Филогенетический анализ типовых штаммов плесеней roqueforti, camemberti рода Penicillium*

Тип работы:
Реферат
Предмет:
Пищевая промышленность


Узнать стоимость

Детальная информация о работе

Выдержка из работы

УДК 637. 336. 5
Л. А. Остроумов, Т. Н. Садовая, К.В. Беспоместных
ФИЛОГЕНЕТИЧЕСКИЙ АНАЛИЗ ТИПОВЫХ ШТАММОВ ПЛЕСЕНЕЙ ЯОдиЕГОНТГ, СЛМЕМБЕЯТТ РОДА РЕМС1ЬЬШМ*
Исследовано разнообразие в строении последовательности 5. 8, 18, 28S рРНК межгенной области (internal transcribed spacer, внутренний транскрибируемый спейсер или ITS-область) у различных представителей рода Penicillium для выявления внутривидовых различий в последовательностях этих генов и возможности использования результатов данного исследования при молекулярной идентификации близкородственных видов этого рода. Объектами исследования в данной работе являлись нуклеотидные последовательности 5. 8, 18, 28S рРНК межгенной области 7 видов типовых штаммов пенициллов, депонированные в базу данных NCBI. Множественное выравнивание последовательностей и построение филогенетического дерева проведено в программе ClustalW (www. ebi. ac. uk/clustalw/).
Мягкие сыры, плесени видов P. roqueforti, P. camemberti, штамм, филогенетический анализ, нуклеотидные последовательности генов 5. 8, 18, 28S рРНК ITS-области.
Сыры, вырабатываемые с помощью плесневых грибов, составляют небольшой процент от общего производства сыров, но благодаря специфическому, хорошо выраженному вкусу и аромату, нежной консистенции они становятся все более популярными. Они подразделяются на сыры с поверхностным ростом плесневых грибов и сыры с развитием плесневых грибов по всей массе (интерьеру). Из плесневых грибов в сырах первого класса главную роль играет Penicillium camemberti, в сырах второго класса -Penicillium roqueforti [1−3].
Применяемые в сыроделии виды плесневых грибов подробно описаны французскими учеными [2]. Ранее выделяли два вида этого микроорганизма: P. caseicolum (старое название P. candidum), всегда имеющий мицелий белого цвета, и P. camemberti (старое название P. album — белая плесень), мицелий которого сначала белый, а на 10−14 сутки приобретает бледную серо-зеленую окраску. P. camem-berti образует пушистый мицелий. P. caseico-
lum образует мицелий трех видов: плотный, с короткими, тесно перевитыми нитями- с длинными, высокими, свободно расположенными нитями и типа «невшатель» (neufchatel), очень быстро образующийся толстый, бело-желтый мицелий. Последний вариант обладает самой высокой протеолитической и липолитической активностью. В настоящее время P. caseicolum рассматривают как белый мутант P. camemberti. Местом обитания P. camemberti является поверхность некоторых сыров и помещения вырабатывающих эти сыры заводов, особенно камеры для созревания и солильные бассейны. По сравнению с другими видами пенициллов растет медленно: 25−35 мм на сусло-агаре за две недели при 25 оС, причем белый мутант растет более медленно. Время до появления светло-зе-леной окраски мицелия может варьировать в широких пределах (от 4 до 14 суток при 22 оС).
* Работа выполнена в рамках Федеральной целевой программы «Научные и научно-педагогические кадры инновационной России» на 2009−2013 годы.
Большинство штаммов хорошо растет при рН 3,5−6,5, но лишь некоторые, полученные в результате селекции, растут при щелочном рН. По другим данным, нормальный рост наблюдается при рН 3,09,5, оптимальный рН для образования конидий 4,5, для роста мицелия 7,0. P. camemberti образует по крайней мере две протеиназы: кислую (расщепляет 05- и р-казеины) и нейтральную (действует на Р-казеин), две внеклеточные карбоксипептидазы и аминопептидазу с относительно высоким оптимальным рН [4].
