Модифицированный метод анализа структуры рРНК позволил выявить новые свойства аналогов C/D-бокс-РНК

Тип работы:
Реферат
Предмет:
Биология


Узнать стоимость

Детальная информация о работе

Выдержка из работы

УДК 577. 21
Модифицированный метод анализа структуры рРНК позволил выявить новые свойства аналогов C/D-бокс-РНК
Ю. А. Филиппова1,2*, Г. А. Степанов1, Д. В. Семенов1, О. А. Коваль1,2, Е. В. Кулигина1, И. В. Рабинов1, В. А. Рихтер1
1Институт химической биологии и фундаментальной медицины СО РАН, 630 090, Новосибирск, просп. Академика Лаврентьева, 8
2Новосибирский государственный университет, 630 090, Новосибирск, ул. Пирогова, 2 *E-mail: filippova@niboch. nsc. ru Поступила в редакцию 04. 08. 2014 После доработки 19. 01. 2015
РЕФЕРАТ Созревание рибосомных РНК (рРНК) представляет собой сложный процесс, в ходе которого отдельные нуклеотиды подвергаются химическим модификациям по азотистым основаниям или остатку рибозы. Одна из самых распространенных модификаций рРНК — 2'--0-метилирование нуклеотидов — осуществляется рибонуклеопротеидными комплексами, содержащими в своем составе малые ядрышковые C/D-бокс-РНК. Поскольку большая часть 2'--0-метилированных нуклеотидов расположена в наиболее консервативных участках рРНК, формирующих важнейшие функциональные центры рибосом, то изменения в профиле 2'--0-метилирования могут приводить к нарушениию сборки и функционирования рибосом. Один из основных методов выявления положений 2'--0-метилированных нуклеотидов в протяженных РНК — метод терминации обратной транскрипции. В настоящей работе этот метод адаптирован к использованию флуоресцентно меченных праймеров и анализу продуктов терминации капиллярным гель-электрофорезом на автоматическом генном анализаторе. С помощью разработанного подхода проанализировано действие синтетических аналогов C/D-бокс-РНК на посттранскрипционные модификации 28S рРНК человека в клетках линии MCF-7. Установлено, что трансфекция клеток MCF-7 аналогом C/D-бокс-РНК приводит к увеличению глубины модификации отдельных сайтов 2'--0-метилирования в рРНК-мишени. Наблюдаемый эффект воздействия синтетических РНК на 2'--0-метилирование нуклеотидов рРНК в клетках человека указывает на возможность направленной регуляции посттранскрипционного созревания рРНК. Представленный подход может найти применение в разработке методов выявления заболеваний человека.
КЛЮЧЕВЫЕ СЛОВА малые ядрышковые C/D-бокс-РНК, посттранскрипционные модификации нуклеотидов РНК, 2'--0-метилирование РНК, терминация обратной транскрипции.
СПИСОК СОКРАЩЕНИЙ рРНК — рибосомная РНК- ПТЦ — пептидилтрансферазный центр- мяоРНК — малая ядрышковая РНК- мяоРПК — малый ядрышковый рибонуклеопротеидный комплекс- FAM — 5(6)-карбо-ксифлуоресцеин- M-MLV — Moloney Murine Leukemia Virus, вирус лейкоза мышей Молони- dNTP — дезок-сирибонуклеозидтрифосфаты- ОТ — обратная транскрипция- ПААГ — полиакриламидный гель.
ВВЕДЕНИЕ
РНК всех живых организмов подвергаются посттранскрипционной модификации и содержат не только канонические, но и модифицированные нуклеотиды, необходимые для правильного функционирования сложных биологических комплексов. Посттранскрипционные модификации существенно влияют на формирование вторичной структуры и функции РНК [1, 2].
