Характеристика антицитокиновой активности энтерококков

Тип работы:
Реферат
Предмет:
Медицина


Узнать стоимость

Детальная информация о работе

Выдержка из работы

ISSN 2304−9081
Учредители: Уральское отделение РАН Оренбургский научный центр УрО РАН
Бюллетень Оренбургского научного центра
УрО РАН
2015 * № 3
Электронный журнал On-line версия журнала на сайте http: //www. elmag. uran. ru
© Коллектив авторов, 2015 УДК 579. 61
12 1 1 М. В. Сычева, , Т. М. Пашкова, О. Л. Карташова ,
О.А. Пашинина1, Л.П. Попова1
ХАРАКТЕРИСТИКА АНТИЦИТОКИНОВОЙ АКТИВНОСТИ ЭНТЕРОКОККОВ
1 Институт клеточного и внутриклеточного симбиоза УрО РАН, Оренбург, Россия
2 Оренбургский государственный аграрный университет, Оренбург, Россия
Цель. Изучение распространенности и выраженности антицитокиновой активности у энтерококков как представителей симбиотической микрофлоры кишечника и возбудителей инфекционно-воспалительной патологии (ИВП) у детей.
Материалы и методы. В исследовании использовано 95 штаммов энтерококков, выделенных из кишечника детей при обследовании на дисбиоз, и 41 штамм, выделенный из патологического материала при инфекционно-воспалительных заболеваниях. Идентификацию штаммов осуществляли с помощью мультиплексной ПЦР Антицитокиновую активность определяли по О. В. Бухарину и др. (2011) [9].
Результаты. Установлен более высокий уровень выраженности антицитокиновой активности в отношении ИЛ-4, ИЛ-8 и ИФН-у у изолятов Enterococcus faecalis и E. fae-cium, выделенных при ИВЗ по сравнению со штаммами, выделенными из кишечника здоровых лиц.
Заключение. Полученные данные могут быть использованы для дифференциации патогенных штаммов.
Ключевые слова: энтерококки, антицитокиновая активность, микрофлора кишечника, инфекционно-воспалительные заболевания.
12 1 1 M. V. Sycheva, , T.M. Pashkova, O.L. Kartashova ,
O.A. Pashinina1, L.P. Popova1
CHARACTERISTIC OF ANTI-CYTOKINE ACTIVITY OF ENTEROCOCCI
1 Institute of Cellular and Intracellular Symbiosis UrB RAS, Orenburg, Russia
2 Orenburg State Agricultural University, Orenburg, Russia
Objective. Study the prevalence and intensity of anti-cytokine activity of enterococci as representatives of symbiotic intestine microflora and causative agent of infection-inflammatory diseases (IID) in children.
Materials and methods. The study used 95 strains of enterococci isolated from intestines of children during examination for dysbiosis, and 41 strains isolated from pathological material in infection-inflammatory diseases. Strain identification was carried out by using multiplex PCR. Anti-cytokine activity was determined by O.V. Bukharin et al. (2011) [9].
Results. A higher level of expression of anti-cytokine activity against IL-4, IL-8 and IFN-Y in isolates Enterococcus faecalis and E. faecium, isolated in infection-inflammatory diseases compared with strains isolated from the intestine of healthy persons was established. Conclusions. The data obtained can be used to differentiate pathogenic strains.
Keywords: enterococci, anti-cytokine activity, intestinal microflora, infection-inflammatory diseases.
Введение
Энтерококки, являясь условно-патогенными микроорганизмами, способны вызывать развитие инфекционно-воспалительных заболеваний. В последние годы многими авторами обоснована важная роль персистентного потенциала микроорганизмов в патогенезе инфекционно-воспалительных заболеваний [1−4]. Характеристика персистентных свойств энтерококков различного происхождения дана в ряде работ [5−7], однако отдельные свойства энтерококков еще не охарактеризованы. К таким свойствам относится антици-токиновая активность (АЦА). Разработан метод определения АЦА микроорганизмов, изучены распространенность и выраженность данного свойства в отношении про- и антивоспалительных цитокинов у патогенных и условно патогенных бактерий [8], а также штаммов облигатно-анаэробной микрофлоры, изолированной из кишечника [9]. Вместе с тем, отсутствуют данные сравнительного анализа о распространенности и выраженности у энтерококков, выделенных их разных источников, способности к деградации/связыванию различных видов цитокинов.
В связи с вышеизложенным целью данной работы явилось изучение распространенности и выраженности антицитокиновой активности у энтерококков как представителей симбиотической микрофлоры кишечника и возбудителей инфекционно-воспалительных заболеваний у детей.