Суспензию спор P. camemberti наносят на поверхность сыров с помощью ватного тампона или пульверизатора, а также распыляют в камерах созревания [1]. Физико-химические условия на поверхности сыров неблагоприятны для прорастания спор. Для ускорения развития P. camemberti французские ученые предложили обсеменять поверхность сыров не спорами, а мицелием, который выращивают на сывороточной среде при периодическом перемешивании в течение 1−3 суток. Это на 30% сокращает период между инокулированием сыра и появлением видимого роста плесени на поверхности головки, а также повышает качество сыра.
В отличие от P. camemberti, P. roqueforti широко распространен в природе. Он не имеет ничего общего с P. glaucum, с которым его отождествляли ранее в литературе [2]. Близок к нему P. verrucosum var. cyclopium, который иногда загрязняет культуры плесневых грибов для сыроделия, но PenicШmm roqueforti не имеет запаха, который напоминает запах сырой земли- иногда его называют «запах дикой плесени». Кроме этого, они отличаются морфологическими и культуральными свойствами, отношением к кислороду и углекислому газу, скоростью роста
[4].
Оптимальная температура роста для PeniciШum roqueforti 35−40 оС, но он растет хорошо и при низких температурах. Растет при рН от 3 до 10,5, но при 4,0 лучше, чем при 6,0. Рост не прекращается даже в присутствии молочной кислоты.
Penicillium roqueforti образует внеклеточные кислую и нейтральную протеиназы, расщепляющие Os- и р-казеины [5].
Плесени рода Penicillium (P. album, P. candidum, P. roqueforti и др.) отличаются особенно высокой липазной активностью. В некоторых сырах (рокфор, русский камамбер) липазы микроскопических грибов обеспечивают образование специфического вкуса и аромата в результате выделения летучих жирных кислот при расщеплении жира [4].
Филогенетические связи между живыми организмами могут быть прослежены путем сравнения последовательностей генов и отдельных участков генов, кодирующих рибосомальные РНК. Данные полностью либо частично секвенированных генов рРНК различных видов микроорганизмов поступают в международные базы данных и доступны через компьютерную сеть. В настоящее время методы, основанные на определении нуклеотидной последовательности рибосомальных генов, широко используются для видовой идентификации бактерий.
Метод сравнения последовательностей генов часто используется для определения видовой принадлежности микрофлоры в молочных продуктах. Плесени вида P. roqueforti и P. camemberti используются в качестве культур при производстве мягких сыров.
Целью настоящей работы было исследование разнообразия в строении последовательности 5. 8, 18, 28S рРНК межгенной области (internal transcribed spacer, внутренний транскрибируемый спей-сер или ITS-область) у различных представителей рода Penicillium для выявления внутривидовых различий в последовательностях этих генов и возможности использования результатов данного исследования при молекулярной идентификации близкородственных видов этого рода.
Объектами исследования в данной работе являлись нуклеотидные последовательности 5. 8, 18, 28S рРНК межгенной области 7 видов типовых штаммов пенициллов, депонированные в базу данных NCBI.
Филогенетический анализ, множественное выравнивание последовательностей и построение филогенетического дерева проводили в программе ClustalW (www. ebi. ac. uk/clustalw/).
Прежде всего нами был проведен поиск по базе данных полных нуклеотидных последовательностей
5. 8, 18, 28S рРНК межгенной области типовых представителей плесеней рода Penicillium: P. ca-memberti strain ATCC 10 387 (GQ458039. 1), P. ca-memberti strain MA09-L (GQ458020. 1), P. camemberti strain 95 827 (EU664481. 1), P. camemberti strain 82 331 (EU664463. 1), P. camemberti strain 95 007 (EU664462. 1), P. roqueforti strain ATCC 10 110 (GQ458035. 1), P. roqueforti strain FSU 503 (EU484300. 1) (табл. 1).