Одна из наиболее распространенных модификаций некодирующих РНК у млекопитающих — метилирование нуклеотидов по 2'--0-положению рибозы [3]. Положения многих сайтов 2'--0-метилирования в рРНК носят консервативный характер, а большинство модификаций обнаружены в наиболее эволю-ционно консервативных и важных участках рРНК, которые играют ключевую роль на различных этапах трансляции [4]. Изменение общей картины распре-
деления модифицированных нуклеотидов или недостаток таких нуклеотидов могут привести к нарушению сборки и функционирования рибосом [5, 6]. Например, показано, что блокирование модификации нуклеотидов пептидилтрансферазного центра (ПТЦ) рибосом вызывает изменения во вторичной структуре 25S рРНК дрожжей, нарушает трансляционную активность рибосом и повышает, в ряде случаев, чувствительность клеток к действию ингибиторов трансляции [2, 7].
Считается, что модификации способствуют стабилизации «функциональной» структуры рРНК за счет влияния на внутри- и межмолекулярные взаимодействия [2]. На данный момент основной функцией модификаций считают участие в созревании и сборке рибосом: модификация рРНК в определенной степени может служить дополнительным критерием качества новосинтезированной рРНК, что способствует отбору только «правильных» рРНК для включения в рибосомы [8].
Известно, что 2'--0-метилирование нуклеотидов рРНК и малых ядерных РНК клеток млекопитающих осуществляют рибонуклеопротеидные комплексы (мяоРПК), содержащие малые ядрышковые С^-бокс-РНК [9]. При этом С^-бокс-РНК, будучи комплементарными участку РНК-мишени, непосредственно участвуют в процессе узнавания нукле-отида-мишени 2'--0-метилирования — модификации подвергается пятый нуклеотид от D-бокса (рис. 1) [10, 11].
Недавно показали, что в клетках некоторых типов рака повышен уровень экспрессии генов С^-бокс-РНК, а также фибрилларина — ключевого белка мяоРПК, выполняющего роль метилтрансферазы [12, 13]. Установлено, что клетки рака молочной железы разного типа могут отличаться глубиной модификации отдельных нуклеотидов рРНК [14]. Различия в экспрессии отдельных C/D-бокс-РНК выявлены и при разных типах лейкоза [15]. Ранее уже отмечалось, что нарушения в созревании рРНК и синтеза рибосомных белков в клетках человека могут приводить к патологическим изменениям [16, 17]. Таким образом, мяоРНК могут участвовать в онкогенезе, а изменение профиля 2'--0-метилирования рРНК может иметь диагностическую значимость. Поэтому актуальной представляется разработка новых подходов к анализу структуры рРНК и других протяженных клеточных РНК, позволяющих количественно оценивать глубину модификации отдельных нуклеотидов таких РНК.
В настоящей работе метод определения положений 2'--0-метилированных нуклеотидов РНК адаптирован к использованию 5'--флуоресцентно меченных праймеров с последующим анализом продуктов
Рис. 1. Структура C/D-бокс-РНК и ее взаимодействие с предшественником рРНК
терминации обратной транскрипции (ОТ) на автоматическом ДНК-анализаторе. При помощи предложенного подхода проведен анализ влияния синтетических аналогов C/D-бокс-РНК на изменение профиля 2'--0-метилированных нуклеотидов рРНК в клетках человека. Показано, что при трансфек-ции клеток аденокарциномы MCF-7 синтетическими C/D-бокс-РНК, направленными на 28S рРНК, происходит увеличение глубины 2'--0-метилирования отдельных нуклеотидов рРНК-мишени.
ЭКСПЕРИМЕНТАЛЬНАЯ ЧАСТЬ
Анализ профилей 2'--0-метилирования 18S и 28S рРНК человека
Номера нуклеотидов рРНК человека приведены в соответствии с GenBank: U13369 (7935−12 969 н.) для 28S рРНК и X03205 для 18S рРНК.
