОП.

Зейско-бурейская популяция калуги занесена в Красную книгу Российской Федерации (2001) (категория 1). Её численность в возрасте 2 года и старше, видимо, не превышает 2000 экз. и неуклонно сокращается. Основная причина снижения численности — чрезмерный вылов в китайских водах и браконьерство в нашей стране, загрязнение вод Амура и его притоков и добыча гравия на нерестилищах калуги. Необходимо заключение межгосударственного соглашения с Китаем об охране редких видов, строительство рыбозавода для искусственного разведения и усиления борьбы с загрязнением вод бассейна Амура для сохранения и увеличения численности популяций.

1.1.3 Гены ядерной 18S рДНК

Рибосомная ДНК (рДНК) кодирует рибосомные РНК, которые, совместно с рибосомными белками, образуют рибосомы, т. е. структуры, на которых происходит синтез белков. В эукариотических клетках три гена рРНК расположены вместе, в одной транскрипционной единице: 18S — ген малой субъединицы, 28S — ген большой субъединицы, и ген 5. 8S рРНК (рис. 7). При транскрипции образуется единая цепь рРНК, которая затем разделяется на три отдельные молекулы. Транскрипционные единицы рДНК могут находиться на нескольких хромосомах как тандемно-повторенные последовательности. Местом локализации рДНК на хромосомах являются ядрышкообразующие регионы (ЯОР). Количество копий рибосомной ДНК может меняться от одной, как у Tetrahymena (Yao, Gall, 1997), до нескольких сотен и даже тысяч у высших эукариот (Apples et al., 1980). С 5'-конца гены рРНК ограничены внешним транскрибируемым спейсером (ETS), кодирующие участки разделены двумя внутренними транскрибируемыми спейсерами (ITS-1 и ITS-2). Межгенный спейсер (IGS) разделяет тандемные повторы транскрипционных единиц рибосомной ДНК. В отличие от консервативных кодирующих участков, спейсеры, особенно межгенные, эволюционируют быстро, преимущественно за счет замены оснований, а также делеций, инсерций, или дупликаций сегментов ДНК (Arnheim, 1983).

Хотя гены рРНК играют важную роль в эволюционном процессе, из-за большого количества их копий существовало мнение, что эти гены могут эволюционировать независимо. Однако исследования показали, что семейства генов рРНК эволюционирует не-независимо. Внутри одной особи или одного вида копии рДНК идентичны, различия наблюдаются при сравнении семейств рибосомных генов между видами. Процесс гомогенизации повторенных последовательностей носит название согласованной эволюции (Arnheim et al., 1980; 1983).

Действие согласованной эволюции не направлено непосредственно на создание множества копий генов рРНК, полностью идентичных друг другу. Действительно, с накоплением информации о генах рибосомальной РНК появляются данные об организмах, в геноме которых существуют множественные варианты рДНК. Гены рРНК являются наиболее консервативными вследствие функциональных ограничений. Самым консервативным признается ген 18S рРНК (Hillis, Dixon, 1991). Участки рибосомных генов показывают наибольшую (если не полную) гомогенность последовательностей у организмов и видов в целом. Однако существуют и исключения. Например, два варианта рДНК были найдены у паразитического простейшего Plasmodium (см.: Dame et al., 1984; Gunderson et al., 1987; Waters et al., 1989; Qari et al., 1994). Предполагают, что они специфичны к стадиям развития. Позже, у плоского червя Dugesia mediterranea были обнаружены два типа гена 18S рРНК (Carranza et al., 1996). Однако, в отличие от Plasmodium, у него наблюдается экспрессия только одного варианта гена. Две различные последовательности 16S рРНК были найдены у четырех видов бактерий (Liefting et al., 1996; Wang et al., 1997; Reischel et al., 1998; Yap et al., 1999), а также у архебактерии Haloarcula marismortui (Mylvaganam, Dennis, 1992). Следует отметить, что присутствие двух вариантов гена РНК малой субъединицы рибосом у бактерий не аналогично двум вариантам гена 18S рРНК в геноме эукариот, поскольку рибосомные гены прокариот не образуют тандемных повторов.

Филогенетическая ценность гена РНК малой рибосомной субъединицы состоит в том, что он, с одной стороны, имеет консервативные участки, позволяющие провести выравнивание последовательностей различных видов, даже в случае низкой степени их родства. С другой стороны, вариабельные участки гена являются филогенетически информативными и используются для определения филогенетических отношений между родственными видами (Hillis, Dixon, 1991) и таксонами высокого ранга.

