МикроРНК: малые молекулы с большим значением

Тип работы:
Реферат
Предмет:
Медицина


Узнать стоимость

Детальная информация о работе

Выдержка из работы

Клин. онкогематол. 2015- 8(1): 1−12
ОН!
ГЕМАТОЛОГИЯ
Klin. Onkogematol. 2015- 8(1): 1−12
OIUC'-w
HEMATOLOGY
ОБЗОРЫ
REVIEWS
МикроРНК: малые молекулы с большим значением
ВН. Аушев
ФГБНУ «Российский онкологический научный центр им. Н.Н. Блохи-на», Каширское ш., д. 24, Москва, Российская Федерация, 115 478
РЕФЕРАТ

Ключевые слова: микроРНК, регуляция экспрессии, онкомаркеры.
MicroRNA: Small Molecules of Great Significance
V.N. Aushev
N.N. Blokhin Russian Cancer Research Center, 24 Kashirskoye sh., Moscow, Russian Federation, 115 478
ABSTRACT
МикроРНК были впервые обнаружены как антисмысловые транскрипты у нематоды Caenorhabditis elegans, где они подавляли экспрессию генов, содержащих в мРНК комплементарные последовательности. Таким образом, данные молекулы наряду с короткими интерферирующими микроРНК являются основными медиаторами РНК-интерференции — универсального механизма регуляции экспрессии.
МикроРНК представляют собой небольшие молекулы, транскрибируемые с геномной ДНК и подвергающиеся дальнейшему процессингу и экспорту в цитоплазму. Они могут входить в состав транскриптов, кодирующих белки, либо транскрибироваться с белок-некодирующих участков. Первичный процессинг может осуществляться с участием специализированного ферментного комплекса либо в ходе стандартного сплайсинга мРНК. После экспорта в цитоплазму промежуточный продукт подвергается окончательному процессингу с образованием активного РНК-белкового комплекса, способного связываться с комплементарными участками мРНК-«мишеней». Результатом такого связывания является подавление трансляции с данной мРНК. Сама мРНК во многих случаях может быть расщеплена за счет РНКазной активности комплекса. В геноме человека закодировано несколько тысяч микроРНК, образующих обширную регуляторную сеть, которая задействована в самых разных сигнальных путях и клеточных процессах. Нарушения микроРНК-регуляции вовлечены в развитие широкого спектра заболеваний, включая все типы неоплазий. МикроРНК имеют большое значение в онкологии, в частности в онкогематологии, как перспективные маркеры и потенциальные терапевтические агенты. К настоящему времени показано участие отдельных микроРНК в патогенезе большинства заболеваний системы крови. В ряде случаев предлагается использовать данные молекулы в качестве средств молекулярной диагностики и для определения прогноза заболевания.
MicroRNAs were first discovered as antisense transcripts in Caenorhabditis elegans nematodes, where they inhibited expression of genes containing complementary sequences in mRNAs. Therefore, these molecules, along with the short interfering microRNAs are main mediators of RNA interference, which is a universal mechanism of regulation of the expression.
MicroRNAs are small molecules transcribed from genomic DNA, undergoing further processing and exported to the cytoplasm. They can be a part of protein-coding transcripts or may be transcribed from non-coding areas. Primary processing can also be realized either by the specialized enzyme complex, or as a part of standard mRNA splicing. After exporting to the cytoplasm, intermediate RNA product undergoes final processing resulting in formation of an active RNA-protein complex capable of binding to complementary sequences of target mRNAs. Ultimate effect of such binding is the suppression of translation from the target mRNA- the latter can often be split due to the RNase activity of the complex. Several thousand microRNAs are encoded in human genome, forming a large regulatory network involved in various signaling pathways and cellular processes. Malfunction of microRNA regulation are typical for a wide range of diseases and all types of malignancies. MicroRNAs are of great importance in oncology, including oncohematology as perspective cancer biomark-ers and potential therapeutic agents. Involvement of some microRNAs in the development of a broad range of hematopoietic diseases has been demonstrated to date. In a number of cases it is recommended to use these molecules for molecular diagnosing and for determining prognosis of the disease.
Получено: 16 июля 2014 г. Принято в печать: 7 октября 2014 г.
¦ Keywords: microRNA, regulation of expression, tumor biomarkers.
Received: July 16, 2014 Accepted: October 7, 2014
© 2015 практическая медицина
Для переписки: Василий Николаевич Аушев, канд. биол. наук, Каширское ш., д. 24, Москва, Российская Федерация, 115 478- тел.: +7(499)324−17−64- e-mail: vaushev@gmail. com
Для цитирования: Аушев В. Н. МикроРНК: малые молекулы с большим значением. Клин. онкогематол. 2015- 8(1): 1−12.
For correspondence: Vasily Nikolaevich Aushev, PhD, 24 Kashirskoye sh., Moscow, Russian Federation, 115 478- Tel.: +7(499)324−17−64- e-mail: vaushev@gmail. com
For citation: Aushev V.N. MicroRNA: Small Molecules of Great Significance. Klin. Onkogematol. 2015- 8(1): 1−12 (In Russ.).
ВВЕДЕНИЕ
В конце 50-х годов прошлого века была впервые сформулирована так называемая центральная догма молекулярной биологии, постулирующая основное направление реализации генетической информации в клетке по трем уровням: от ДНК к РНК и далее к белку. Все дальнейшие открытия лишь дополняли эту схему и добавляли новые детали. Сложные системы регуляции клеточных процессов также описываются как модификации и взаимодействия на указанных уровнях. Например, на белковом уровне важную роль играют различные посттрансляционные модификации, включая фосфорилирование/де-фосфорилирование, убиквитинирование и т. п. На уровне ДНК регуляция осуществляется за счет метилирования, изменения доступности хроматина. Наконец, широко распространенным механизмом регуляции является изменение активности транскрипционных факторов.
Считается, что около 75% ДНК в геноме человека транскрибируются, т. е. служат матрицей для синтеза РНК. Однако лишь 3% ДНК кодируют РНК, с которой в дальнейшем будут синтезированы какие-либо белки [1], т. е. большая часть РНК в клетке является некоди-рующей. Функции некодирующих РНК долгое время оставались неизвестными, и лишь относительно недавно стало выясняться их возможное значение.
Обнаружение нового масштабного уровня регуляции активности генов с помощью малых некодирующих молекул — микроРНК — можно уверенно считать одним из наиболее выдающихся открытий в биологии последнего десятилетия. К настоящему времени стало очевидным, что подавление экспрессии генов с участием микроРНК является исключительно важным универсальным механизмом, широко вовлеченным в большинство внутриклеточных сигнальных путей у множества эукариотических организмов.
Нарушения этого механизма обнаруживаются при самой разной патологии человека, в первую очередь в развитии неоплазий. В данном обзоре приводятся некоторые основные вехи изучения микроРНК, современные представления об их функционировании в клетке, а также о роли микроРНК в развитии отдельных онкогематологических заболеваний, их диагностике и терапии.
ОТДЕЛЬНЫЕ ЭТАПЫ ИЗУЧЕНИЯ И СОВРЕМЕННЫЕ ЗНАНИЯ О МИКРОРНК
??п-4,?е1−7 и другие — первые открытые микроРНК
Первые работы, описывающие микроРНК, были опубликованы в 1993 г. коллективами под руководством V. Ambros и G. Ншкип, изучавшими механизмы регуляции развития нематоды СаепогНаЬйШз elegаns [2, 3]. Ранее было известно, что гены Ип-4 и Ип-14 у С. elegans являются антагонистами. Мутации этих генов по отдельности вызывают противоположные фенотипические эффекты, а в сочетании — компенсируют друг друга [4]. Исследования V. Ambros и G. Ruvkun показали, что Ип-4 не кодирует никаких белков, а его эффекты опосредуются небольшим РНК-транскриптом данного гена. Эта РНК была комплементарна нескольким участкам в 3'--нетранслируемой области (З'-иТН) гена Ип-14 (рис. 1), причем именно взаимодействие с этим участком подавляло экспрессию белкового продукта Ип-14. Так, впервые был продемонстрирован новый механизм подавления экспрессии с помощью антисмысловой РНК.
Несмотря на фундаментальную значимость сделанного открытия, в течение последующих 7 лет не было опубликовано других крупных работ в этом направлении и было неясно, является ли обнаруженный механизм специфичным
мРНК lin-14
(О 2 3
5 // «cds
микроРНК lin-4
5'- UGUGA 3
t
пре-микроРНК lin-4
5 GLtCCUGU & quot-UGUALlJA
3'- Сг GGAC^^. GGG^CUCU^GGGU^CACACUUCGTJ^
JATJGUUAAAAUCAGGAA
AGUGUGA AGUCCU 3'- 5'-
ucc
(A)n 3'-
Рис. 1. МикроРНК lin-4 и ее мишень — мРНК lin-14 (цит. по [5]). Красным отмечена последовательность микроРНК, синим — мРНК CDS — белок-кодирующая последовательность- (A)n — полиаденилированный участок.