Материалы и методы
Материалом для исследования явились 95 штаммов энтерококков, выделенных из кишечника детей при обследовании на дисбиоз, 25 штаммов из мочи при инфекции мочевыводящих путей, 9 штаммов из очагов воспаления у новорождённых с кожными формами перинатальной инфекционно-воспалительной патологии (ИВП) при наличии воспалительных заболеваний урогенитального тракта у рожениц, 7 штаммов из гнойного экссудата от больных с гнойными ранами.
Энтерококки выделяли путем посева исследуемого материала на среду Enterococcosel agar (BD, USA). Штаммы идентифицировали с помощью мультиплексной ПЦР с использованием известных праймеров (таблица) по видоспецифическим генам, кодирующим синтез супероксиддисмутазы [10]. Синтез праймеров осуществлен компанией «Синтол» (Москва).
Бюллетень Оренбургского научного центра УрО РАН (электронный журнал), 2015, № 3 Таблица. Праймеры, использованные в ПЦР, для идентификации энтерококков
Вид Прай-мер Последовательность 5 '-- 3'- Размер продукта реакции, п.о.
E. faecalis FL1 ACTTATGTGACTAACTTAACC 360
FL2 TAATGGTGAATATTGGTTTGG
E. faecium FM1 GAAAAAACAATAGAAGAATTAT 215
FM2 TGCTTTTTTGAATTCTTCTTTA
E. durans DU1 CCTACTGATATTAAGACAGCG 295
DU2 TAATCCTAAGATAGGTGTTTG
E. hirae HI1 CTTTCTGATATGGATGCTGTC 187
HI2 TAAATTCTTCCTTAAATGTTG
E. gallinarum GA1 TTACTTGCTGATTTTGATTCG 173
GA2 TGAATTCTTCTTTGAAATCAG
Для обнаружения генов, кодирующих синтез супероксиддисмутазы, проводили мультиплексную ПЦР с 1 мкл лизата в термоциклере «Терцик» (ДНК технология, Россия) по следующему протоколу: 1 цикл — 92 °C, 4 мин- 30 циклов: 92 °C, 30 сек- 55 °C, 1 мин- 72 °C, 1 мин- последний цикл включал элонгацию в течение 7 мин при 72 °C. Продукты амплификации анализировали путем электрофоретического разделения в горизонтальном 1% агарозном геле, окрашенном бромистым этидием, ТАЕ буферной системе.
В качестве маркеров использовали GeneRuler 100 bp DNA Ladder (Fermentas, Литва). Положительное заключение о наличии гена делали при обнаружении в дорожке специфической светящейся полосы определенной массы, которую устанавливали по линейке молекулярных масс.
Антицитокиновую активность (АЦА) энтерококков в отношении ИЛ-4, ИЛ-8, ИФН-у определяли по ранее описанному методу [9].
Статистическую обработку проводили с использованием параметрических методов [11]. Достоверность различий оценивали по критерию Стъюдента.
Результаты и обсуждение
По наличию видоспецифических генов идентифицировано 136 штаммов энтерококков. Выделенные из кишечника микроорганизмы представляли виды Enterococcus faecalis (50%), E. faecium (42%), E. durans (6%), E. hirae (1%) и E. gallinarum (1%). Изоляты энтерококков из патологического материала принадлежали к видам E. faecalis (83%) и E. faecium (17%), причем из гнойных ран и из очагов воспаления у новорожденных с кожными формами
3
Бюллетень Оренбургского научного центра УрО РАН (электронный журнал), 2015, № 3 перинатальной ИВП высевали только Е. faecalis, тогда как из проб мочи при инфекции мочевыводящих путей — Е. faecalis (70,8%) и Е. faecium (29,2%).
Антицитокиновая активность (АЦА) обнаруживалась как у штаммов из кишечника, так и культур, выделенных из патологического материала при инфекционно-воспалительной патологии (ИВП).
Анализ пенетрантности и экспрессивности АЦА в отношении ИЛ-4 показал, что данный признак у кишечных изолятов энтерококков выявлялся в 95,9% случаев, а его среднее значение у Е. faecalis составляло 29,2±2,3%, у Е. faecium 26,9±3,0%. Выраженность АЦА в отношении ИЛ-4 у.е. Ытв составила 28,5±0,5%, у Е. gallinarum — 25,4±1,5%, а у Е. durans — 35,1±4,4%.
При исследовании способности к инактивации ИЛ-4 энтерококков, выделенных из патологического материала, установлено наличие признака у всех исследованных штаммов. Экспрессия признака у вида Е. faecium составляла в среднем 37,5±2,7%, у вида Е. faecalis — 43,0±3,7%.