Обратную транскрипцию проводили с использованием праймеров, содержащих на 5'--конце [32P] либо остаток 5(6)-карбоксифлуоресцеина (FAM): 18−2 — 5'--TAATGATCCTTCCGCAGGTTC-3'- (комплементарен участку 1849−1869 н. 18S рРНК) — FAM-28−2.2 — 5'--ATTGGCTCCTCAGCCAAGCA-3'- (4608−4627 н. 28S рРНК) и FAM-4491 — 5'--GACGGTCTAAACCCAGCTCA-3'- (4491−4510 н. 28S рРНК). Реакционную смесь, содержащую 3.0 мкг суммарной клеточной РНК и 1.4 пмоль праймера, инкубировали при 70 °C в течение 3 мин и охлаждали до 4 °C. Добавляли буфер для обратной транскрипции, содержащий (мМ) 50 KCl, 50 Трис-НС1 (рН 8. 3), 4 MgCl2 и 10 ДТТ- а также 3 ед. акт. /мкл обратной транскриптазы M-MLV («Биосан», Новосибирск).
В отдельные пробы добавляли dNTP до конечной концентрации 2. 0, 1. 0, 0.1 или 0. 04 мМ. Реакционную смесь инкубировали 2 ч при 40 °C. Продукты О Т осаждали 75% этанолом, высушивали и растворяли в деионизованной воде.
Секвенирование участка 18S рРНК проводили методом обратной транскрипции в присутствии ddNTP. Для этого инкубировали 3.0 мкг суммарной клеточной РНК и 1.4 пмоль праймера 18−2 в течение 3 мин при 70 °C, охлаждали до 4 °C. К смеси добавляли один из ddNTP: ddATP до конечной концентрации 5.0 мкМ, ddCTP — 2.5 мкМ, ddGTP — 5.0 мкМ или dTTP — 5.0 мкМ. Конечная концентрация dNTP, соответствующего ddNTP в смеси, равна 25 мкМ, а остальных dNTP — 100 мкМ. К полученной смеси добавляли буфер для обратной транскрипции (см. выше), а также 2.0 мМ MnCl2, 10 мМ ДТТ и 3 ед. акт. /мкл обратной транскриптазы M-MLV. Смесь инкубировали в течение 90 мин при 40 °C. Продукты О Т осаждали 75% этанолом, высушивали и растворяли в деионизованной воде.
Анализ продуктов обратной транскрипции рибосомных РНК клеток человека
Флуоресцентно меченные продукты обратной транскрипции рРНК анализировали на анализаторе ABI3100 Applied Biosystems (ЦКП «Геномика» СО РАН). Данные анализировали с помощью программного обеспечения Peak Scanner Software версии 1.0 (Applied Biosystems, США). Относительное изменение выхода продуктов ОТ определяли с использованием значений площадей пиков, нормированных на сумму площадей пиков, относительная интенсивность которых изменялась меньше чем на 20%. Представлены средние данные как минимум трех независимых экспериментов.
Получение синтетических C/D-бокс-РНК
Аналоги C/D-бокс-РНК были получены с помощью транскрипции in vitro согласно [18, 19]: 28A4518 (98 н.) 5'--
GACUCAGCAUGCGUGUUCAUGCUAUGAUGAAA-
AAGUCAACUUAGGCGUGGUUGUGGCCUAAAA-
CUAACCUGUCUCUGAUGGCAGAGGCAUGCUGA-
GUC-3'--
РНК3 (77 н.)
5'--
GGGUGCAGAUGAUGUAAAAUAGCGACGGGCGG-
UGCUGAGAGAUGGUGAUGAACGGUCUAAACCC-
AGCUGAUGCACCC-3'--
РНК5 (77 н.)
5'--
GGGUGCAGAUGAUGUAAAAUAGCGACGGGCGG-
UGCUGAGAGAUGGUGAUGAACGACGGUCUAAA-
CCCUGAUGCACCC-3'--
PH^mC (77 н.)
5'--
GGGUGCAGACAGCACAAAAUAGCGACGGGCGG-
UGCUGAGAGAUGGCAGCAGACGACGGUCUAAA-
CCCUGAUGCACCC-3'--
PH^D/N (77 н.)
5'--
GGGUGCAGAUGAUGUAAAAUAGCGACGGGCGG-
UGCUGAGAGAUGGUGAUGAACGACGGUCUAAA-
CCAGUCUGCACCC-3'--
PH^mD (77 н.)