Fig. 1. mRNA of lin-4 and its target — mRNAlin-14 (cited according to [5]). The microRNA sequence is marked with red, the mRNA sequence is marked with blue
CDS — protein-coding sequence- (A)n — polyadenylated fragment.
2
Клиническая онкогематология
для C. elegans или же он присущ и другим организмам. В 2000 г. также в лаборатории G. Ruvkun была открыта еще одна сходная пара генов C. elegans: короткая (21 ну-клеотид) РНК гена let-7 была комплементарна 3'-UTR гена lin-41 и успешно подавляла его экспрессию [6]. В отличие от lin-4 последовательность let-7 оказалась одинаковой для широкого диапазона организмов — от насекомых до человека, что стимулировало активное изучение данного феномена разными группами исследователей.
В 2001 г. был впервые использован термин «мик-роРНК» (microRNA, miRNA). К этому времени был уже открыт другой класс малых РНК — короткие интерферирующие (short interfering RNA, siRNA), опосредующие процессы РНК-интерференции (RNA interference, RNAi). В журнале «Science» в 2001 г. были опубликованы результаты трех исследовательских групп, обнаруживших более сотни новых РНК, подобных lin-4 и let-7, и предложено называть их микроРНК [7−9]. Открытие микроРНК заставило исследователей из самых разных областей по-новому подойти к задаче определения генетических детерминантов, показав, что нужно искать не только «типичные» белок-кодирующие гены, но и возможные некодирующие РНК-продукты, в т. ч. и совсем короткие.
miR-15/miR-16 — факторы развития хронического лимфолейкоза
История изучения хронического лимфолейкоза (ХЛЛ) примечательна тем, что это заболевание было первым
описанным примером участия микроРНК в развитии злокачественной опухоли. ХЛЛ известен как злокачественное лимфопролиферативное заболевание, характеризующееся в первую очередь значительным повышением уровня В-лимфоцитов в крови, обусловленное патологической пролиферацией моноклональной популяции атипичных ^5+/^19+/^23 +) В-лимфоцитов. Достаточно давно был обнаружен и ряд генетических дефектов, характерных для ХЛЛ: делеции ёе1(17р) (5−10% наблюдений), ёе1(1Ц) (5−10%), трисомия хромосомы 12 (около 20%), ёе1(^) (около половины случаев). Однако детальные механизмы развития заболевания оставались практически неизвестными. В частности, при подробном изучении генов, расположенных на участке с de1(13q), не выявлено ни одного белок-кодирующего гена, определяющего возникновение ХЛЛ. Ситуация изменилась, когда с открытием микроРНК стали обращать внимание на некодируемые (точнее, не кодирующие белки) элементы генома. Анализируя известные последовательности ДНК, группа под руководством К. Кроче (С. Сгосе) обнаружила, что участок с de1(13q) содержит среди прочего две ранее обнаруженные микроРНК: ш1Н-15 и miR-16 [10]. Интересно, что находились они внутри гена БЬЕи2, между его 1-м и 2-м экзонами (рис. 2). Как и другие гены этого локуса, БЬЕи2 был уже ранее изучен и функциональных белковых продуктов для него обнаружено не было. Оказалось, что miR-15 и miR-16 активно экспрессируются во многих типах клеток, включая нормальные В-лимфоциты
Рис. 2. Картирование участка, кодирующего miR-15a/miR-16, в локусе 13q. Желтым обозначены отдельные гены, расположенные в данном участке. Для гена DLEU2 зеленым отмечены экзоны, синим — участки, кодирующие предшественники микроРНК, miR-16−1 и miR-15a. Розовым цветом и подчеркиванием обозначена часть последовательности, соответствующая зрелой микроРНК (цит. по [10])
Fig. 2. Mapping of a fragment coding miR-15a/miR-16 at 13q genomic locus. Individual genes located in this fragment are marked with yellow. As for the DLEU2 gene, exons are marked with green, and fragments coding miR-16−1 and miR-15a microRNAs progenitors are marked with blue. A fragment of the sequence corresponding to a mature microRNA is marked with pink and underlined (cited according to [10])
I I
13q14. 12 13q14. 2
¦ ¦! ¦ ¦ ¦ ¦¦ I ¦¦ ¦
50 Mb
D13S1150 D13S272
51 Mb
CLLD7
CLLD8
(SETDB2)
D13S1150 (WI-6333)
(RCBTB1)
D
CLLD6
DLEU2
DLEU1
KCNRG
«
DLEU7
(SPRYD7) |leu5 (TRIM13)
50 600 kb
D13S272 (AFM120XA3)
KCNRG
DLEU1 50 700 kb
Ex5 Ex4 DLEU2
ШЖ
11
~ггг~г
I
50,623,100
I miR-16−1 miR-15a & lt-_ -
DLEU2 — интрон 6
-------50,623,700
]
TCAGCAGCACAGTTAATACTGG AG ATAATTTTAG AATCTTAA CG CCAATATTTACGTGCTGCTAA AGTCGTCGTGTCAATTATGACC TCTATTAAAATCTTAGAATT GCGGTTATAAATGCACGACGAT T
4 4 4 4
3'- agucgucgugucaauuaugaccucuauuaaaaucuuagaauugcgguuauaaaugcacgacgauu
3'- 5'-
u a u u aaaa
agucgucgug ca uuaugacc cauu u
llllllllll II IIIIMII I III uuagcagcac gu aauauugg g uaa c
— a c u gauu
пре-микроРНК miR-16−1
j. medprint. ru
3
hsa-miR-16-l (локус 13ql4)
а с u gauu
g u aauauugg g uaa с
ag с
5* gucagc ugc uuagcagcac
111(11 III I I Il11 I I I I II I I I I I II I I III 3* caguug aug agucgucgug ca uuaugacc с auu u ga a u a u u aaaa
hsa-miR-16−2 [локус 3qZ5]
uc cu ua с ag aau
gu cacu agcagcacg aauauugg gu uga a II lilt I I I I I I I I I I I I I I I I I I I III
ca guga ucgucgugu uuauaacc ca auu u gu uu ca a -a aua

miR-16-Sp
5'- uagcagcacguaaauauuggcg3'- «(miR-16) 35
miR-16-l-3p
5'- ccaguaLiuaacugugcugcLiga 3'- 56 (miR-16−1*)
miR-16-Sp
5'- uagcagcacguaaauauuggcg 3'- 10 (miR-16)
miR-16−2-3p
5'- ccaauauuacugugcugcuuua 3'- 5J (miR-16−2*)
Рис. 3. Номенклатура микро-РНК на примере miR-16
Fig. 3. MicroRNA nomenclature by example of miR-16
CD5+, однако их экспрессия отсутствует или значительно подавлена в большинстве случаев ХЛЛ, а также в ряде опухолевых линий [10]. Таким образом, было впервые продемонстрировано участие микроРНК в развитии опухолевых заболеваний. Следует отметить, однако, что потеря экспрессии miR-15/miR-16 характерна далеко не для всех случаев ХЛЛ. Более того, на момент публикации описанного исследования К. Кроче и соавт. не было выяснено, какие именно гены являются мишенями этих микроРНК.
Современная классификация и номенклатура микроРНК
Исторически первые открытые микроРНК были обозначены в том же стиле, как «обычные» гены C. elegans: lin-4 и let-7. Однако в дальнейшем возникла необходимость введения специальной номенклатуры, позволяющей легко обозначать сотни вновь открываемых микроРНК. Так, в одном из исследований было предложено написание «miR-» с числовым индексом в порядке открытия (miR-1, miR-2 и т. д. — для РНК-продуктов- mir-1 и т. д. — для кодирующих их генов) [9]. Близкие гомологи обозначаются одинаковым числом с добавлением маленькой латинской буквы (например, miR-2a, miR-2b). Для указания идентичных микроРНК, закодированных в разных позициях генома, добавляется дополнительное число через дефис (например, mir-2b-1, mir-2b-2) — для let-7 и lin-4 сохранены их изначальные наименования. Эти правила были в дальнейшем приняты научным сообществом и дополнительно описаны в публикации, устанавливающей нормы аннотации вновь открываемых микроРНК [11]. Когда стало понятно, что из шпилечной структуры микроРНК-предшественника зрелая микроРНК может происходить из любой цепи, стали использовать дополнительный суффикс -5p или -3p в случаях, когда обе цепи равнозначны, либо звездочку (*) для обозначения минорной цепи (рис. 3).