Проведенное исследование гена 18S рРНК у 10 видов северо-американских осетровых рыб выявило, что у некоторых из них наблюдается множественность аллелей исследуемого гена (Krieger, Fuerst, 2002). В результате частичного секвенирования 33 клонов гена малой субъединицы озерного осетра (A. fulvescens) было обнаружено 17 вариантов последовательностей. Эти варианты были полностью секвенированы и из 1783 сайтов 159 показали изменчивость. В тоже время, секвенирование гена 18S рРНК веслоносов (Polyodon spathula) не выявило наличия генных вариантов. При сравнении последовательностей обнаружено, что лишь один из клонов 18S рДНК озерного осетра является наиболее близким к последовательности гена веслоносов, отличаясь от него всего одной нуклеотидной заменой. Исследователи полагают, что множественные варианты рибосомных генов появились у осетровых после расхождения семейств Acipenseridae и Polyodontidae.

Существует несколько вероятных причин наличия у осетровых рыб множественности аллелей гена 18S рРНК. Первая — это тканеспецифичность генных вариантов. По данным Кригер с соавторами (Krieger et al., 2004) Af-7 является основным вариантом, экспрессируемым в тканях печени. В других тканях в качестве основных аллелей могут выступать другие варианты. Для проверки этой гипотезы необходимо детальное исследование экспрессии рРНК во всех тканях осетровых рыб. Однако самим исследователям этот вариант не кажется приемлемым, т.к. при наличии, как минимум, 17 вариантов гена 18S рРНК, следует предположить наличие 17 типов тканей, использующих эти варианты. Маловероятно, что такому количеству тканей необходимо столько вариантов специально адаптированных рибосом. Хотя возможность того, что несколько вариантов все же могут быть тканеспецифичными полностью исключить нельзя. Тогда зачем нужны остальные аллели? Если допустить, что все 17 вариантов действительно тканеспецифичны, то вероятность того, что клон Af-7 экспрессируется только в печени равна 1 к 17, или около 6% (Krieger, 2002).

Второй возможной причиной данного феномена может являться специфичность некоторых, а возможно и всех, вариантов к стадиям развития организма. Например, у малярийного плазмодия существует два типа рРНК, поскольку его цикл развития проходит через две стадии (Dame et al., 1984; Gunderson et al., 1987; Waters et al., 1989; Quari et al., 1994; Rogers et al., 1995). Поскольку осетровые рыбы не имеют подобных стадий развития, то необходимость нескольких вариантов 18S рРНК можно допустить лишь для анадромных видов. Но ареал озерного осетра, у которого впервые и был обнаружен этот феномен, ограничен пресными водами Великих и некоторых других озер юга Канады. Очевидно, что данная гипотеза также не подходит для объяснения множественности аллелей гена 18S рРНК. Основным фактором, способствующим происхождению и поддержанию множественности копий гена 18S рРНК, по мнению большинства авторов, считается полиплоидная природа генома осетровых рыб (см.: Dingerkus, Howell, 1976; Birstein, Vasiliev, 1987; Birstein et al., 1993; Blacklidge, Bidwell, 1993; Fontana, 1994; Fontana et al., 1998).

Происхождение множества копий гена 18S рРНК может быть следствием полиплоидизации генома осетровых рыб, развивавшейся по одному из двух путей. Во-первых, полиплоидизация, в результате межвидовой гибридизации, могла свести вместе различные родительские аллели, вызвав тем самым внутри-индивидуальную изменчивость. Однако маловероятно, что наличие такого феномена связано только с комбинацией родительских аллелей (Krieger, 2002). Для этого необходимо, чтобы в родительских геномах также содержались различные копии гена 18S рРНК. Существуют данные (Birstein, DeSalle, 1998), что у предков осетровых рыб внутри-индивидуальная изменчивость этих генов отсутствовала. Альтернативный путь может заключаться в том, что в результате авто- или аллополиплоидизации увеличилось число хромосом и кластеров рДНК. Ослабленное действие отбора позволило некоторым из копий рДНК стать нефункциональными вариантами, поскольку не все копии гена 18S рРНК необходимы для обеспечения жизнедеятельности клетки.