5'--
GGGUGCAGAUGAUGUAAAAUAGCGACGGGCGG-UGAAAAGAGAUGGUGAUGAACGACGGUCUAAA-CCAAAAUGCACCC-3'-.
Подчеркнута область узнавания нуклеотидов рРНК, жирным шрифтом выделены консервативные элементы (C- и D-боксы).
Трансфекция клеток MCF-7 синтетическими РНК. Выделение суммарной клеточной РНК
Клетки MCF-7 (Российская коллекция клеточных культур позвоночных, ИНЦ РАН, Санкт-Петербург) культивировали в среде IMDM с 10 мМ L-глутамином и 40 мкг/мл гентамицина в присутствии 10% эмбриональной сыворотки крупного рогатого скота при 37оС в атмосфере 5% СО2.
Синтетические аналоги C/D-бокс-РНК (10−6 М) предварительно инкубировали с липофектамином (Lipofectamine Reagent, Invitrogen, США) в концентрации 0. 06 мг/мл в течение 15 мин при 20 °C. Клетки MCF-7 трансфицировали комплексом липофекта-мина с РНК (конечная концентрация РНК в среде 7×10−8 M). Контрольные клетки инкубировали в среде с липофектамином (6 мкг/мл). После 24 ч инкубации суммарную РНК клеток выделяли с помощью Trizol Reagent (Invitrogen, США) согласно протоколу производителя. Сохранность суммарной РНК оценивали электрофорезом на Lab-on-chip анализаторе нуклеиновых кислот Agilent Bioanalyzer и использовали препараты со значениями RIN не менее 8.0. Профиль 2'--0-метилирования рРНК анализировали как описано выше.
РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ
Модификация метода терминации обратной транскрипции
Метод терминации обратной транскрипции основан на способности 2'--0-метилированных нукле-отидов вызывать остановку ревертазы при концентрации dNTP менее 1 мМ [20]. По длине
З'-.
РНК
СН. СН, СН,
-^Праймер кДНК
Обратная транскрипция
I
Рис. 2. Метод терминации обратной транскрипции
продуктов терминации ОТ можно судить о положениях 2'--O-метилированных нуклеотидов в анализируемой РНК-матрице [21] (рис. 2). В отличие от стандартной методики, которая предполагает проведение реакции обратной транскрипции с радиоактивно меченным праймером и разделение кДНК-продуктов в полиакриламидном геле с последующей радиоавтографией, разработанный нами подход основан на использовании флуоресцентно меченных праймеров и анализе кДНК капиллярным гель-электрофорезом на автоматическом генном анализаторе.
Возможность применения такого подхода к определению положений 2'--O-метилированных ну-
клеотидов в РНК изучали с помощью обратной транскрипции 18S или 28S рРНК из линии клеток MCF-7 с [5'--^]- или 5'--FAM-мечеными прайме-рами. На рис. 3 представлено сравнение типичных результатов «стандартного» метода с использованием радиоактивно меченных праймеров и метода, адаптированного к анализу флуоресцентно меченных кДНК-продуктов на автоматическом ДНК-анализаторе. Видно, что наборы кДНК-продуктов на рис. 3А, Б хорошо согласуются между собой по длине и относительному выходу.
Для точного определения соответствия детектируемых продуктов терминации ОТ положениям конкретных нуклеотидов РНК-матрицы мы разделяли продукты реакции секвенирования по Сэнгеру участка 18S рРНК (рис. 3А, вставка).
Воспроизводимость результатов оценивали с использованием данных трехкратного повторения обратной транскрипции суммарной клеточной РНК с праймерами, специфичными к различным участкам 18S и 28S рРНК, с последующим разделением ДНК-транскриптов на генном анализаторе. В серии экспериментов было установлено, что главные продукты терминации ОТ одинаковых участков рРНК-матрицы согласуются по времени выхода (± 1 н.) и интенсивностям сигналов кДНК (± 10%) (данные не приведены).
А
4000 —
2000 —
Длина кДНК, н.
45 60 80 100 120 Длина кДНК, н.