На рис. 3 приведено обозначение микроРНК на примере miR-16. В геноме человека имеется два участка, дающих идентичный основной продукт данной микроРНК (UAGCAGCACGUAAAUAUUGGCG), поэтому они обозначаются одинаковым номером hsa-miR-16 с добавлением цифрового суффикса, позволяющего различать геномную локализацию hsa-miR-16−1 для гена на хромосоме 13 и hsa-miR-16−2 для гена на хромосоме 3. Основной продукт микроРНК в этих генах неразличим и обозначается miR-16 (либо miR-16−5p, чтобы показать, из какой цепи пред-
4
шественника он произошел). Другая цепь шпильки-пред-шественника1 также может давать молекулу микроРНК, которая обозначается т1Н-16−1-3р/т1Н-16−2-3р (в название включают суффиксы -1/-2, т. к. последовательности в разных локусах отличаются), либо т1Н-16−1*/т1Н-16−2* (звездочка означает, что данный продукт минорный, т. е. представлен в клетке крайне редко по сравнению с основным) [11].
В связи с возникшей потребностью организовывать и систематизировать информацию об открываемых микроРНК исследователи Сэнгеровского института (Великобритания) создали специализированную базу данных, названную miRBase [12]. В настоящее время база поддерживается Манчестерским университетом и является главным централизованным хранилищем информации, куда в обязательном порядке заносятся все вновь открываемые микроРНК, включая данные об их геномной локализации, последовательности и экспрессии [13]. Названия микроРНК присваиваются в соответствии с описанной выше номенклатурой, дополнительно добавляют сокращенное название организма (например, для человека — hsa-miR-25, hsa-let-7- для мыши — mmu-miR-25- для нематоды — сеЫт-4 и т. п.). Текущая версия базы (выпуск № 21 от июня 2014 г.) содержит сведения о 28 645 микроРНК (из них 2588 человека) и доступна на сайте http: //mirbase. org.
БИОГЕНЕЗ И ФУНКЦИОНИРОВАНИЕ МИКРОРНК
Транскрипция микроРНК-генов, процессинг в ядре
Первым этапом биогенеза микроРНК является транскрипция с ДНК, которая, как правило, осуществляется РНК-полимеразой II — тем же ферментом, который транскрибирует «стандартные» белок-кодирующие гены (рис. 4, А). Более того, очень часто (у человека — в большинстве случаев) участки, кодирующие микроРНК, находятся внутри белок-кодирующих генов. Таким образом, во многих случаях первичным продуктом может выступать обычная матричная РНК. Однако в общем случае РНК-транскрипт, служащий предшественником микроРНК, обозначают как pri-miRNA (от англ. primary — первичная, при-микроРНК).
1 Район РНК, иногда несколько участков, разделенных фиксированными последовательностями и формирующих определенную вторичную структуру — шпильку.
Клиническая онкогематология
(Г) tbicfi
4
мРНК-мишень
miRNA в составе RISC-комплекса
Рис. 4. Основные этапы биогенеза микро-РНК (пояснения в тексте)
Fig. 4. Main stages of microRNA biogenesis (for details, see the text)
МикроРНК чаще закодированы в интронах1, но экзон-локализованные микроРНК также широко распространены2. Единственным обязательным критерием является наличие самокомплементарного участка, способного формировать шпильку на транскрибированной РНК. Такая структура при-микроРНК еще в ядре распознается и отрезается от остального транскрипта ферментным комплексом, включающим белки Drosha (относится к семейству РНКаз III) и Pasha (от partner of Drosha, DGCR8) (рис. 4, Б). В качестве вспомогательных компонентов этого комплекса (называемого также микропроцессором) могут присутствовать хеликазы3 и гетерогенные ядерные рибонуклеопротеиды (hnRNP). Менее распространенным путем является процессинг4 без участия микропроцессора, т. е. за счет механизма сплайсинга. Это происходит в тех случаях, когда область шпильки совпадает с границами вырезаемого интрона.
Результатом процессинга при-микроРНК является фрагмент РНК длиной 60−70 нуклеотидов, называемый pre-miRNA (от англ. precursor — предшественник, пре-микроРНК). Этот фрагмент содержит в своем составе двухцепочечный участок: две самокомплементарных области, соединенные петлей (англ. terminal loop), и
1 Интрон — участок ДНК, не содержащий информации о последовательности аминокислот белка.
2 Экзон — участок ДНК, кодирующий синтез белка.
3 Ферменты, которые разделяют цепи двухцепочечной молекулы ДНК или внутримолекулярные связи в РНК, используя энергию гидролиза АТФ или ГТФ.
4 Изменение РНК или белка, например, белкового антигена, приводящее к образованию функциональной формы из их предшественников.
www. medprint. ru
небольшой одноцепочечный участок на 3'--конце. Совокупность этих элементов распознает белок экспортин-5 в комплексе с малой ГТФазой Ran (рис. 4, В).
Экспорт из ядра и формирование активных комплексов в цитоплазме
После образования комплекса Ran/ГТФ/экс-портин-5/пре-микроРНК происходит его перенос через поры ядерной мембраны в цитоплазму. Здесь, после гидролиза ГТФ, комплекс распадается с высвобождением молекулы РНК [14]. Экспорт из ядра — важный этап биогенеза микроРНК. Его нарушения приводят к снижению уровня функциональных микроРНК в цитоплазме, что наблюдается, например, в ряде опухолей и опухолевых клеточных линий.
В цитоплазме структурные элементы пре-микроРНК — двухцепочечная шпилька и короткий неспаренный участок на ее конце — распознаются ферментом Dicer (рис. 4, Г). Dicer имеет в своем составе домен PAZ (распознает неспаренный конец шпильки), двухцепочечный РНК-связывающий домен, хеликазный домен и два домена с активностью РНКазы III. После связывания и правильного позиционирования Dicer на молекуле пре-микроРНК РНКазные домены вносят два разрыва в РНК возле петли, отрезая ее от шпильки. Образованный двухцепочечный РНК-продукт длиной около 22 нуклеотидов связывается белком Ago2 из семейства Argonaute (рис. 4, Д). Ago2 сам по себе также обладает эндонуклеазной активностью и в случае некоторых ми-кроРНК может осуществлять процессинг пре-микроРНК без участия Dicer.
Из двух цепей РНК, образовавшихся после отщепления петли, только одна (называемая ведущей, guide strand)
5
остается связанной с Ago2, в то время как другая («пассажирская», passenger strand) диссоциирует от комплекса и, как правило, деградирует. Выбор ведущей цепи определяется структурой самого дуплекса: большую вероятность остаться в комплексе с Ago2 имеет цепь, несущая неспаренный участок на своем 5'--конце. Комплекс Ago2 с единичной цепью РНК, а также белком GW182 обозначается как miRISC (от miRNA-induced silencing complex).
Подавление активности генов-мишеней
RISC-комплекс в цитоплазме обеспечивает главный эффект микроРНК — подавление экспрессии генов, мРНК которых имеет участок, комплементарный последовательности микроРНК. Такие гены называются мишенями для данной микроРНК. Важнейшим этапом в выборе мишени является распознавание в мРНК последовательности, которая была бы комплементарна со 2-го по 8-й нуклеотид микроРНК. Последние образуют так называемую ключевую последовательность (seed sequence) микроРНК. Комплементарность (необязательно полная) между ключевой последовательностью микроРНК и последовательностью мРНК обеспечивает посадку RISC-комплекса на мРНК-мишень. Чаще всего такие участки комплементарности в мРНК (сайты связывания микроРНК) находятся в З'--нетранслируемой области, т. е. после белок-кодирующей части (рис. 4, Е).
Посадка RISC-комплекса на мРНК-мишень может иметь разные последствия, которые зависят в т. ч. и от степени комплементарности между микроРНК и мРНК. В случае полной комплементарности включается РНКазная активность Ago2, который разрезает мРНК в месте посадки. Такая РНК быстро расщепляется клеточными рибонуклеазами. Прочие механизмы подавления трансляции не требуют полной комплементарности. В частности, рекрутирование белком GW182 деаденилаз CCR4-NOT и PAN2-PAN3 обеспечивает отщепление от мРНК полиА-сигнала [15], а привлечение белков DCP½ ведет к удалению кэпа [16]. В обоих случаях мРНК становится нефункциональной и в дальнейшем деградирует. Наконец, само по себе нахождение RISC-комплекса на мРНК препятствует посадке и продвижению рибосомы. Следует отметить, что в отдельных случаях микроРНК могут являться не репрессорами, а прямыми активаторами трансляции [17], однако распространенность такого «исключения» пока недостаточно изучена.