Выбранные нами нуклеотидные последовательности использованы для сравнительного филогенетического анализа, результаты которого отражены на рис. 1.
Таблица 1
Номера последовательностей 5. 8, 18, 28S рРНК межгенной области представителей рода Penicillium, депонированные в NCBI
№ п/п Номер последовательности в NCBI Название штамма
1 GQ458039.1 Penicillium camemberti strain ATCC 10 387 18S ribosomal RNA gene, partial sequence- internal transcribed spacer 1, 5. 8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence- and 28S ribosomal RNA gene, partial sequence
2 GQ458020.1 Penicillium camemberti strain MA09-L 18S ribosomal RNA gene, partial sequence- internal transcribed spacer 1, 5. 8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence- and 28S ribosomal RNA gene, partial sequence
3 EU664481.1 Penicillium camemberti strain 95 827 18S ribosomal RNA gene, partial sequence- internal transcribed spacer 1, 5. 8S ribo-somal RNA gene, and internal transcribed spacer 2, complete sequence- and 28S ribosomal RNA gene, partial sequence
4 EU664463.1 Penicillium camemberti strain 82 331 18S ribosomal RNA gene, partial sequence- internal transcribed spacer 1, 5. 8S ribo-somal RNA gene, and internal transcribed spacer 2, complete sequence- and 28S ribosomal RNA gene, partial sequence
5 EU664462.1 Penicillium camemberti strain 95 007 18S ribosomal RNA gene, partial sequence- internal transcribed spacer 1, 5. 8S ribo-somal RNA gene, and internal transcribed spacer 2, complete sequence- and 28S ribosomal RNA gene, partial sequence
6 GQ458035.1 Penicillium roqueforti strain ATCC 10 110 18S ribosomal RNA gene, partial sequence- internal transcribed spacer 1, 5. 8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence- and 28S ribosomal RNA gene, partial sequence
7 EU484300.1 Penicillium roqueforti strain FSU 503 18S ribosomal RNA gene, partial sequence- internal transcribed spacer 1, 5. 8S ribo-somal RNA gene, and internal transcribed spacer 2, complete sequence- and 28S ribosomal RNA gene, partial sequence
60 458 039.1 (50 458 035.1 НДОШ1 С45 802И1 ЕШМ481.1 ЙШ463.1 ЕШ462. 1
Рис. 1. Филогенетическое дерево, основанное на анализе структур фрагментов последовательностей 5. 8, 18, 288 рРНК межгенной области, отражающее родственные связи исследуемых штаммов плесеней рода Penicillium
Семь использованных нами последовательностей
5. 8, 18, 288 рРНК межгенной области двух видов пенициллов распределились в три кластера. На основании сходства последовательностей генов 5. 8, 18, 288 рРНК 1Т8-области, представленного на рис. 1, кластер 1 объединяет в себя четыре вида Penicil-Нит: два вида P. camemberti (вр458 039. 1,
вр458 020. 1) и два вида P. roqueforti (вр458 035. 1, Еи484 300. 1), полные нуклеотидные последовательности которых характеризуются от 99 до 97%-ным сходством- кластер 2 — два вида P. camemberti (ЕШ64 481. 1, ЕШ64 463. 1), полные нуклеотидные последовательности которых характеризуются 98%-ным сходством- кластер 3 — один вид P. camemberti (Еиб64 462. 1).
В табл. 2 представлены результаты уровней подобия внутри каждого кластера филогенетического дерева и между ними.
Столь высокие уровни гомологии последовательности 5. 8, 18, 288 рРНК у видов P. camemberti и P. roqueforti объяснимы наличием всего 12 нуклеотидных замен и 3 мононуклеотидными вставками у
98 98


98
Ч

штамма под номером ОР458 035. 1- наличием всего 13 нуклеотидных замен и 3 монуклеотидными вставками у штамма под номером Еи484 300. 1- наличием всего одной мононуклеотидной вставки у штаммов под номерами ОР458 020.1 и вр458 039.1 (рис. 2).