Инактивация некоторых локусов рДНК в процессе диплоидизации полиплоидных геномов осетров могла стать еще одной причиной появления множественных вариантов гена 18S рРНК, поскольку действие отбора на инактивированные кластеры рДНК ниже, чем на функциональные аналоги (Krieger, 2000). Подвергшиеся диплоидизации полиплоидные виды имеют дуплицированный геном, но уровень экспрессии генов тот же, что и у диплоидов (Ohno, 1970; Leipoldt, 1983). Происходит это путем инактивации избыточных копий генов полиплоидного генома для поддержания нормального уровня экспрессии генов. Избыточные копии также могут подвергаться функциональной модификации, превращаясь в новые локусы (Ohno, 1970). Накопление мутаций в копиях может, в конечном счете, привести или к ослаблению экспрессии гена или к созданию новых функциональных локусов (Krieger, 2000). В некоторых случаях, инактивированный генетический материал может с течением времени элиминироваться из генома, уменьшая его размер (Hinegardner, 1976; Ferris, Whitt, 1977).

Очевидно, что некоторые повторы рДНК должны сохранять свою консервативность для нормальной жизнедеятельности клетки. Наличие функциональных последовательностей гена 18S рРНК A. fulvescens говорит о том, что механизмы согласованной эволюции, в некоторой степени, воздействуют на повторы рДНК. Тогда почему действие согласованной эволюции не распространяется на все повторы рДНК, как это происходит у большинства организмов? Точного ответа на этот вопрос пока не существуют, но данные анализа изменчивости гена 18S рРНК озерного осетра (Krieger, 2000; Krieger et al., 2002, 2004) позволяют сделать некоторые предположения о факторах, влияющих на согласованную эволюцию. Работа этих факторов, возможно, согласована.

Одно из предположений заключается в том, что с момента возможной гибридизации/полиплоидизации прошло меньше времени, чем требуется механизмам согласованной эволюции для гомогенизации рДНК, или скорость гомогенизации ниже ожидаемой. Если детальное исследование всех ЯОР позволит обнаружить в них большинство из зарегистрированных вариантов гена 18S рРНК, это будет являться доказательством протекающего процесса гомогенизации рДНК у осетровых рыб.

Интересным является тот факт, что у веслоносов, также имеющих полиплоидный геном (Dingerkus, Howell, 1976), внутри-индивидуальная изменчивость 18S рРНК отсутствует (Krieger, Fuerst, 2002, 2004). Для объяснения эволюции осетровых рыб Васильевым (Vasil'ev, 1999) был предложен возможный сценарий сетчатого видообразования. По его мнению, различные виды могли произойти в разное время и к настоящему времени достигнуть различных уровней функциональной и структурной диплоидизации. Если полиплоидные веслоносы произошли раньше, чем осетровые рыбы, у них могло быть больше времени для диплоидизации, освобождающей геном от нефункциональных последовательностей рДНК (гипотеза 1). Накопление мутаций в некоторых кластерах рДНК могло препятствовать отжигу праймеров, делая невозможным дальнейшую амплификацию (гипотеза 2). Более раннее происхождение веслоносов могло дать согласованной эволюции достаточно времени для гомогенизации всех последовательностей рДНК в геноме (гипотеза 3). Во втором случае вариантные аллели все еще могут существовать, но мутации не позволяют обнаружить их методами PCR-анализа. Уровень диплоидизации в этом случае можно измерить путем аллозимного анализа. Если экспрессия дуплицированных генов все еще имеет место, они проявятся на геле в виде дополнительных полос. Такой анализ был проведен для Polyodon spathula (Carlson et al., 1982) и атлантического осетра (A. stellatus) (Ryabova, Kutergina, 1990). Результаты исследований выявили различный уровень диплоидизации у этих видов. Уровень экспрессии дуплицированных локусов был наибольшим у веслоноса — 6% (высший уровень диплоидизации) и наименьшим у атлантического осетра — 31% (низший уровень диплоидизации). Эти данные согласуются с наблюдаемой у осетров изменчивостью гена 18S рРНК. Они также согласуются с предположением о том, что диплоидизация у веслоносов шла более интенсивно, чем у осетров (возможно в результате более раннего происхождения). Пониженная изменчивость гена у рода Scaphirhynchus может указывать на меньшее число вариантов гена 18S рРНК, что позволяет прочитать последовательность напрямую с PCR продукта. Вполне возможно, что лопатоносы являются промежуточной стадией диплоидизации между осетрами и веслоносами. Проверить вышеупомянутые гипотезы можно путем окрашивания серебром и флуоресцентной in situ гибридизацией ЯОР.