Таким образом, микроРНК в составе RISC-комплекса осуществляет «выключение» экспрессии своих генов-мишеней, причем выбор мишеней определяется последовательностью микроРНК, точнее — наличием комплементарной ей последовательности в мРНК. Одна и та же микроРНК может воздействовать на все мРНК, имеющие в своей последовательности соответствующие сайты связывания. Более того, поскольку для посадки RISC-комплекса не требуется полной комплементарности, эти сайты могут иметь слегка различающиеся последовательности. Фактически микроРНК является исключительно универсальным механизмом подавления экспрессии и поэтому задействована в регуляции широкого спектра клеточных процессов (по разным оценкам, от 30 до 60% генов человека являются мишенями микроРНК) [18, 19]. Кроме того, одна мРНК может нести множество сайтов связывания для одной или разных микроРНК, что создает еще больше вариантов для гибкой регуляции их действия.
б
МИКРОРНК В ОНКОГЕМАТОЛОГИИ
Участие в нормальном гемопоэзе
Развитие клеток крови из их предшественников, гемопоэтических стволовых клеток, — сложный многоступенчатый процесс, каждый этап которого подлежит точному и эффективному контролю, где внутренние и внешние факторы определяют способности клетки к пролиферации либо апоптозу, дифференцировке либо сохранению плюрипотентности. Значительная часть этих факторов служит мишенями микроРНК, хотя конкретные пары микроРНК-мишень определены далеко не для всех аспектов гемопоэза. В целом же сеть микроРНК может быть представлена как дополнительный «слой», наряду с белковыми факторами, на карте эволюции клеток крови (рис. 5). Достаточно давно было показано, что экспрессия микроРНК в целом крайне важна для нормального гемопоэза: нокаут (удаление) фермента Dicer приводил к нарушениям в развитии T-клеток [20], а роль Ago2 была продемонстрирована как для лимфоидного, так и эритроидного ряда [21]. Отдельные микроРНК являются стимуляторами или ингибиторами сразу многих этапов гемопоэза. Например, miR-221 и miR-222 действуют как ингибиторы эритропоэза, т. к. их мишенью является рецептор c-kit [22]- miR-24 обладает сходным ингибирующим свойством за счет подавления другого рецептора — ALK4 [23]. Отдельно следует отметить роль miR-155: эта микроРНК кодируется геном BIC1, который активно экспрессируется в тканях различного происхождения [24] и участвует в регуляции пролиферации и дифференцировки как миелоидных, так и эритроидных предшественников [25, 26].
В настоящее время показано участие нескольких десятков микроРНК в тех или иных процессах гемопоэза [27−29].
Роль в различных опухолях кроветворной и лимфоидной тканей
Учитывая столь значительное вовлечение микроРНК в регуляцию гемопоэза, неудивительно было обнаружить их роль в возникновении и прогрессии самых различных опухолей кроветворной и лимфоидной тканей. После уже описанных выше работ, связавших потерю экспрессии miR- 15a/miR-16−1 с развитием ХЛЛ, были проведены другие скрининговые исследования, выявившие большое количество микроРНК, нарушение экспрессии которых было связано с рядом онкогематологических заболеваний [29]. Ниже приведены отдельные примеры таких микроРНК.
Механизм развития хронического лимфолейкоза
при потере miR- 15a/miR-16−1 не до конца изучен, однако предполагается, что эти микроРНК в норме стимулируют апоптоз за счет подавления онкогенов BCL2 и MCL1 [30]. В одной из более поздних работ показано, что непосредственной мишенью этих микроРНК является также онкосупрессор TP53, который в норме активирует экспрессию других микроРНК — miR-34b и miR-34c, мишенью которых, в свою очередь, служит киназа ZAP70 [31]. Таким образом, было найдено объяснение известной ранее ассоциации между делецией 13q и менее агрес-
1 B-cell Integration Cluster- в настоящее время принято название MIR155 host gene, MIR155HG.
Клиническая онкогематология
Рис. 5. Примеры микроРНК, участвующих в регуляции гемопоэза [27]. Зеленым отмечены отдельные транскрипционные факторы, красным — микроРНК. Знаком # указаны микроРНК, роль которых показана на мышиных моделях.
MEP (megakaryocyte-erythroid progenitor) — мегакариоцитарно-эритроидный предшественник- GMP (granulocyte-macrophage progenitor) — предшественник гранулоцитов и макрофагов- ErP (erythroid progenitor) — эритроидный предшественник- MkP (megakaryocyte progenitor) — предшественник мегакариоцитов.
Fig. 5. Examples of microRNA involved in regulation of hemopoiesis [27]. Individual transcription factors are marked with green, and microRNA with red. MicroRNAs whose role has been demonstrated in murine models are marked with #.
MEP — megakaryocyte-erythroid progenitor- GMP — granulocyte-macrophage progenitor- ErP — erythroid progenitor- MkP — megakaryo-cyte progenitor.
сивной формой ХЛЛ. Наблюдающаяся при такой делеции потеря miR-15a/miR-16−1, хотя и способствует развитию патологии за счет подавления MCL1, в то же время повышает уровень TP53, что ведет к активации miR-34b/ miR-34c и подавлению экспрессии ZAP70 (рис. 6). Среди прочих микроРНК, задействованных в развитии ХЛЛ,
www medprint. ru
можно отметить ш1Р-29 и ш1Р-181: их мишенями является онкоген TCL1, повышенная экспрессия которого связана с агрессивным течением болезни [32].
Изменения экспрессии значительного количества микроРНК были показаны в клеточных линиях острого миелоидного лейкоза (ОМЛ) [33]. В этой работе про-
7
TP53 & quot-
miR-15a miR-16−1
N
BCL2.

MCL1
Подавление апоптоза
С
Иматиниб 1
miR-203 J (miR-138)
BCR-ABL 1
(miR-17~92
V
GATA
Рис. 6. Потеря экспрессии miR-15a/miR-16−1 связана с медленным течением хронического лимфолейкоза. ZAP70 (маркер агрессивности заболевания) является мишенью для miR-34, экспрессия которых активируется опухолевым супрессором TP53, который, в свою очередь, служит мишенью miR-15a/ miR-16−1. Соответственно, в отсутствие miR-15a/miR-16−1 повышается активность TP53, который стимулирует экспрессию miR-34, подавляющих ZAP70. Кроме того, потеря miR-15a/miR-16−1 приводит к активации других мишеней — антиапоптотиче-ских белков Bcl-2 и Mcl-1 (цит. по [31])
Fig. 6. Loss of miR-15a/miR-16−1 expression is associated with slow progression of chronic lymphocytic leukemia. ZAP70 (disease aggressiveness marker) is a target of miR-34 whose expression is activated by TP53 tumor suppressor which, in turn, is a target of miR-15a/miR-16−1. Therefore, absence of miR-15a/miR-16−1 increases the activity of TP53 stimulating the expression of miR-34 which suppresses ZAP70. Besides, loss of miR-15a/miR-16−1 leads to activation of other targets, antiapoptotic proteins Bcl-2 and Mcl-1.
демонстрировано развитие ОМЛ у мышей в результате делеции ш1Н-145 и ш1Н-146а. Ранее было описано, что потеря экспрессии этих микроРНК, расположенных на участке 5q, обусловливает такие проявления «5q-синдрома», как умеренная нейтропения и дисплазия мегакариоцитарного ростка [34]. Изучение транслокации 1-(2−11)(р2123), характерной для многих случаев мие-лодиспластических синдромов и ОМЛ, показало, что для этой хромосомной перестройки характерно резкое повышение экспрессии ш1Н-125Ь (один из локусов которой расположен как раз на участке 1Ц24), которая блокирует дифференцировку клеток CD34+ [35]. В дальнейшем была отмечена аналогичная роль 1-(11−14)^2432) [36], а также напрямую продемонстрировано развитие ОМЛ в результате гиперэкспрессии ш1Н-125Ь [37].
Для хронического миелолейкоза характерно падение экспрессии таких микроРНК, как ш1Н-10а [38] и ш1Н-203 (мишенью которых являются АВЫ и ВСН-АВЫ) [39] и повышение экспрессии микроРНК из кластера ш1Н-17~92 (в хронической фазе, но не в стадии бластного криза) [40]. Более того, экспрессия ш1Н-17~92 также напрямую связана с АВЫ. Подавление киназной активности АВЫ с помощью иматиниба либо соответствующих при-
водит к снижению экспрессии микроРНК из этого кластера [40]. Наконец, еще одним репрессором АВЫ оказалась ш1Н-138, которая одновременно служит его мишенью, т. к. экспрессируется под воздействием транскрипционного фактора ОАТА1, подавляемого активностью АВЫ [41] (рис. 7).