Проведенные исследования показали, что все изученные изоляты энтерококков характеризовались способностью к инактивации ИЛ-8. Среднее значение экспрессии признака у Е. faecalis, выделенных из кишечника, было равно 29,2±2,23%, из патологического материала — 41,4±4%, а у Е. faecium -19,9±2,1% и 39,1±4%, соответственно (р& lt-0,05).
Выраженность АЦА в отношении ИЛ-8 у.е. gallinarum составила 17,9±3,4%, Е. Ытв — 25,3±6,0%, Е. durans — 17,2±5,4%.
АЦА в отношении ИНФ-у была выявлена у всех штаммов энтерококков, выделенных как из кишечника, так и материала при инфекционно-воспалительных заболеваниях. При этом среднее значение признака у фекальных изолятов Е. faвcalis было равно 33,8±1,7%, а у изолятов из патологического материала — 62,4±6,8%. Способность к инактивации ИНФ-у у Е. faвcium составляла 33,2±3,7% и 65,5±5,3%, соответственно (р& lt-0,05).
Выраженность признака у Е. durans была равна 30,8±4,2%, Е. gallinarum — 31,7±4%, Е. Ытв — 38,3±4%.
Таким образом, проведенные исследования выявили различия в уровне выраженности антицитокиновой активности в отношении ИЛ-4, ИЛ-8 и ИФН-у у изолятов энтерококков, выделенных от здоровых детей из кишечника и больных с ИВП. Сравнение уровней экспрессии этих признаков показало, что у энтерококков, выделенных из патологического материала, выра-
Бюллетень Оренбургского научного центра УрО РАН (электронный журнал), 2015, № 3 женность АЦА в 1,5−2 раза выше, чем у энтерококков, изолированных из кишечника здоровых детей.
Заключение
В результате проведенного нами исследования установлена способность энтерококков, выделенных из кишечника при эубиозе и из патологического материала при инфекционно-воспалительных заболеваниях, изменять в условиях in vitro концентрацию цитокинов ИЛ-4, ИЛ-8 и ИФН-у. Механизм подобного влияния экзометаболитов микроорганизмов на уровень цитокинов при совместном их культивировании с рекомбинантными цитокинами может быть связан с неспецифическим действием широкого спектра протеаз, находящихся в составе экзометаболитов [9].
Полученные в настоящей работе данные о высоком уровне выраженности АЦА у изолятов энтерококков, выделенных при инфекционно-воспалительных заболеваниях, по сравнению с кишечными изолятами, свидетельствуют о возможном влиянии их экзометаболитов на локальный цито-киновый баланс, что поддерживает воспалительный процесс.
Полученные данные о модификации энтерококками различного происхождения активности цитокинов могут быть использованы для идентификации патогенных штаммов.
ЛИТЕРАТУРА
1. Гриценко В. А., Иванов Ю. Б. Роль персистентных свойств микроорганизмов в патогенезе эндогенных инфекций. Журнал микробиологии, эпидемиологии и иммунобиологии. 2009. 4: 66−71.
2. Карташова О. Л., Норкина А. С., Чайникова И. Н. и др. Фенотипическая характеристика стафилококков и местный иммунитет при бактерионосительстве. Журнал микробиологии, эпидемиологии и иммунобиологии. 2009. 4: 99−103.
3. Карташова О. Л., Гандыбин Е. А., Уткина Т. М. и др. Биологические свойства микроорганизмов в прогнозировании течения венозно-трофических язв нижних конечностей. Журнал микробиологии, эпидемиологии и иммунобиологии. 2009. 4: 111−114.
4. Капустина О. А., Чайникова И. Н., Карташова О. Л. Видовая характеристика и факторы персистенции грибов рода Candida, выделенных из разных биотопов при инфекцион-но-воспалительных заболеваниях и дисбиозе кишечника. Журнал микробиологии, эпидемиологии и иммунобиологии. 2012. 4: 37−41.
5. Билимова С. И. Характеристика факторов персистенции энтерококков. Журнал микробиологии, эпидемиологии и иммунобиологии. 2000. 4: 104−105.
6. Сычева М. В., Карташова О. Л. Биологические свойства энтерококков различного происхождения. Журнал микробиологии, эпидемиологии и иммунобиологии. 2015. 4: 17−21.
7. Пошвина Д. В., Щепитова Н. Е., Сычева М. В. и др. Видовая характеристика и факторы персистенции энтерококков, выделенных от животных в норме и при патологии. Ветеринария. 2015. 6: 26−29.
8. Савастеева А. В., Иванова Е. В., Перунова Н. Б. и др. Видовая характеристика и факторы
персистенции облигатно-анаэробных микроорганизмов кишечной микробиоты человека. Бюллетень Оренбургского научного центра УрО РАН. [Электронный ресурс] (Url: http:lmag. uran. m:9673/magazine/Numbers/2013−3/Articles/Savasteeva-soavt (2013−3). pdf — дата обращения: 22. 10. 13).