Четвертая гипотеза может состоять в том, что локусы рДНК у веслоносов имеют другое, нежели у осетровых, положение на хромосомах, что, в свою очередь, позволяет механизмам согласованной эволюции гомогенизировать все варианты последовательностей в один (Krieger, 2000). Количество и расположение кластеров рДНК веслоносов к настоящему времени неизвестно, но если они находятся на нескольких гомологичных хромосомах, взаимодействие между ними в процессе мейоза может облегчить гомогенизацию вариантов рДНК. Как и в предыдущем случае, эту гипотезу можно проверить серебряным окрашиванием ЯОР.

1.1.4 Согласованная эволюция

Большая часть генома эукариот — это повторяющиеся последовательности, в частности, более трети генома человека состоит как из отдельно, так и тандемно-повторяющихся последовательностей ДНК, которые могут занимать до 10% генома, большинство из которых — некодирующие. Геномная организация повторяющихся последовательностей ДНК может быть разной: 1. короткие последовательности, включенные в разные части генома (SINEs), длинные последовательности, включенные в разные части генома (LINEs), и мобильные элементы, как гены тРНК и гены гистонов, которые могут группироваться в одном или нескольких участках хромосом. Мультигенные семейства, в том числе рибосомная РНК (рРНК), малые ядерные РНК (мяРНК), а также некодирующие последовательности, такие как мини- и микросателлитной ДНК, часто расположены в тандеме. Несмотря на обилие повторяющихся ДНК в геноме эукариот, их биологические функции остаются неясными. Однако, большинство повторяющихся последовательностей, будь то кодирующие или некодирующие, проявляют неожиданные свойства: они развиваются согласованным образом. Хотя, тандемные повторы сравниваются в пределах вида, а не между видами, предполагается, что они развиваются независимо друг от друга.

Молекулярный процесс, который приводит к усреднению тандемно-повторяющихся последовательностей ДНК, называется «согласованной эволюцией». Согласованная эволюция — это универсальным биологическим механизмом эволюции. У многих видов, начиная от бактерий, заканчивая млекопитающими, до настоящего времени процесс гомогенизации генов не закончен. Например, расхождение между тандемами генов 16S рДНК разных штаммов Е. coli. всего лишь 0,192%, тогда как между E. сoli и H. influenzae — 5,90%. Но в большинстве организмов согласованная эволюция завершилась. Механизм гомогенизации хорошо описан на примере локуса RNU2 приматов, который кодирует U2 мяРНК. Было доказано, что повторы гена U2, появившиеся у древних родственников приматов, стабилизировались более 35 миллионов лет и эволюционировали в согласованной форме в различных линиях приматов. В частности, обезьяны Старого Света (бабуины, макаки) имеют повторяющуюся единицу U2 размером 11 т.п.н. (тысяч пар нуклеотидов), в то время как гоминоиды (гиббоны, орангутанги, гориллы и шимпанзе) и люди имеют размер этого же блока 6 т.п.н. Впоследствии было доказано, что разница в 5 т.п.н. повторяющегося U2 блока между обезьянами Старого Света и гоминоидами связана с удалением 5 т.п.н. последовательности из 6 т.п.н. провируса, оставив длинный концевой повтор (LTR) в 1 т.п.н. Таким образом, согласованной эволюцией распространяется делеция более 5 т.п.н. из одного повтора всех копий в геноме гоминоидов. Согласованная эволюция также наблюдалась в белок-кодирующих мультигенных семействах, например, кодирующих гистоны и убиквитин, а также в некодирующих последовательностях, начиная от огромных альфа-сателлитных до простых повторов.

Огромное сходство повторяющихся последовательностей внутри вида, а не между видами, может свидетельствовать о том, что существуют механизмы, поддерживающие гомогенным состав тандемных повторов. Внутривидовые гомогенные тандемные последовательности считаются результатом ряда рекомбинаций ДНК, репараций, репликаций, генных конверсий, амплификаций и неравного кроссинговера между повторяющимися последовательностями.

Недавние исследования мультигенного семейства, кодирующего мяРНК U2 и рРНК заставили иначе взглянуть на механизмы согласованной эволюции. Человеческий локус RNU2 состоит из нескольких тандемных повторов длинной 6,1 т.п.н. и находится только в одном участке хромосомы 17q21−22, только на конце локуса BRCA1 (рис. 1). Число копий гена U2 изменяется в широких пределах отдельных лиц и населения, начиная от 5 до более 30 копий в тандеме, что свидетельствует о высоком уровне рекомбинаций внутри или между локусами RNU2. Анализ нескольких полиморфных маркеров показал, что отдельные повторы гена U2 являются полностью однородными для конкретных полиморфных аллелей, хотя различные аллели каждого маркера могли произойти в любой комбинации. Таким образом, гомогенизация последовательностей происходила, в основном, вдоль хромосомных линий. С учетом этих результатов, предполагается, что основной движущей силой согласованной эволюции тандемно-повторяющихся мультигенных семейств является внутрихромосомная гомогенизация. Межхромосомные генетические обмены встречаются гораздо реже и протекают по типу генной конверсии.