Сравнительное исследование ОМЛ и В-клеточного острого лимфобластного лейкоза (В-ОЛЛ) показало, что последний отличается значительной гиперэкспрессией ш1Н-128а и ш1Н-128Ь и сниженной экспрессией Ы-7Ь и ш1Н-223. По утверждению авторов, определения уровня экспрессии всего двух микроРНК было достаточно, чтобы показать с 95%-й точностью отличия ОМЛ от ОЛЛ [42]. В другой работе были обозначены микроРНК-«подписи»
Рис. 7. Взаимосвязь активности BCR-ABL, иматиниба и некоторых микроРНК при хроническом миелолейкозе. мРНК ABL служит мишенью для miR-203 и miR-138, а сам белок ABL, в свою очередь, активирует экспрессию miR-17~92. Экспрессию miR-138 обеспечивает транскрипционный фактор1 GATA, который сам является мишенью ABL1 (цит. по [39−41])
Fig. 7. Interrelation between activities of BCR-ABL, imatinib, and several microRNAs in chronic myeloleukemia. ABL mRNA is a target for miR-203 and miR-138, and the ABL protein itself, in turn, activates the expression of miR-17~92. The expression of miR-138 is provided by GATA transcription factor which is a target for ABL1 (cited according to [39−41])
для различных подтипов ОЛЛ и даже для предсказания чувствительности их к разным видам химиотерапии [43].
Ключевым событием для трансформации B-клеток при лимфоме Беркитта являются хромосомные перестройки с участием локуса 8q24, где расположен онкоген c-MYC. Как правило, вторым участником транслокации является локус генов иммуноглобулинов: тяжелой цепи иммуноглобулина IGH в локусе 14q32, реже — легких цепей к (IGK, локус 2p12) и X (IGL, локус 22q11). Гены иммуноглобулинов в данных клетках активно транскрибируются, поэтому их транслокация к локусу c-MYC ведет к резкому повышению экспрессии последнего, что, в свою очередь, стимулирует постоянную пролиферацию клеток. Предполагается, что такие транслокации могут быть стимулированы специфической цитидиндезами-назой (activation-induced cytidine deaminase, AID) [44]. Ген AID, по-видимому, является мишенью miR-155. На мышиных моделях удаление как самой miR-155, так и сайта ее связывания в гене AID приводило к значительному повышению частоты транслокаций myc-IGH [45]. Таким образом, miR-155 в данных клетках может выполнять функцию онкосупрессора, а потеря ее активности соответственно быть одним из факторов развития лим-фомы Беркитта. Следует отметить, однако, что в других моделях развития онкогематологических заболеваний miR-155 проявляла себя как онкогенная микроРНК (см. ниже).
Для диффузной В-крупноклеточной лимфомы
(ДВКЛ), в отличие от лимфомы Беркитта, чаще характерна гиперэкспрессия miR-155, а не потеря ее экспрессии [46−49]. Экзогенная экспрессия miR-155 в B-лимфоцитах мышей приводила к развитию ДВКЛ-подобной лимфомы [46]. Дальнейшие работы показали, что мишенью miR-155 является инозитолфосфатаза SHIP1, подавление которой ведет к активации сигнального каскада AKT [50, 51], в то время как экспрессия самой miR-155 повышается в ответ на активацию провоспалительным цитокином TNF-a [52]. В то же время при экзогенной экспрессии miR-155 не в зрелых B-лимфоцитах, а в гемопоэтических стволовых клетках
1 Транскрипционный фактор — белок или белковый комплекс, непосредственно не участвующий в каталитическом акте образования РНК, но необходимый для прохождения основных этапов транскрипции и ее регуляции.
Клиническая онкогематология
8
miR-15a miR-16−1
& gt-
VEGF
Ангиогенез
STAT3
Пролиферация опухолевых клеток
Ш «D '-__ т
#7Ц / ^ I
I ----------1 IP5
^ CDK4,
(miR-17~92) M_et I
Г PCA
[ miR-34a J T
(miR-106b)
Рис. 8. Отдельные ключевые регуляторные механизмы, вовлеченные в развитие множественной миеломы [59]. Красные стрелки показывают непрямую активацию посредством «ингибирования ингибитора»: например, miR-21 и miR-17~92 подавляют антипролиферативные факторы PIAS3 и Bim, т. е. в конечном итоге экспрессия этих микроРНК стимулирует пролиферацию
Fig. 8. Individual key regulatory mechanisms involved in development of multiple myeloma [59]. Red arrows present an indirect activation by means of & quot-inhibition of an inhibitor& quot-: e.g., miR-21 and miR-17~92 inhibit PIAS3 and Bim antiproliferative factors, i.e., in the end, expression of these microRNAs stimulates proliferation
наблюдалось нарушение миелопоэза без развития В-клеточных опухолей [53], подтверждая гипотезу о том, что данная микроРНК может выступать как «онкомир» (опсош1Н) либо онкосупрессор в зависимости от клеточного контекста [29]. Анализ профилей экспрессии микроРНК в нормальных лимфатических узлах по сравнению с пораженными фолликулярной лимфомой или ДВКЛ показал, что обе лимфомы характеризуются повышенным уровнем ш1Н-155, ш1Н-210, ш1Н-106а и пониженным уровнем ш1Н-139 и ш1Н-149. Для ДВКЛ была также характерна в среднем повышенная экспрессия ш1Н-17−5р и пониженная — ш1Н-145, ш1Н-150, ш1Н-328, а для фолликулярной лимфомы — повышенная экспрессия ш1Н-9/ш1Н-9*, ш1Н-301, ш1Н-338, ш1Н-213 [54]. Другое крупное исследование профилей экспрессии микроРНК частично подтвердило данные результаты [55].
Одной из ключевых микроРНК в развитии множественной миеломы (ММ) является ш1Н-21. Повышение ее экспрессии было обнаружено в клеточных линиях у пациентов с ММ и моноклональной гаммапатией неясного генеза [56]. Предполагается, что повышение уровня ш1Н-21 в клетках ММ происходит в ответ на активацию БТАТ3 и ведет к подавлению апоптоза [57] (рис. 8). В другой работе было показано, что экспрессия ш1Н-21 в клетках ММ повышается при их совместном культивировании со стромальными клетками костного мозга, в то время как протеасомный ингибитор бортезомиб подавляет экспрессию ш1Н-21 [58]. Кроме того, было обнаружено повышение уровня микроРНК из кластера ш1Н-17~92 и его паралога1 ш1Н-106Ь~25 [56], что предположительно также приводит к подавлению апоптоза в опухолевых клетках [59].
Еще один представитель неходжкинских лимфом, мантийноклеточная лимфома (МКЛ), характеризуется гиперэкспрессией циклина D1 (ген €€N01), обусловленной транслокацией с участием соответствующего ло-куса — обычно 1-(11−14)^1332). Зачастую результатом такой транслокации является укорочение мРНК гена €€N01, при этом теряется сайт связывания ш1Н-15/16 и 17/20, которые в норме подавляют экспрессию данного гена [60, 61]. В то же время экспрессия самих ш1Н-15/16 и ш1Н-17~92 в клетках МКЛ зачастую повышена. Хотя €€N01 и перестает быть их мишенью, остается эффект подавления ими других генов. Например,
1 Паралог — один из двух генов, возникших в результате дупликации исходного гена при хромосомной мутации.
www. medprint. ru
мишенями miR-17~92 являются онкосупрессоры PTEN, PHLPP2 и BIM. Подавление PTEN и PHLPP2 ведет к активации сигнального пути PI3K/AKT, что, в свою очередь, стимулирует пролиферацию клеток МКЛ и придает им устойчивость к химиотерапии [62].
Анализ профилей экспрессии микроРНК при лим-фоме Ходжкина затруднен низкой представленностью собственно опухолевых клеток в пораженных лимфатических узлах. Выделение таких клеток с помощью микродиссекции с последующим анализом уровней микроРНК показало, что в клетках Ходжкина и Березовского-Рид-Штернберга по сравнению с нормальными B-клетками CD77+ подавлена экспрессия miR-520a, miR-200a, miR-614 и повышена экспрессия miR-20a, miR-21, miR-9, miR-155, miR-16 и др. [63]. В остальных работах материалом исследования, как правило, служили клеточные линии либо тотальная ткань лимфатических узлов.