Рис. 3. Сравнение продуктов терминации обратной транскрипции 18S рРНК с [5'--32Р]-меченым и 5'-^АМ-меченым праймером 18−2 (в присутствии 0. 04 мМ dNTP). А — разделение 5'-^АМ-меченых продуктов терминации ОТ капиллярным электрофорезом на автоматическом ДНК-анализаторе (верхняя вставка) — продукты терминации ОТ 18S рРНК в присутствии ddGTP и ddCTP (нижняя вставка). Б — разделение [5'--32Р]-меченых продуктов ОТ в 12% денатурирующем ПААГ. Дорожка 0. 04 -продукты терминации ОТ при 0. 04 мМ dNTP. Дорожки G, А, С и и -терминация ОТ 18S рРНК в присутствии ddCTP, dTTP, ddGTP и ddATP соответственно
Б
4510'- 3'--
FAM
Ст 4426
84 н.
Gm Gm 4362 4340
ит 4276

I
149 н. 171 н.
235 н.
ит 4197
Gm 4198
и


312−313 н.
149
84
) л^ I.
-1-
115


311 313

I-
305
-I-
ш
Длина кДНК, н.
Длина кДНК, н.
Длина кДНК, н.
Б
В
Рис. 4. Анализ кДНК-продуктов терминации ОТ, соответствующих известным сайтам 2'--0-метилирования в 28S рРНК. Л — схема расположения 2'--0-метилированных нуклеотидов в 28S рРНК и длин соответствующих им кДНК-продуктов терминации ОТ с праймера FAM-4491. Б-Г — разделение FAM-меченых продуктов терминации ОТ на автоматическом ДНК-анализаторе. ОТ 28S рРНК клеток MCF-7 проводили при следующих концентрациях dNTP в реакционной смеси (мМ): Б — 0. 1, В — 1. 0, Г — 2. 0
С помощью предлагаемого метода мы проанализировали наборы продуктов терминации ОТ 28S рРНК человека при разных концентрациях мономеров в реакционной смеси. В дополнение к стандартным условиям эксперимента по терминации ОТ, при которых используют пониженные концентрации dNTP в реакционной смеси (0. 001−0.1 мМ) [21], мы проводили реакцию и при повышенных концентрациях мономеров (2.0 мМ). Из рис. 4 видно, что при понижении концентрации dNTP в реакционной смеси увеличивается выход кДНК-продуктов длиной 84, 149, 171 и 235 н., соответствующих известным сайтам 2'--0-метилирования — Ст4426, Gm4362, Gm4340 и ит4276 (рис. 4Б, В). ОТ терминируется непосредственно на модифицированном нуклеотидет4362, Gm4340 и ит4276) либо на нуклеотиде, прилежащем с З'--конца к 2'--0-метилированному (Ст4426). Кроме того, установлено, что при повышении концентрации dNTP до 2.0 мМ удается увеличить специфичность терминации на 2'--0-метилированных нуклеотидах рРНК. Так, при 2.0 мМ dNTP выход продуктов терминации, не относящихся к 2'--0-метилированным нуклеотидам РНК-матрицы, значительно снижает-
ся по сравнению с ОТ, проводимой при 0.1 мМ dNTP (рис. 4Б, Г).
Преимуществом нового подхода является возможность количественной оценки выхода продуктов терминации ОТ. При этом разделение продуктов терминации на автоматическом генном анализаторе позволяет получать более полную информацию о распределении сайтов терминации в структуре РНК-матрицы за счет анализа более протяженных участков РНК по сравнению со стандартным разделением кДНК в денатурирующем ПААГ. Предложенный подход может быть использован как для идентификации модифицированных нуклеотидов в природных РНК и подтверждения положений сайтов модификации в синтетических РНК, так и для решения других задач, связанных с анализом структуры протяженных РНК, методом обратной транскрипции.