Таблица 2
Уровень подобия штаммов видов P. camemberti и P. roqueforti
Номер последовательности, А Номер последовательности В Уровень подобия, %
Од458 039.1 Од458 020.1 99
Од458 039.1 Од458 035.1 99
Од458 039.1 ЕИ484 300.1 97
Од458 020.1 Од458 035.1 99
Од458 020.1 ЕИ484 300.1 97
Од458 035.1 ЕИ484 300.1 99
ЕИ664 481.1 ЕИ664 463.1 98
Од458 039.1 ЕИ664 481.1 96
Од458 039.1 ЕИ664 463.1 98
Од458 039.1 ЕИ664 462.1 98
Од458 020.1 ЕИ664 481.1 96
Од458 020.1 ЕИ664 463.1 98
Од458 020.1 ЕИ664 462.1 98
ЕИ664 481.1 ЕИ664 462.1 98
ЕИ664 481.1 Од458 035.1 91
ЕИ664 481.1 ЕИ484 300.1 97
ЕИ664 463.1 ЕИ664 462.1 100
ЕИ664 463.1 Од458 035.1 94
ЕИ664 463.1 ЕИ484 300.1 97
ЕИ664 462.1 Од458 035.1 93
ЕИ664 462.1 ЕИ484 300.1 97
ЕИ664 481. 1 ССТ ОСООААООАТ САТТ АССОАОТ ОАОООСССТ СТ ОООТ ССААССТ СССАСССОТ ОТТТА 86
ЕИ664 463. 1 ССТ ОСООААООАТ САТТ АССОАОТ ОАОООСССТ СТ ОООТ ССААССТ СССАСССОТ ОТТТА 86
ЕИ664 462.1 ССТ ОСООААООАТ САТТ АССОАОТ ОАОООСССТ СТ ОООТ ССААССТ СССАСССОТ ОТТТА 86
0д458 020.1 ССТ ОСООААООАТ САТТ АССОАОТ ОАОООСССТ СТ ОООТ ССААССТ СССАСССОТ ОТТТА 1796
Од458 039.1 ССТ ОСООААООАТ САТТ АССОАОТ ОАОООСССТ СТ ОООТ ССААССТ СССАСССОТ ОТТТА 1800
Од458 035.1 ССТ ОСООААООАТ САТТ АССОАОТ ОАОООСССТ СТ ОООТ ССААССТ СССАСССОТ ОТТТА 1796
ЕИ484 300.1 … ААООАТ САТТ АССОАОТ ОАОООСССТ СТ ОООТ ССААССТ СССАСССОТ ОТТТА 53
ЕИ664 481.1 ТТТТ АССТТ ОТТ ОСТТ СООСОООСССОССТТ ААСТ ООССОССООООООСТ САСОСС СССО 146
ЕИ664 463.1 ТТТТ АССТТ ОТТ ОСТТ СООСОООСССОССТТ ААСТ ООССОССООООООСТ САСОСС СССО 146
ЕИ664 462.1 ТТТТ АССТТ ОТТ ОСТТ СООСОООСССОССТТ ААСТ ООССОССООООООСТ САСОСС СССО 146
Од458 020.1 ТТТТ АССТТ ОТТ ОСТТ СООСОООСССОССТТ ААСТ ООССОССООООООСТ САСОСССССО 1856
Од458 039.1 ТТТТ АССТТ ОТТ ОСТТ СООСОООСССОССТТ ААСТ ООССОССООООООСТ САСОСССССО 1860
Од458 035.1 ТТТ -АССТТ АТТ ОСТТ СООСОООСССОССТТ ААСТ ООССОССООООООТТТАСАСССССО 1855 ЕИ484 300.1 ТТТ -АССТТ АТТ ОСТТ СООСОООСССОССТТ ААСТ ООССОССООООООТТТАСАСССССО 112
ЕИ664 481. 1 ООСССОСОСССОССОААОАСАСССТ СОААСТ СТОТСТ ОААОАТТ ОААОТСТОАОТ ОАААА 206 ЕИ664 463.1 ООСССОСОСССОССОААОАСАСССТ СОААСТ СТОТСТ ОААОАТТ ОААОТСТОАОТ ОАААА 206
ЕИ664 462.1 ООСССОСОСССОССОААОАСАСССТ СОААСТ СТОТСТ ОААОАТТ ОААОТСТОАОТ ОАААА 206
Од458 020.1 ООСССОСОСССОССОААОАСАСССТ СОААСТ СТОТСТ ОААОАТТ ОААОТСТОАОТ ОАААА 1916
Од458 039.1 ООСССОСОСССОССОААОАСАСССТ СОААСТ СТ ОТ СТ ОААОАТТОААОТ СТ ОАОТ ОАААА 1920