МикроРНК как онкомаркеры
После обнаружения существенных изменений в уровне экспрессии микроРНК при различных заболеваниях естественным образом стало развиваться позиционирование этих молекул в качестве перспективных биомаркеров. К преимуществам микроРНК в этом аспекте можно отнести универсальность детекции, относительную стабильность при хранении образца, высокую чувствительность. Двумя наиболее распространенными методами детекции микроРНК в настоящее время являются полимеразная цепная реакция (ПЦР) в реальном времени и гибридизация с флюоресцентными зондами. В первом случае РНК сначала подвергается обратной транскрипции с образованием ее комплементарной копии (кДНК), которая затем служит матрицей для количественной ПЦР. Сложностью данного подхода в случае микроРНК является их малая длина в сочетании с необходимостью дифференцировать формы, отличающиеся всего несколькими нуклеотидами. Для решения этой проблемы используются, в частности, модифицированные олигонуклеотиды — «закрытые» нуклеиновые кислоты (Locked Nucleic Acids, LNA), которые обеспечивают большую специфичность детекции. В случае гибридизации с флюоресцентными зондами, как правило, амплификация ДНК не проводится, поэтому данный метод обладает меньшей чувствительностью по сравнению с ПЦР.
Основным недостатком микроРНК как биомаркеров считается высокая вариабельность уровня их экспрессии
9
в зависимости от множества факторов. Этим можно объяснить тот факт, что наборы микроРНК-кандидатов, составленные в результате независимых исследований, могут существенно различаться между собой, что свидетельствует о необходимости дополнительной валидации с расширением выборки, строгой стандартизации и статистической обработки. Несмотря на эти сложности, уже сейчас отдельные микроРНК и их сочетания предлагаются в качестве маркеров различных заболеваний и факторов прогноза.
В онкогематологии микроРНК-маркеры позиционируются в основном не для первичного установления заболевания (т. к. это можно осуществить более простыми методами), а для дифференциальной диагностики отдельных подтипов, предсказания течения болезни и чувствительности к терапии.
Уже в ранних работах, посвященных анализу экспрессии микроРНК при ХЛЛ, были не только найдены ми-кроРНК, дифференцирующие нормальные B-лимфоциты от трансформированных клеток, но и отмечено разделение последних на два кластера, отличающихся одновременно профилем микроРНК и уровнем экспрессии ZAP70. Была сформулирована микроРНК-«подпись» (включающая miR-186, -132, -16−1, -102, -29c), ассоциированная с экспрессией мутантной формы IgVH — благоприятного прогностического фактора [64]. В дальнейшем этими же авторами была предложена расширенная «подпись» из 13 микроРНК (высокий уровень miR-15a, -195, -221, -23b, -155, -24−1, -146, -16−1, -16−2- низкий уровень miR-223, -29a-2, 29b-2, -29c), характерная для пациентов с немутированным IgVH, высоким уровнем ZAP70 и неблагоприятным прогнозом [65]. В других работах были найдены микроРНК, предсказывающие чувствительность к флударабину (miR-29a, miR-181a, miR-221) [66].
В случае ОМЛ часть работ была посвящена поиску микроРНК-маркеров, характерных для отдельных подтипов болезни. Так, для случаев с нарушениями CBF (core-binding factor), т. е. подтипов с перестройками t (8−21) и inv (16), была характерна повышенная экспрессия miR-126/126* и пониженная — miR-368 и miR-382. В случаях t (15- 17) наблюдалась противоположная картина плюс повышенная экспрессия miR-224 и пониженная — miR-17−5p и miR-20a [67]. Другое подобное исследование подтвердило высокую значимость miR-382, однако остальные микроРНК-маркеры значительно отличались [68]. Повышенная экспрессия miR-9 была показана как фактор плохого прогноза при ОМЛ [69].
Терапевтический потенциал
Использование микроРНК в терапии различных болезней стало следующим логичным этапом в их изучении. К настоящему времени в одобренную клиническую практику еще не введены препараты, основанные на микроРНК или взаимодействии с ними. Однако работы в этом направлении ведутся крайне интенсивно, и можно ожидать появления подобных средств в ближайшее десятилетие.
Все потенциальные микроРНК-опосредованные терапевтические стратегии можно условно разделить на два подхода: искусственное повышение уровня определенных микроРНК и, напротив, подавление их экспрессии либо активности. Подход первый, как правило, основан на непосредственном введении микроРНК либо их предше-
10
ственников или же на введении генетических конструкций, с которых будет происходить экспрессия микроРНК — последний вариант технически не отличается от других форм генной терапии. Подавление экспрессии микроРНК может осуществляться с помощью антисмысловых молекул1, также вводимых непосредственно либо в форме генетических векторов [70].
Как и для любого другого таргетного средства, одной из наиболее актуальных проблем в использовании РНК является их доставка в клетки. Будучи по своей природе отрицательно заряженными и гидрофильными, молекулы РНК не могут сами по себе преодолеть клеточную мембрану. Кроме того, РНК в естественной среде подвержены быстрому расщеплению нуклеазами, в изобилии содержащимися как внутри клеток, так и в биологических жидкостях. Для решения этих проблем синтезируются РНК с измененной химической структурой, а также применяются вспомогательные молекулярные комплексы для облегчения доставки. Химической модификации подвергается сахарофосфатный остов РНК, в частности, применяют модификацию 2'--гидроксильной группы (2'--0-метилирование [71], фосфотиоатные связи, 2'--фторо/2'--метоксиэтилирование [72]), формирование «мостика» между 2'-- и 4'--атомом (так называемые LNA) либо полную замену сахарофосфатной цепи на остов белкового типа (PNA — peptide nucleic acid, пеп-тидонуклеиновые кислоты). Такие модифицированные цепи не расщепляются эндонуклеазами и благодаря меньшей подвижности связей более специфично соединяются с комплементарной последовательностью. В качестве вспомогательных молекулярных комплексов используются, как правило, липидные соединения, конъюгируемые с микроРНК либо образующие для них мембранные контейнеры — липосомы. Описанные выше химические модификации сахарофосфатного остова наиболее часто применяются для антисмысловых молекул, предназначение которых — связывать на себе молекулы «нежелательных» микроРНК и получивших в связи с этим название «антагомиры» (antagomirs). Несколько менее распространены термины «антимиры» и «блок-миры» (anti-miRs, blockmirs). Термин «РНК-губки» (RNA sponges) используется, как правило, для длинных молекул, в которых мотив2 связывания повторяется несколько раз.
Наиболее известным к настоящему времени примером терапевтического использования микроРНК является препарат миравирсен, предназначенный для лечения гепатита C. Миравирсен относится к LNA-олигонуклеотидам и является антагонистом miR-122, которая необходима для репликации вируса гепатита С. Клинические исследования II фазы показали, что еженедельного подкожного введения препарата было достаточно для значительного снижения вирусной нагрузки. У ряда пациентов титр вируса снизился до неопределяемых значений [73]. В настоящее время продолжаются клинические исследования, направленные на определение эффективности миравирсена у пациентов, нечувствительных к стандартной терапии интерфероном-а и рибавирином [74].
1 Молекулы с комплементарной последовательностью.
2 Мотив — характерная последовательность нуклеотидов.
Клиническая онкогематология
Другой пример микроРНК-терапии, достигшей стадии клинических исследований, — препарат MRX34 компании Mirna Therapeutics (США), являющийся синтетическим аналогом miR-34 в липосомном векторе. В проводимом в настоящий момент исследовании I фазы (NCT01829971) участвуют пациенты с нерезектабельным первичным раком печени, а также другими опухолями с метастазами в печени (в первую очередь лимфомами). Онкосупрессивный эффект miR-34 обусловлен тем, что ее мишенями является целый ряд важных онкогенов, включая с-MYC, MET, BCL2, CDK4 и др. Ранее высокая эффективность miR-34 была продемонстрирована на мышиной модели гепатоцеллюлярного рака [1]. Следует отметить, что онкосупрессивный эффект miR-34, хотя и не столь выраженный, наблюдался также на мышиной модели ММ [75].
Прочие микроРНК-агенты пока находятся на стадии доклинических исследований. Помимо описанных в предыдущих разделах экспериментов in vitro (на клеточных линиях) значимые результаты были получены in vivo на моделях гематологических опухолей у животных. Например, подавление miR-21 и miR-196b с помощью соответствующих «антагомиров» приводило к значительному снижению канцерогенности и повышению выживаемости у иммунокомпетентных мышей с MLL-AF9-индуцированным ОМЛ [76]. На других мышиных моделях ОМЛ была продемонстрирована эффективность внутривенного введения miR-29 [77, 78]. Трансфекция1 miR-150 в опухолевые клетки кожной T-клеточной лим-фомы значительно снижала их инвазивность и способ-ность к метастазированию у иммунодефицитных мышей
[79].