Влияние аналогов C/D-бокс-РНК на профиль 2'--0-метилирования нуклеотидов рРНК клеток человека
Представленный в нашей работе подход был использован для изучения влияния аналогов малых ядрыш-
РНК3
. et7GiOGAACGGDCUAAACCCAGCOGAOGCACCC-3'- I I I I I I I I I I I I I I I
. (4510)CUGCC AGAUUUGGGUCGAGUGC AAGGGAUAAUC ACCCACUU (4470)… -5'-
РНК5
G4499 28S рРНК
. GUGA ?7GAACGACGGUCUAAAC С CUGAUGCACCC — 3 '-
I I I I I I I I I I I I I I I
. (4513)GUGCOGCCAGAUUUGGGUCGAGOGCAAGGGAUAAOCACCCA (4473)… -5'-
t
U4502 28S рРНК
. AVGAi7GAAAAAGUC AACUUAGGCGUGGUUGUGGCCUAAAACLTAACCUGUCUCOGA.. -3
I I I I I I I I I I I I I I I II
28A4518
(4556) GUACCGtntGUOGUGOAGOAGOCAOCCCAOOOtlGAOUGGACAGAGOG (4511)… -5'-
t
A4518 28S рРНК
Рис. 5. Конструирование синтетических аналогов С/О-бокс-РНК. Консервативные элементы аналогов мяоРНК -С (С'-) — и й (О'-)-боксы — выделены зеленым цветом. Нуклеотиды-мишени в рРНК обозначены стрелкой с указанием номера нуклеотида в соответствии с [26]. Известные 2'--0-метилированные нуклеотиды в структуре 28Б рРНК выделены красным цветом. В рамках справа приведены обозначения аналогов С/й-бокс-РНК, содержащих в своей структуре соответствующую область комплементарности к рРНК
ковых C/D-бокс-РНК на процессинг рРНК-мишеней в клетках человека. Ранее J. Cavaille и соавт. показали возможность направления 2'--0-метилирования нуклеотидов рРНК с использованием ДНК-конструкций, кодирующих C/D-бокс-РНК [22]. Нами были сконструированы и получены синтетические аналоги малых ядрышковых C/D-бокс-РНК человека, содержащие измененные области узнавания мишени (рис. 1). В качестве мишеней синтетических C/D-бокс-РНК были выбраны нуклеотиды рРНК человека, входящие в состав или находящиеся вблизи ПТЦ рибосом — G4499, U4502 и A4518 28S рРНК [23−25]. Аналоги малых ядрышковых C/D-бокс-РНК были сконструированы таким образом, чтобы их последовательности содержали необходимые компоненты для направления 2'--0-метилирования в заранее заданный нуклеотид-мишень: консервативные области С- и D-боксов (домены узнавания белков мяоРПК) — а также область, комплементарную участку рРНК-мишени (рис. 5).
Аналог C/D-бокс-РНК — 28A4518 — имел структуру, способную направлять 2'--0-метилирование нуклеотида A4518 28S рРНК. Из рис. 6 В видно, что трансфекция РНК 28A4518 в клетки человека линии MCF-7 не вызывает появления нового продукта терминации в положении нуклеотида-мише-ни, соответствующему кДНК длиной 109 н. Вопрос отсутствия модификации нуклеотидов-мишеней в составе рРНК мы обсуждали ранее [18]. В частности, мы полагаем, что наблюдаемое отсутствие 2'--0-метилирования нуклеотидов-мишеней может указывать на низкое содержание модифицированной рРНК в клетках вследствие ее быстрой деградации. Как показано в работах B. Liu и M.J. Fournier с соавт., 2'--0-метилирование ряда нуклеотидов, формирующих активные центры рибосом клеток дрожжей,
индуцирует деградацию рРНК-мишеней и приводит к снижению скорости роста клеток [23, 27, 28].
Несмотря на отсутствие терминации на нукле-отиде-мишени РНК 28А4518, трансфекция клеток синтетическим аналогом приводила к изменению глубины 2'--0-метилирования известных сайтов модификации рРНК. Из данных рис. 6 видно, что увеличивается выход продуктов терминации, соответствующих положениям 2'--0-метилированнных Gm4362, Gm4198 и ит4197 (рис. 6Б, В). Сравнение значений интенсивностей кДНК-продуктов показало, что трансфекция клеток аналогом РНК 28А4518 приводит к усилению терминации на нуклеотиде Gm4362 в 1.5 раза, тогда как выход продукта длиной 428−429 н.т4198 и ит4197) возрастает в 2.2 раза. Повышение выхода продуктов ОТ, соответствующих остановке ревертазы на 2'--0-метилированных ну-клеотидах, указывает на большую глубину модификации этих нуклеотидов рРНК в трансфицированных клетках.