Од458 035.1 ООСССОСОСССОССОААОАСАССС-СОААСТ СТ ОТ СТ ОААОААТОС АОТ СТ ОАОААСААА 1914 ЕИ484 300.1 ООСССОСОСССОССОААОАСАССС-СОААСТ СТОТСТ ОААОААТОС АОТ СТ ОАОААСААА 171
Рис. 2. Участки нуклеотидных последовательностей 5. 8, 18, 288 рРНК межгенной области видов P. camemberti и P. roque-/сгИ, содержащие нуклеотидные замены (начало)
EU664481.1 T AT AAATT ATTT AAAACTTT CAACAACGGAT CTCTT GGTTCCGGCAT CGAT GAAGAACGC 266
EU664463.1 T AT AAATT ATTT AAAACTTT CAACAACGGAT CTCTT GGTTCCGGCAT CGAT GAAGAACGC 266
EU664462.1 T AT AAATT ATTT AAAACTTT CAACAACGGAT CTCTT GGTT CCGGCAT CGAT GAAGAACGC 266
GQ458020.1 T AT AAATT ATTT AAAACTTT CAACAACGGAT CT CTT GGTT CCGGCAT CGAT GAAGAACGC 1976
GQ458039.1 T AT AAATT ATTT AAAACTTT CAACAACGGAT CT CTT GGTT CCGGCAT CGAT GAAGAACGC 1980
GQ458035.1 T AT AAATT ATTT AAAACTTT CAACAACGGAT CT CTT GGTT CCGGCAT CGAT GAAGAACGC 1974
EU484300.1 T AT AAATT ATTT AAAACTTT CAACAACGGAT CTCTT GGTTCCGGCAT CGAT GAAGAACGC 231
EU664481. 1 AGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGC 326 EU664463. 1 AGCGAAAT GCGAT ACGT AAT GT GAATT GCAAATT CAGT GAAT CAT CGAGT CTTTGAACGC 326
EU664462.1 AGCGAAAT GCGAT ACGT AAT GT GAATT GCAAATT CAGT GAAT CAT CGAGT CTTTGAACGC 326
GQ458020.1 AGCGAAAT GCGAT ACGT AAT GT GAATT GCAAATTCAGT GAAT CATC GAGT CTTTGAACGC 2036 GQ458039.1 AGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGC 2040 GQ458035.1 AGCGAAAT GCGAT ACGT AAT GT GAATT GCAAATTCAGT GAAT CATC GAGT CTTTGAACGC 2034
EU484300.1 AGCGAAAT GCGAT ACGT AAT GT GAATT GCAAATT CAGT GGAT CAT CGAGT CTTT GAACGC 291
EU664481.1 ACATT GCGCCCCCT GGT ATT CCGGGGGGCAT GCCT GT CCGAGCGT C ATT GCT GCCCTCAA 386 EU664463.1 ACATT GCGCCCCCT GGT ATT CCGGGGGGCAT GCCT GT CCGAGCGT C ATT GCT GCCCTCAA 386
EU664462.1 ACATT GCGCCCCCT GGT ATT CCGGGGGGCAT GCCT GT CCGAGCGT C ATT GCT GCCCTCAA 386
GQ458020.1 ACATT GCGCCCCCT GGT ATT CCGGAGGGCAT GCCT GT CCGAGCGT C ATT GCT GCCCT CAA 2096
GQ458039.1 ACATT GCGCCCCCT GGT ATT CCGGAGGGCAT GCCT GT CCGAGCGT C ATT GCT GCCCT CAA 2100
GQ458035.1 ACATT GCGCCCCCT GGT ATTCCGGGGGGCAT GCCT GT CCGAGCGT C ATT GCT GCCCTCAA 2094 EU484300.1 ACATT GCGCCCCCT GGT ATT CCGGGGGGCAT GCCT GT CCGAGCGT C ATT GCT GCCCTCAA 351
EU664481.1 GCCCGGCTT GT GT GTT GGGCCCCGT CCT CCGAT CT CCGGGGGACGGGCCCGAAAGGCAGC 446
EU664463. 1 GCCCGGCTT GT GT GTT GGGCCCCGT CCT CCGAT CT CCGGGGGACGGGCCCGAAAGGCAGC 446