При изучении полиморфизма внутреннего транскрибируемого спейсера в популяциях дрозофилы Drosophila melanogaster показано, что индивидуальные последовательности рДНК в разных полиморфных аллелях гомогенизированы. Это указывает на более высокие скорости внутрихромосомных рекомбинаций по сравнению со скоростью рекомбинаций между гомологичными хромосомами.

Специфические механизмы, ответственные за внутрихромосомную гомогенизацию, неизвестны, но в любой внутрихромосомной конверсии генов или неравном обмене сестринских хроматид (unequal sister-chromatid exchange — USCE), в принципе, происходят внутрихромосомные рекомбинации по механизму согласованной эволюции. Из-за отсутствия взаимного обмена в маркерах, фланкирующих тандемный массив, наиболее вероятным механизмом межхромосомного генетического обмена является генная конверсия. Генной конверсией является нереципрокная передача генетической информации между аналогичными последовательностями, в которых обмена фланкирующими участками ДНК не происходит. Генная конверсия очень точна, она приводит к гомогенизации только специфических регионов ДНК, таких как кодирующие последовательности (при этом наличие малых фланкирующих последовательностей не требуется для эффективной генной конверсии). Частота межхромосомной конверсии генов не должна быть высокой. Это доказывает, что генная конверсия ответственна за гомогенизацию диспергированных генов у бактерий и дрожжей. Таким образом, разумно предположить, что генная конверсия является общим механизмом, который ответственен за согласованную эволюцию всех диспергированных генов.

Рис. 1. Модель молекулярного механизма согласованной эволюции. А) Организация тандемных повторов человеческого гена U2 мяРНК (локус RNU2). На схеме показаны элементы, содержащиеся в повторе гена U2, включая две тандемно-повторенные последовательности Alu, LTR, СТ-микросателлит и урезанный элемент L1. Кодирующий регион U2 мяРНК обозначен белой стрелкой. D — DraI, Eco — EcoRI, H2 — HincII, H3 — HincIII, K — KpnI. B) Модель консеративной эволюции на примере мультигенных семейств.

На схеме показано две тандемно-повторяяющихся последовательности, включающих их фланкирующие ДНК. Кодирующие последовательности обозначены белыми стрелками, а межгенные спейсеры — линиями. Фланкирующие последовательности двух массивов отмечены или заштрихованным или черным прямоугольником.

Динамика распространения видоспецифичных мутаций будет зависеть от скорости рекомбинации внутри и между хромосомами и будет предметом как естественного отбора так и случайного генетического дрейфа. Одна из точек зрения гласит, что согласованная эволюция мультигенных семейств не может быть просто результатом стохастических рекомбинаций, но, скорее, может отражать требования клетки к гомогенности повторяющихся последовательностей.

Механизм согласованной эволюции, описанный выше, основан на исследованиях мультигенных семейств. Модель гомогенизации, относящаяся к повторяющимся некодирующим ДНК, неизвестна, хотя теоретически согласованная эволюция повторяющихся последовательностей некодирующей ДНК может, по большому счету, проходить через подобные механизмы. Тем не менее, важно иметь в виду, что, хоть некоторые повторяющиеся некодирующие последовательности обладают очевидной однородностью, многие из них могут отображать активную амплификацию и транспозицию, а не активную гомогенизацию последовательностей. Прекрасным примером является анализ мультигенных семейств иммунной системы позвоночных.

Дублирование ДНК последовательности считается основным источником новых генов в эволюции. Дублированные гены могут расходиться и приобретать новые функции, или они могут стать функционально инактивированными и оставаться в геноме как псевдогены. Третьим вариантом может быть сохранение их в первоначальном виде; последним вариантом гомогенизации этих последовательностей выступает согласованная эволюция, чтобы замедлить генетическое и функциональное разнообразие. Очевидно, что появление генетического разнообразия показывает, что процесс гомогенизации не является универсальным. Теперь ясно, что не все повторяющиеся семейства подвергаются согласованной эволюции, как обсуждалось выше (Nei et al., 1997).