ЗАКЛЮЧЕНИЕ
В настоящее время уже не вызывает сомнений огромная важность микроРНК как универсальных регуляторов экспрессии генов, хотя конкретные мишени и отдельные детали их функционирования во многих случаях еще не определены. В данном обзоре кратко освещены лишь некоторые избранные аспекты системы микроРНК-регу-ляции. Очевидно, что это направление крайне широко и разнообразно и будет активно развиваться в ближайшие годы. Изучение микроРНК необходимо не только для фундаментального понимания механизмов внутриклеточной регуляции, но и имеет высокую практическую ценность в диагностике и терапии широкого спектра заболеваний, что подтверждается недавними работами, направленными на внедрение соответствующих подходов в клиническую практику.
КОНФЛИКТЫ ИНТЕРЕСОВ
Автор заявляет об отсутствии конфликтов интересов.
ИСТОЧНИКИ ФИНАНСИРОВАНИЯ
Работа выполнена при финансовой поддержке Российского фонда фундаментальных исследований. Проект № 14−04−1 846.
1 Трансфекция — процесс введения нуклеиновой кислоты в клетки человека и животных невирусным методом.
ЛИТЕРАТУРА/REFERENCES
1. Ling H, Fabbri M, Calin GA. MicroRNAs and other non-coding RNAs as targets for anticancer drug development. Nat. Rev. Drug Discov. 2013- 12(11): 847−65.
2. Lee R.C., Feinbaum R.L., Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 1993: 75(5): 843−54.
3. Wightman B, Ha I., Ruvkun G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 1993- 75(5): 855−62.
4. Lee R, Feinbaum R, Ambros V. A short history of a short RNA. Cell. 2004: 116(2 Suppl.): S89−92.
5. He L, Hannon G.J. MicroRNAs: small RNAs with a big role in gene regulation. Nat. Rev. Gen. 2004- 5(7): 522−31.
6. Reinhart BJ, Slack F.J., Basson M. et al. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature. 2000- 403(6772): 901−6.
7. Lagos-Quintana M, Rauhut R, Lendeckel W. et al. Identification of novel genes coding for small expressed RNAs. Science. 2001- 294(5543): 853−8.
8. Lau N.C., Lim L.P., Weinstein E.G. et al. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 2001- 294(5543): 858−62.
9. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T. Identification of Novel Genes Coding for Small Expressed RNAs. Science. 2001- 294(5543): 853−8.
10. Calin G.A., Dumitru C.D., Shimizu M. et al. Frequent deletions and down-regulation of micro-RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc. Nat. Acad. Sci. USA. 2002- 99(24): 15 524−9.
11. Ambros V. A uniform system for microRNA annotation. RNA. 2003- 9(3): 277−9.
12. Griffiths-Jones S, Grocock R.J., van Dongen S. et al. miRBase: microRNA sequences, targets and gene nomenclature. Nucl. Acids Res. 2006- 34(Database issue): D140−4.
13. Kozomara A, Griffiths-Jones S. miRBase: integrating microRNA annotation and deep-sequencing data. Nucl. Acids Res. 2011- 39(Database issue): D152−7.
14. Lei E.P., Silver P.A. Protein and RNA export from the nucleus. Dev. Cell. 2002- 2(3): 261−72.
15. Behm-Ansmant I., Rehwinkel J., Doerks T. et al. mRNA degradation by miRNAs and GW182 requires both CCR4: NOT deadenylase and DCP1: DCP2 decapping complexes. Genes Dev. 2006- 20(14): 1885−98.
16. Nishihara T., Zekri L., Braun J.E. et al. miRISC recruits decapping factors to miRNA targets to enhance their degradation. Nucl. Acids Res. 2013- 41(18): 8692−705.
17. Vasudevan S, Tong Y, Steitz J.A. Switching from repression to activation: microRNAs can up-regulate translation. Science. 2007- 318(5858): 1931−4.
18. Wilson R.C., Doudna J.A. Molecular mechanisms of RNA interference. Ann. Rev. Biophys. 2013- 42: 217−39.
19. Friedman R.C., Farh K.K., Burge C.B. et al. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res. 2009- 19(1): 92−105.
20. Cobb B.S., Hertweck A, Smith J. et al. A role for Dicer in immune regulation. J. Exp. Med. 2006- 203(11): 2519−27.
21. O'-Carroll D, Mecklenbrauker I., Das P.P. et al. A Slicer-independent role for Argonaute 2 in hematopoiesis and the microRNA pathway. Genes Dev. 2007- 21(16): 1999−2004.
22. Felli N, Fontana L, Pelosi E. et al. MicroRNAs 221 and 222 inhibit normal erythropoiesis and erythroleukemic cell growth via kit receptor down-modulation. Proc. Nat. Acad. Sci. USA. 2005- 102(50): 18 081−6.
23. Wang Q, Huang Z, Xue H. et al. MicroRNA miR-24 inhibits erythropoiesis by targeting activin type I receptor ALK4. Blood. 2008- 111(2): 588−95.
24. Elton T.S., Selemon H, Elton S.M. et al. Regulation of the MIR155 host gene in physiological and pathological processes. Gene. 2013- 532(1): 1−12.
25. Dagan L.N., JiangX., Bhatt S. et al. miR-155 regulates HGAL expression and increases lymphoma cell motility. Blood. 2012- 119(2): 513−20.
26. Teng G, Hakimpour P., Landgraf P. et al. MicroRNA-155 is a negative regulator of activation-induced cytidine deaminase. Immunity. 2008- 28(5): 621−9.
27. Bissels U, Bosio A, Wagner W. MicroRNAs are shaping the hematopoietic landscape. Haematologica. 2012- 97(2): 160−7.
28. Listowski M.A., Heger E, Boguslawska D.M. et al. microRNAs: fine tuning of erythropoiesis. Cell. Mol. Biol. Lett. 2013- 18(1): 34−46.
29. Lawrie C.H. MicroRNAs in hematological malignancies. Blood Rev. 2013- 27(3): 143−54.
30. Cimmino A, Calin GA, Fabbri M. et al. miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc. Nat. Acad. Sci. USA. 2005- 102(39): 13 944−9.
31. Fabbri M, Bottoni A, Shimizu M. et al. Association of a microRNA/TP53 feedback circuitry with pathogenesis and outcome of B-cell chronic lymphocytic leukemia. JAMA. 2011- 305(1): 59−67.
32. Pekarsky Y, Santanam U, Cimmino A. et al. Tcl1 expression in chronic lymphocytic leukemia is regulated by miR-29 and miR-181. Cancer Res. 2006- 66(24): 11 590−3.
?. medprint. ru
11
33. Starczynowski D.T., Morin R, McPherson A. et al. Genome-wide identification of human microRNAs located in leukemia-associated genomic alterations. Blood. 2011- 117(2): 595−607.
34. Starczynowski D.T., Kuchenbauer F., Argiropoulos B. et al. Identification of miR-145 and miR-146a as mediators of the 5q- syndrome phenotype. Nat. Med. 2010- 16(1): 49−58.
35. Bousquet M., Quelen C., Rosati R. et al. Myeloid cell differentiation arrest by miR-125b-1 in myelodysplastic syndrome and acute myeloid leukemia with the t (2−11)(p21-q23) translocation. J. Exp. Med. 2008- 205(11): 2499−506.
36. Chapiro E., Russell L.J., Struski S. et al. A new recurrent translocation t (11−14)(q24-q32) involving IGH@ and miR-125b-1 in B-cell progenitor acute lymphoblastic leukemia. Leukemia. 2010- 24(7): 1362−4.
37. Bousquet M., Harris M.H., Zhou B. et al. MicroRNA miR-125b causes leukemia. Proc. Nat. Acad. Sci. USA. 2010- 107(50): 21 558−63.
38. Agirre X., Jimenez-Velasco A, San Jose-Eneriz E. et al. Down-regulation of hsa-miR-10a in chronic myeloid leukemia CD34+ cells increases USF2-mediated cell growth. Mol. Cancer Res. 2008- 6(12): 1830−40.
39. Bueno M.J., Perez de Castro I., Gomez de Cedron M. et al. Genetic and epigenetic silencing of microRNA-203 enhances ABL1 and BCR-ABL1 oncogene expression. Cancer Cell. 2008- 13(6): 496−506.
40. Venturini L., Battmer K., Castoldi M. et al. Expression of the miR-17−92 polycistron in chronic myeloid leukemia (CML) CD34+ cells. Blood. 2007- 109(10): 4399−405.
41. Xu C., Fu H., Gao L. et al. BCR-ABL/GATA1/miR-138 mini circuitry contributes to the leukemogenesis of chronic myeloid leukemia. Oncogene. 2012.