EU664462.1 GCCCGGCTT GT GT GTT GGGCCCCGT CCT CCGAT CT CCGGGGGACGGGCCCGAAAGGCAGC 446
GQ458020.1 GCCCGGCTT GT GT GTTGGGCCCCGT CCT CCGAT CT CCGGGGGACGGGCCCGAAAGGCAGC 2156
GQ458039.1 GCCCGGCTT GT GT GTTGGGCCCCGT CCT CCGAT CT CCGGGGGACGGGCCCGAAAGGCAGC 2160
GQ458035.1 GCCCGGCTT GT GT GTTGGGT CT CGT CCT CCGAT-TCT GGAGGACGGGCCCGAAAGGCAGC 2153
EU484300.1 GCCCGGCTT GT GT GTT GGGT CTCGT CCT CCGAT-TCT GGAGGACGGGCCCGAAAGGCAGC 410
EU664481.1 GGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGG 506 EU664463.1 GGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGG 506 EU664462.1 GGCGGCACCGCGT CCGGT CCT CGAGCGT AT GGGGCTTTGT CACCCGCT CTGT AGGC CCGG 506
GQ458020.1 GGCGGCACCGCGT CCGGT CCT CGAGCGT AT GGGGCTTT GT CACCCGCT CTGT AGGCCCGG 2216
GQ458039.1 GGCGGCACCGCGT CCGGT CCT CGAGCGT AT GGGGCTTT GT CACCCGCT CTGT AGGCCCGG 2220
GQ458035.1 GGCGGCACCGCGT CCGGT CCT CGAGCGT AT GGGGCTTT GT CACCCGCT CTGT AGGCCCGG 2213
EU484300.1 GGCGGCACCGCGT CCGGT CCT CGAGCGT AT GGGGCTTTGT CACCCGCT CTGT AGGC CCGG 470
EU664481.1 CCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATA 566 EU664463.1 CCGGCGCTT GCCGAT CAACCCAAATTTTT AT CCAGGTT GACCT CGGAT CAGGT AGGGAT A 566
EU664462.1 CCGGCGCTT GCCGAT CAACCCAAATTTTT AT CCAGGTT GACCT CGGAT CAGGT AGGGAT A 566
GQ458020.1 CCGGCGCTT GCCGAT CAACCCAAATTTTT AT CCAGGTT GACCT CGGAT CAGGT AGGGAT A 2276
GQ458039.1 CCGGCGCTT GCCGAT CAACCCAAATTTTT AT CCAGGTT GACCT CGGAT CAGGT AGGGAT A 2280
GQ458035.1 CCGGCGCTT GCCGAT CAACCCAAATTTTT AT CCAGGTT GACCT CGGAT CAGGT AGGGAT A 2273
EU484300.1 CCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATA 530
EU664481.1 CCCGCT GAACTT AAGCAT AT CAAT A. AGCGGAGGACGCGT CCGG-T CCT CGAG 617
EU664463.1 CCCGCT GAACTT AAGCAT AT CAAT A. TCAATAAGC… 600
EU664462.1 CCCGCTGAACTTAAGCATATCAATATCAATAAGCGGAGGAAAAG------------------ 610
GQ458020.1 CCCGCT GAACTTAAGCAT AT CAAT AAGCGGAGGAAAAGAAACCAAC AGGGATT GCCCCAG 2336
GQ458039.1 CCCGCT GAACTTAAGCAT AT CAAT AAGCGGAGGAAAAGAAACCAAC AGGGATT GCCCCAG 2340
GQ458035.1 CCCGCTGAACTTAATCATA------------------------------------------- 2292
EU484300.1 CCCGCTGAACTTAA------------------------------------------------ 544
Pto. 2. Участки нуклеотидных последовательностей 5. S, 1S, 2SS рPHK межгенной области видов P. camemberti и P. ro-queforti, содержащие нуклеотидные замены (окончание)