Согласованная эволюция — это фундаментальный процесс, происходящий во всех организмах. Изучение мультигенных семейств, таких как рДНК и мяРНК в различных популяциях является необходимым для получения полезной информации о динамике мультигенов из популяций, что даст ключ к разгадке механизма согласованной эволюции (D. Liao, 1999).

1.2 Краткая характеристика используемых методов и маркеров

1.2.1 Полимеразная цепная реакция

Полимеразная цепная реакция — это метод, имитирующий естественную репликацию ДНК и позволяющий обнаружить единственную специфическую молекулу ДНК в присутствии миллионов других молекул. Открытие метода полимеразной цепной реакции (PCR) стало одним из наиболее выдающихся событий в области молекулярной биологии за последние десятилетия, что позволило поднять молекулярную биологию на качественно новый уровень.

Впервые состав реакционной смеси для постановки полимеразной цепной реакции, и принципы использования праймеров (коротких искусственно синтезированных цепочек ДНК) для получения копий ДНК были описаны в 1971 году. Однако тогда еще не была продемонстрирована основная черта PCR — экспоненциальное увеличение количества копий фрагмента исходной ДНК как результат реакции.

В 1983 году Кэрри Мюллисом (Mullis, 1983) был предложен метод, ставший в дальнейшем известным как полимеразная цепная реакция. Суть метода заключается в многократном копировании (амплификации) в пробирке определенных участков ДНК в процессе повторяющихся температурных циклов. На каждом цикле амплификации синтезированные ранее фрагменты вновь копируются ДНК-полимеразой. Благодаря этому происходит многократное увеличение количества специфических фрагментов ДНК в миллиарды раз, что значительно упрощает дальнейший анализ.

Полимеразная цепная реакция — метод амплификации ДНК in vitro, с помощью которого, в течение нескольких часов, можно выделить и размножить определённую последовательность ДНК в миллиарды раз. Возможность получения огромного количества копий одного строго определённого участка генома значительно упрощает исследование имеющегося образца ДНК.

Для проведения полимеразной цепной реакции необходимо соблюдение ряда условий:

— Наличие в реакционной смеси следующих компонентов:

1 Праймеры — искусственно синтезированные олигонуклеотиды, имеющие, как правило, размер от 15 до 30 п.н., идентичные соответствующим участкам ДНК-мишени. Они играют ключевую роль в образовании продуктов реакции амплификации;

2 Taq-полимераза — термостабильный фермент, обеспечивающий достраивание 3'-конца дочерней цепи ДНК согласно принципу комплементарности;

3 Смесь дезоксинуклеотидтрифосфатов (дНТФ), (дАТФ), (дГТФ), (дЦТФ) и (дТТФ) — «строительный материал», используемый Taq-полимеразой для синтеза второй цепи ДНК;

4 Буфер — смесь различных компонентов в определенной концентрации, обеспечивающих оптимальные условия для реакции, а также стабильное значение pH;

5 Анализируемый образец — подготовленный к внесению в реакционную смесь препарат, содержащий искомую ДНК, служащую мишенью для последующего многократного копирования. При отсутствии ДНК-мишени специфический продукт амплификации не образуется.

— Циклический температурный режим.

Если в анализируемом образце присутствует искомая ДНК, то в процессе реакции амплификации с ней происходит ряд событий, обеспечиваемых определенными температурными циклами. Каждый цикл амплификации состоит из трех этапов, описанных ниже:

Денатурация. На первом этапе необходимо денатурировать ДНК, находящуюся в образце. Для этого реакционную смесь нагревают до 92−95°С, в результате чего двухцепочечные молекулы ДНК расплетаются с образованием двух одноцепочечных молекул.

Отжиг. На втором этапе праймеры присоединяются к одноцепочечной ДНК-мишени. Этот процесс носит название «отжиг» («annealing»). Праймеры выбирают так, что они ограничивают искомый фрагмент и комплементарны противоположным цепям ДНК. Отжиг происходит в соответствии с правилом комплементарности Чаргаффа. Если это правило не соблюдено, то отжига праймеров не происходит.

Элонгация (синтез). На третьем этапе температуру в реакционной смеси доводят до оптимума работы Taq-полимеразы (72°С), и синтез дочерней цепи продолжается с максимальной эффективностью.

В дальнейшем этапы денатурации, отжига и элонгации многократно повторяются (30 и более раз). На каждом цикле количество синтезированных копий фрагмента ДНК удваивается.