9. Бухарин О. В., Перунова Н. Б., Чайникова И. Н. и др. Антицитокиновая активность микроорганизмов. Журнал микробиологии, эпидемиологии и иммунобиологии. 2011. 4: 56−61.
10. Jackson C.R., Fedorka-Cray P.J., Barrett J.B. Use of a genus- and species-specific multiplex PCR for identification of enterococci. J. Clin. Microbiol. 2004. 42 (8): 3558−3565.
11. Лакин Г. Ф. Биометрия. М.: Высшая школа, 1990. 352 с.
Поступила 16. 09. 2015
(Контактная информация: Карташова Ольга Львовна — доктор биологических наук, зав. лабораторией по изучению механизмов и регуляции персистенции бактерий Института клеточного и внутриклеточного симбиоза УрО РАН- адрес: 460 000, г. Оренбург, ул. Пионерская, 11- тел. /факс (3532)774463- e-mail: labpersist@mail. ru)
LITERATURA
1. Gricenko V.A., Ivanov Ju.B. Rol'- persistentnyh svojstv mikroorganizmov v patogeneze jendogennyh infekcij. Zhurnal mikrobiologii, jepidemiologii i immunobiologii. 2009. 4: 66−71.
2. Kartashova O.L., Norkina A.S., Chajnikova I.N. i dr. Fenotipicheskaja harakteristika stafilo-kokkov i mestnyj immunitet pri bakterionositel'-stve. Zhurnal mikrobiologii, jepidemiologii i immunobiologii. 2009. 4: 99−103.
3. Kartashova O.L., Gandybin E.A., Utkina T.M. i dr. Biologicheskie svojstva mikroorganizmov v prognozirovanii techenija venozno-troficheskih jazv nizhnih konechnostej. Zhurnal mikrobiologii, jepidemiologii i immunobiologii. 2009. 4: 111−114.
4. Kapustina O.A., Chajnikova I.N., Kartashova O.L. Vidovaja harakteristika i faktory persis-tencii gribov roda Candida, vydelennyh iz raznyh biotopov pri infekcionno-vospalitel'-nyh zabolevanijah i disbioze kishechnika. Zhurnal mikrobiologii, jepidemiologii i immunobiologii. 2012. 4: 37−41.
5. Bilimova S.I. Harakteristika faktorov persistencii jenterokokkov. Zhurnal mikrobiologii, jepidemiologii i immunobiologii. 2000. 4: 104−105.
6. Sycheva M.V., Kartashova O.L. Biologicheskie svojstva jenterokokkov razlichnogo prois-hozhdenija. Zhurnal mikrobiologii, jepidemiologii i immunobiologii. 2015. 4: 17−21.
7. Poshvina D.V., Shhepitova N.E., Sycheva M.V. i dr. Vidovaja harakteristika i faktory persistencii jenterokokkov, vydelennyh ot zhivotnyh v norme i pri patologii. Veterinarija. 2015. 6: 26−29.
8. Savasteeva A.V., Ivanova E.V., Perunova N.B. i dr. Vidovaja harakteristika i faktory persistencii obligatno-anajerobnyh mikroorganizmov kishechnoj mikrobioty cheloveka [Jelektron-nyj resurs]. Bjulleten'- Orenburgskogo nauchnogo centra UrO RAN. Url: http: //elmag. uran. ru:9673/magazine/Numbers/2013−3/Articles/Savasteeva-soavt (2013−3). pdf (data obrashhenija: 22. 10. 13).
9. Buharin O.V., Perunova N.B., Chajnikova I.N. i dr. Anticitokinovaja aktivnost'- mikroorganizmov. Zhurnal mikrobiologii, jepidemiologii i immunobiologii. 2011. 4: 56−61.
10. Jackson C.R., Fedorka-Cray P.J., Barrett J.B. Use of a genus- and species-specific multiplex PCR for identification of enterococci. J. Clin. Microbiol. 2004. 42 (8): 3558−3565.
11. Lakin G.F. Biometrija. M.: Vysshaja shkola, 1990. 352 s.
Образец ссылки на статью:
Сычева М. В., Пашкова Т. М., Карташова О. Л., Пашинина О. А., Попова Л. П. Характеристика антицитокиновой активности энтерококков. Бюллетень Оренбургского научного
центра УрО РАН. 2015. 3: 1−6 [Электронный ресурс] (URL: http: //elmag. uran. ru:9673/ maga-
zine/Numbers/2015−3/Articles/SMV-2015−3. pdf).

ПоказатьСвернуть
Заполнить форму текущей работой