Изменение глубины модификации нуклеотидов рибосомных РНК может быть связано с увеличением локальной концентрации компонентов комплексов, осуществляющих 2'--0-метилирование нуклеоти-дов при созревании ядрышкового предшественника рРНК. Нуклеотиды Gm4362, Gm4198 и ит4197 28S рРНК находятся на значительном расстоянии (более 150 н.) от участка комплементарности аналогов C/D-бокс-РНК к рРНК (рис. 5). Увеличение глубины 2'--0-метилирования перечисленных нуклеоти-дов может быть связано с их сближенностью в пространственной структуре предшественника рРНК с нуклеотидами-мишенями С^-бокс-РНК и миграцией компонентов метилтрансферазного комплекса от дуплекса С^-бокс-РНК • рРНК к ближайшим нуклеотидам рРНК. Нельзя исключать также воз-
Am 4560
1
Мишень РНК Am
28А4518 4493 m'-U 4500
А4518
I
Gm Gm 4362 4340
Jr ir Jr i
127 h.
Um 4197
Gm 4198
w
68 h. iih. 133 h. 266 h. | 42st
-5'-
428−429 H.
287 H.
7000
Длина кДНК, н.
Длина кДНК, н.
Б
В
Рис. 6. Влияние синтетических аналогов C/D-бокс-РНК на выход продуктов терминации ОТ рРНК. Л — схема расположения 2'--0-метилированных нуклеотидов в 28S рРНК и длин соответствующих им продуктов терминации ОТ с праймера FAM-28−2.2. Продукты О Т рРНК контрольных клеток MCF-7 (Б) и клеток MCF-7, транс-фицированных аналогом 28A4518 (В). ОТ рРНК проводили при концентрации dNTP 0. 04 мМ
можное влияние синтетических РНК на вторичную структуру рРНК и взаимодействие с независимыми трансфакторами, контролирующими этапы созревания рРНК в клетках эукариот, такими, как РНК-геликазы [29].
Усиление терминации ОТ на известных сайтах 2'--0-метилирования мы наблюдали при изучении воздействия других аналогов С^-бокс-РНК на клетки человека. В частности, аналоги РНК3 и РНК5 были сконструированы таким образом, чтобы направлять 2'--0-метилирование нуклеотидов 28S рРНК G4499 и и4502 соответственно. Трансфекция клеток MCF-7 аналогом РНК3 или РНК5 не индуцировала модификации нуклеотида-мишени, но приводила к усилению глубины 2'--0-метилирования нуклеотида Ст4506
28S рРНК (рис. 7 В, Г). Данные, представленные на рис. 7 и в таблице, показывают, что после транс-фекции клеток MCF-7 синтетическими РНК3 и РНК5 выход кДНК-продукта длиной 121 н. увеличивается в 40 и 7 раз соответственно. Этот кДНК-продукт образуется в результате терминации ревертазы М-МКУ на 2'--0-метилированном Ст4506 28S рРНК при элонгации праймера FAM-28−2.2. Наблюдаемое повышение выхода продукта терминации указывает на увеличение глубины 2'--0-метилирования Ст4506.
С целью определения структурных особенностей аналогов С^-бокс-РНК, влияющих на глубину природного 2'--0-метилирования нуклеотидов рРНК, были получены аналоги C/D-бокс-РНК5, содержащие замены в последовательности С (С'-) —
4627
~I
РАМ^& quot-
Мишень Мишень РНК5 РНК3
Ст I т: >-и
4506 I 4500
114 502 I С4499
I I Т I

121 н.
125 н.
128 н.
127 н.
Ат 4493
134 н.
80 Длин1а°кДНК,# Ш
Д
7000−4000-=Г 300 020 001 000-о-
& quot-I-1-г
Длина кДНК, н.