Результатом циклического синтеза является экспоненциальное увеличение количества специфического фрагмента ДНК. Фактически же значение эффективности отдельных циклов амплификации составляет 78−97%. В случае присутствия в пробе ингибиторов реакции это значение может быть намного меньше. Специфические фрагменты, ограниченные на концах праймерами, впервые появляются в конце второго цикла, накапливаются в геометрической прогрессии и очень скоро начинают доминировать среди продуктов амплификации.

1.2.2 Автоматическое секвенирование ДНК с флуоресцентной меткой

Автоматическое секвенирование с помощью флуоресцентно меченых дидезокситерминаторов является последним достижением в области PCR-секвенирования ДНК на сегодняшний день. В 1986 году Худ с соавторами предложили метод секвенирования ДНК, в котором радиоактивное мечение, авторадиография и визуальное чтение нуклеотидов были заменены, соответственно, на флуоресцентные метки, чтение нуклеотидов с помощью лазера, индуцирующего эти метки и компьютерную обработку данных (Smith et al., 1986; Hood et al., 1987). Предложенный метод заключался в том, что к секвенирующему праймеру присоединяли одну из четырех флуоресцентных меток и запускали в реакцию с определенным типом дидезоксинуклеотидтрифосфатами (ддНТФ) и остальными дезоксинуклеотидтрифосфатами (дНТФ). Одновременно проводилось четыре таких реакции с каждым из ддНТФ и праймером, несущим одну из четырех флуоресцентных меток. После этого продукты реакций разделялись в полиакриламидном геле высокого разрешения. На пути миграции меченых фрагментов располагался четырехцветный лазерный детектор, который индуцировал каждую из меток. Флуоресцентный сигнал сразу же передавался на компьютер, где обрабатывался компьютерной программой, после чего выводился окончательный результат — нуклеотидная последовательность фрагмента ДНК. Позже этот метод был модифицирован Пробером с соавторами (Prober et al., 1987), предложившим наносить метку на дидезокситерминаторы вместо праймеров. Для каждого из ддНТФ был разработан флуоресцентный краситель своего цвета со смещенной длиной испускаемой волны. Такой способ мечения дидезокситерминаторов позволил осуществлять проведение циклической PCR в одной микропробирке, содержащей все четыре ддНТФ и электрофорез на одной дорожке геля (Prober et al., 1987). В начале 90-х годов были разработаны новые флуоресцентные красители для ддНТФ, которые представляли собой производные родамина (dichloroROX для ddG, dichloroR6G для ddA, dichloroR110 для ddC и dichloroTAMRA для ddT); был усовершенствован этап электрофореза и детекции меченых продуктов. Также в начале 90-х годов Свердлов сообщил об успешном применении капилляров, для электрофореза при секвенировании ДНК. Капилляр представлял собой микротрубочку с внутренним диаметром 50 мкм, заполненный полиакриламидным гелем. Такой капилляр позволял более эффективно разгонять меченые PCR продукты из-за высокого значения соотношения площади поверхности к объему трубки. Электрофорез при этом осуществлялся при высоком напряжении, что позволило существенно сократить время «чтения» цепи ДНК. Вскоре капиллярный электрофорез был также усовершенствован посредством использования специального полимера низкой вязкости, способного заполнять пространство капилляра при относительно низком давлении (Ruiz-Martinez et al., 1993). Это свойство наполнителя сыграло ключевую роль в полной автоматизации секвенирования ДНК. Полиакриламидный гель — это так называемый поперечно-связанный полимер (гель, представляющий собой сеть из продольных и поперечных стабилизирующих связей) с высокой степенью вязкости. Заменить такой полимер представлялось невозможным, поэтому смена капилляра с полимером осуществлялась вручную. Специальные полимеры, например POP-4, не имеют поперечных стабилизирующих связей, поэтому их вязкость достаточно низка, что позволяет автоматически заменять его после пробега реакционной пробы, не меняя капилляра. Кроме того, такой полимер сохраняет свою структуру при температуре до 60 °C, что обеспечивает высокое качество данных секвенирования (Zhang et al., 1995).

2. Материалы и методы

Материалом для исследования послужили 4 образца осетровых рыб из природных популяций реки Амур (Хабаровский филиал ТИНРО-центра).