Исходя из полученных нами данных о филогенетическом родстве пенициллов следует отметить важность точной идентификации и дифференциации видов Penicillium camemberti и Penicillium roqueforti. Таким образом, определение нуклеотидных последовательностей генов 5. 8, 18, 288 рРНК 1Т8-области
может рассматриваться в качестве быстрого и дос товерного подхода к идентификации близкородственных видов плесеней рода Penicillium.
1.колаев, A.M. Технология мягких сыров. — М.: Пищевая промышленность, 1980. — 213 с.
2. Шуази, K. Производство сыра: технология и качество / пер. с фр.- под ред. и с предисл. Г. Г. Шиллера. — М.: Агропром-издат, 1989. — С. 240−270.
3. Сыроделие: технологические, биологические и физико-химические аспекты / под ред. С. А. Гудкова. — 2-е изд., испр. и доп. — М.: ДеЛи принт, 2004. — S04 с.
4. Горбатова, K.K. Физико-химические и биохимические основы производства молочных продуктов. — СПб.: ГИОPД, 2004. — 352 с.
5. Скотт, P. Производство сыра: научные основы и технологии. — СПб.: Профессия, 2005. — 464 с.
ГОУ ВПО кемеровский технологический институт пищевой промышленности", 650 056, Pоссия, г.мерово, б-р Строителей, 47.
Тел. /факс: (3S42) 73−40−40 е-mail: office@kemtipp. ru
SUMMARY
L.A. Ostroumov, T.N. Sadovaya, K.V. Bespomestnykh Phylogenetic analysis of type strains of fungi Roqueforti, Camemberti genus Penicillium
The diversity in the structure of the sequence of 5. 8, 18, 28S rRNA intergenic region (internal transcribed spacer or ITS-region) from various representatives of the genus Penicillium for revealing intraspecific variation in sequences of these genes and the possibility of using the results of this study with Molecular identification of closely related species of this genus. The objects of this study were the nucleotide sequences of 5. 8, 18, 28S rRNA intergenic region 7 of the type strains of Penicillium, deposited in a database of NCBI. Multiple alignment of sequences and construction of phylogenetic tree conducted in the program ClustalW (www. ebi. ac. uk/clustalw/).
Soft cheeses, mold species P. roqueforti, P. camemberti, strain, phylogenetic analysis, nucleotide sequences of genes
5. 8, 18, 28S rRNA ITS-region.
Kemerovo Institute of Food Science and Technology 47, Boulevard Stroiteley, Kemerovo, 650 056, Russia Phone/Fax: +7(3842) 73−40−40 е-mail: office@kemtipp. ru

ПоказатьСвернуть
Заполнить форму текущей работой