42. Mi S., Lu J., Sun M. et al. MicroRNA expression signatures accurately discriminate acute lymphoblastic leukemia from acute myeloid leukemia. Proc. Nat. Acad. Sci. USA. 2007- 104(50): 19 971−6.
43. Schotte D., De Menezes R.X., Akbari Moqadam F. et al. MicroRNA characterize genetic diversity and drug resistance in pediatric acute lymphoblastic leukemia. Haematologica. 2011- 96(5): 703−11.
44. Magrath I. Epidemiology: clues to the pathogenesis of Burkitt lymphoma. Br. J. Haematol. 2012- 156(6): 744−56.
45. Dorsett Y, McBride K.M., Jankovic M. et al. MicroRNA-155 suppresses activation-induced cytidine deaminase-mediated Myc-Igh translocation. Immunity. 2008- 28(5): 630−8.
46. Costinean S., Zanesi N., Pekarsky Y. et al. Pre-B cell proliferation and lymphoblastic leukemia/high-grade lymphoma in E (mu)-miR155 transgenic mice. Proc. Nat. Acad. Sci. USA. 2006- 103(18): 7024−9.
47. Kluiver J., Poppema S., de Jong D. et al. BIC and miR-155 are highly expressed in Hodgkin, primary mediastinal and diffuse large B cell lymphomas. J. Pathol. 2005- 207(2): 243−9.
48. Eis P. S., Tam W., Sun L. et al. Accumulation of miR-155 and BIC RNA in human B cell lymphomas. Proc. Nat. Acad. Sci. USA. 2005- 102(10): 3627−32.
49. Lawrie C.H., Soneji S., Marafioti T. et al. MicroRNA expression distinguishes between germinal center B cell-like and activated B cell-like subtypes of diffuse large B cell lymphoma. International journal of cancer. J. Int. Cancer. 2007- 121(5): 1156−61.
50. O'-Connell R.M., Chaudhuri A.A., Rao D.S. et al. Inositol phosphatase SHIP1 is a primary target of miR-155. Proc. Nat. Acad. Sci. USA. 2009- 106(17): 7113−8.
51. Yamanaka Y., Tagawa H., Takahashi N. et al. Aberrant overexpression of microRNAs activate AKT signaling via down-regulation of tumor suppressors in natural killer-cell lymphoma/leukemia. Blood. 2009- 114(15): 3265−75.
52. Pedersen I.M., Otero D., Kao E. et al. Onco-miR-155 targets SHIP1 to promote TNFalpha-dependent growth of B cell lymphomas. EMBO Mol. Med. 2009- 1(5): 288−95.
53. O'-Connell R.M., Rao D.S., Chaudhuri A.A. et al. Sustained expression of microRNA-155 in hematopoietic stem cells causes a myeloproliferative disorder. J. Exp. Med. 2008- 205(3): 585−94.
54. Roehle A, Hoefig K.P., Repsilber D. et al. MicroRNA signatures characterize diffuse large B-cell lymphomas and follicular lymphomas. Br. J. Haematol. 2008- 142(5): 732−44.
55. Lawrie C.H., Chi J., Taylor S. et al. Expression of microRNAs in diffuse large B cell lymphoma is associated with immunophenotype, survival and transformation from follicular lymphoma. J. Cell. Mol. Med. 2009- 13(7): 1248−60.
56. Pichiorri F., Suh S.S., Ladetto M. et al. MicroRNAs regulate critical genes associated with multiple myeloma pathogenesis. Proc. Nat. Acad. Sci. USA. 2008- 105(35): 12 885−90.
57. Loffler D., Brocke-Heidrich K., Pfeifer G. et al. Interleukin-6 dependent survival of multiple myeloma cells involves the Stat3-mediated induction of mi-croRNA-21 through a highly conserved enhancer. Blood. 2007- 110(4): 1330−3.
58. WangX., Li C., Ju S. et al. Myeloma cell adhesion to bone marrow stromal cells confers drug resistance by microRNA-21 up-regulation. Leuk. Lymphoma. 2011- 52(10): 1991−8.
59. Dimopoulos K., GimsingP., GronbaekK. Aberrant microRNA expression in multiple myeloma. Eur. J. Haematol. 2013- 91(2): 95−105.
60. Chen R.W., Bemis L.T., Amato C.M. et al. Truncation in CCND1 mRNA alters miR-16−1 regulation in mantle cell lymphoma. Blood. 2008- 112(3): 822−9.
61. Deshpande A, Pastore A, Deshpande A.J. et al. 3'-UTR mediated regulation of the cyclin D1 proto-oncogene. Cell Cycle. 2009- 8(21): 3584−92.
62. Rao E., Jiang C., Ji M. et al. The miRNA-17 approximately 92 cluster mediates chemoresistance and enhances tumor growth in mantle cell lymphoma via PI3K/AKT pathway activation. Leukemia. 2012- 26(5): 1064−72.
63. Van Vlierberghe P., De Weer A, Mestdagh P. et al. Comparison of miRNA profiles of microdissected Hodgkin/Reed-Sternberg cells and Hodgkin cell lines versus CD77+ B-cells reveals a distinct subset of differentially expressed miRNAs. Br. J. Haematol. 2009- 147(5): 686−90.
64. Calin G.A., Liu C.G., Sevignani C. et al. MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias. Proc. Nat. Acad. Sci. USA. 2004- 101(32): 11 755−60.
65. Calin G.A., Ferracin M., Cimmino A. et al. A MicroRNA signature associated with prognosis and progression in chronic lymphocytic leukemia. New Engl. J. Med. 2005- 353(17): 1793−801.
66. Moussay E., Palissot V., Vallar L. et al. Determination of genes and microRNAs involved in the resistance to fludarabine in vivo in chronic lymphocytic leukemia. Mol. Cancer. 2010- 9: 115.
67. Li Z., Lu J., Sun M. et al. Distinct microRNA expression profiles in acute myeloid leukemia with common translocations. Proc. Nat. Acad. Sci. USA. 2008: 105(40): 15 535−40.
68. Jongen-Lavrencic M., Sun S.M., Dijkstra M.K. et al. MicroRNA expression profiling in relation to the genetic heterogeneity of acute myeloid leukemia. Blood. 2008- 111(10): 5078−85.
69. Maki K., Yamagata T., Sugita F. et al. Aberrant expression of MIR9 indicates poor prognosis in acute myeloid leukaemia. Br. J. Haematol. 2012- 158(2): 283−5.
70. Ishida M., Selaru F.M. miRNA-Based Therapeutic Strategies. Curr. Anesth. Rep. 2013- 1(1): 63−70.
71. Czauderna F., Fechtner M., Dames S. et al. Structural variations and stabilising modifications of synthetic siRNAs in mammalian cells. Nucl. Acids Res. 2003- 31(11): 2705−16.
72. Davis S., Propp S., Freier S.M. et al. Potent inhibition of microRNA in vivo without degradation. Nucl. Acids Res. 2009- 37(1): 70−7.
73. Janssen H.L., Reesink H.W., Lawitz E.J. et al. Treatment of HCV infection by targeting microRNA. New Engl. J. Med. 2013- 368(18): 1685−94.
74. Qiu Z., Dai Y. Roadmap of miR-122-related clinical application from bench to bedside. Expert Opin. Invest. Drugs. 2014- 23(3): 347−55.
75. Di Martino M.T., Campani V, Misso G. et al. In Vivo Activity of MiR-34a Mimics Delivered by Stable Nucleic Acid Lipid Particles (SNALPs) against Multiple Myeloma. PloS One. 2014- 9(2): e90005.
76. Velu C.S., Chaubey A, Phelan J.D. et al. Therapeutic antagonists of microRNAs deplete leukemia-initiating cell activity. J. Clin. Invest. 2014- 124(1): 222−36.
77. HuangX., Schwind S., Yu B. et al. Targeted delivery of microRNA-29b by transferrin-conjugated anionic lipopolyplex nanoparticles: a novel therapeutic strategy in acute myeloid leukemia. Clin. Cancer Res. 2013- 19(9): 2355−67.
78. Gong J.N., Yu J., Lin H.S. et al. The role, mechanism and potentially therapeutic application of microRNA-29 family in acute myeloid leukemia. Cell Death Differ. 2014- 21(1): 100−12.
79. Ito M., Teshima K., Ikeda S. et al. MicroRNA-150 inhibits tumor invasion and metastasis by targeting the chemokine receptor CCR6 in advanced cutaneous T-cell lymphoma. Blood. 2014- 123: 1499−511.
12
Клиническая онкогематология

ПоказатьСвернуть
Заполнить форму текущей работой