2.1 Получение геномной ДНК

ДНК получали из печени, фиксированной в 80% этаноле. Печень гомогенизировали в ТЕ-буфере (0. 01 М TRIS, 0.5 M EDTA, ph=8. 0), экстракцию проводили по стандартной методике (Маниатис и др., 1984) с использованием протеиназы К и последующей депротеинизацией фенолом и хлороформом, а также переосаждением изопропиловым и этиловым спиртами. Фиксированную ткань подвергали трехкратной промывке в 70% спирте, с последующей двухкратной промывкой в растворе SSC (0. 15 M NaCl + 0. 015 M цитрат Na) +0.1 М ЭДТА, pH=8.0. Затем ткань гомогенизировали в этом же растворе с последующим добавлением 10% SDS до 1%. Экстракцию ДНК из печени проводили также. Для проведения PCR геномную ДНК растворяли в ТЕ-буфере и хранили при +4°С.

2.2 PCR-амплификация 18S рДНК

Для аплификации полноразмерного гена малой рибосомной субъединицы использовали праймеры, разработанные для озерного осетра. PCR-амплификацию проводили в 20 мкл реакционной смеси, содержащей 100 мМ Tris-HCl (pH=8. 3), 500 мМ KCl, 0. 25 мМ каждого dNTP, 90 нг тотальной ДНК, 10 pM каждого праймера, 1.5 мМ MgCl2 и 1 ед. смеси Taq/Pfu (8/1). Условия реакции: начальная денатурация — 94°C-3 мин, затем 35 циклов — 94°С-1 мин, 55°C-2 мин, 68°C-4 мин; дополнительный синтез 72°C-15 мин. Реакция завершалась охлаждением смеси до 4 °C.

Рис. 2. Транскрипционная единица рДНК в тандемных повторах различных (гомологичных и/или негомологичных) хромосом. ETS — внешний транскрибируемый спейсер, ITS — внутренний транскрибируемый спейсер; IGS — нетранскирибируемый спейсер. На детализации РНК малой рибосомной субъединицы показаны использованные для амплификации и секвенирования праймеры, а также их ориентация (по Krieger, Fuerst, 2002).

Таблица 1. Список использованных праймеров.

Праймер

Последовательность (5'3')

Tm (°C)

Направление

570

gctattggagctggaattac

46. 0

Обратный

570C

gtaattccagctccaatagc

46. 0

Прямой

892C

gtcagaggtgaaattcttgg

46. 0

Прямой

1262

gaacggccatgcaccac

52. 4

Обратный

1200C

caggtctgtgatgccc

42. 9

Прямой

18S — Pg — f

caacctggttgatcctgccagt

68. 0

Прямой

18S — Pg — r

ctgatccttctgcaggttcacctac

65. 0

Обратный

2.3 Клонирование 18S pДНК

Клонирование проволили через встраивание по липким концам с использованием InsT/Aclone PCR Product Cloning Kit (Fermentas) (рис. 3−4).

Лигирование осуществляли в 16 мкл смеси, содержащей до 5 ед. Т4 ДНК-лигазы, 2 мкл плазмидного вектора, 5 мкл PCR-продукта, 3 мкл 10X буфера, 1.5 мкл полиэтиленгликоля (PEG 4000) и 2.0 мкл АТФ. Смесь инкубировали при 22 °C от 2 до 16 часов.

Процедура клонирования включала следующие этапы:

1. Бактериальную культуру подращивали в среде С-medium около 1 часа.

2. Готовили раствор TransformAidTM T-solution путем смешивания равных объемов компонентов, А и В. Готовый раствор хранился на льду;

3. Среду с бактериями центрифугировали при 7000 оборотах 1 минуту при 4 °C, супернатант сливали;

4. Бактериальный осадок ресуспендировали в 300 мкл T-solution, и ставили на 5 мин на лед;

5. Клетки повторно центрифугировали при тех же условиях, супернатант сливали;

6. Осадок ресуспендировали в 120 мкл T-solution, и ставили на 5 мин на лед; 2.5 мкл лигированной смеси также ставили на лед на 2 мин;

7. В пробирку с лигированной смесью добавляли 50мкл бактерий в T-solution, пробирку ставили на лед на 5 мин, после чего клетки высевали на чашку с LB-ампицилиновым агаром и ставили в термостат, разогретый до 37 °C на 16−18 часов.

Рис. 3 Схема плазмидного вектора pTZ57R/T. MCS — универсальный сайт для клонирования

Рис. 4. Схема лигирования по липким концам (T/A-клонирование)

Проверку наличия вставки проводили путем амплификации с праймерами М13 (-20) (Синтол) при следующих условиях: начальная денатурация — 96°С-5 мин, затем 30 циклов — 96°С-30 сек, 55°С-30 сек, 72°С-4 мин. Завершалась программа дополнительным синтезом в течение 40 минут.

ПоказатьСвернуть
Заполнить форму текущей работой