I 127
Длина кДНК, н.
121 134
Х^-Л] П----~Г---Т-г
80 «129 П|||/1М 200 Длина кДНК, н.
Длина кДНК, н.
Ж
II
7000-| 4000-=
300 020 001 000 0

45
3'-° ДлинакДНК, н.™
Б
В
Е
Рис. 7. Влияние синтетических аналогов С^-бокс-РНК на глубину 2'--0-метилирования нуклеотида Ст4506 28S рРНК в клетках человека. А — расположение праймера FAM-28−2. 2, 2'--0-метилированных нуклеотидов 28S рРНК и нуклеотидов-мишеней аналогов C/D-бокс-РНК. Б-Ж — разделение 5'-^АМ-меченых продуктов терми-нации ОТ 28S рРНК (при концентрации dNTP 0. 04 мМ) контрольных клеток MCF-7 (Б) и клеток, трансфицирован-ных РНК3 (В), РНК5 (Г), РНК5тС (Д), РНК5D/N (Е) и РНК5mD (Ж). Красной стрелкой сверху обозначено положение продукта терминации ОТ, соответствующего нуклеотиду Ст4506 28S рРНК. Продукт терминации ОТ длиной 127 н. соответствует т3и4500 28S рРНК
или D (D'-)-боксов: РНК5тС, РНК5D/N и РНК5mD. Все перечисленные аналоги имели одинаковую последовательность области узнавания, направленную на и4502 28S рРНК (рис. 5, таблица). В РНК5тС последовательности С- (AUGAUGU) и С'-- (GUGAUGA) боксов были заменены на (ACAGCAC) и (GCAGCAG) соответственно. В структуре РНК5D/N только D-бокс заменен на (AGUC), тогда как в РНК5mD обе последовательности D- и D'--боксов (CUGA) заменены на (АААА).
Установлено, что замены в структурах D-и С-боксов существенно снижают эффективность действия аналогов C/D-бокс-РНК. Так, при замене
одного D-бокса в структуре РНК5 относительный выход продукта терминации уменьшается приблизительно в 2 раза, а при одновременной замене обоих D- и D'--боксов либо обоих С- и С'--боксов — снижается до уровня в контрольных клетках (рис. 7Г-Ж, таблица). Полученные данные позволили заключить, что С- и D-боксы являются ключевыми элементами в структуре синтетических аналогов С^-бокс-РНК, влияющими на глубину 2'--0-метилирования нукле-отидов рРНК при трансфекции их в клетки человека. Для влияния на модификацию рРНК достаточно одной пары C/D-боксов в структуре синтетической РНК. Удаление функциональных элементов — С-
76 | АСТА КАТиИАЕ | ТОМ 7 № 2 (25) 2015
Выход продукта терминации ОТ, соответствующего нуклеотиду Cm4506 28S рРНК клеток MCF-7, трансфициро-ванных аналогами C/D-бокс-РНК
Аналог C/D-бокс-РНК Изменения в структуре С/Б-бокс-РНК относительно аналога РНК5 Выход продукта терминации ОТ, соответствующего Cm4506 28S рРНК** Относительный выход продукта терминации***, %
РНК5 — 1100 ±154 100
РНК3 Сдвиг области узнавания на 3 нуклеоти-да к 5'--концу рРНК 6500 ± 780 590
РНК5mC Бокс С (AUGAUGU) ^ (ACAGCAC) — бокс С'- (GUGAUGA) ^ (GCAGCAG) 170 ± 25 15
РНК5D/N Бокс Б (CUGA) ^ ^ТС) 570 ± 86 50
РНК5mD Боксы Б и Б'- (CUGA) ^ (АААА) 150 ± 25 13
Контроль* - 150 ± 25 13
'-Контрольные клетки MCF-7 инкубировали в среде с липофектамином без РНК. **Представлены средние значения площадей пиков (± SD).
***Приведены значения относительного выхода продукта терминации ОТ, соответствующего Ст4506 28S рРНК, по сравнению с его выходом при ОТ 28S рРНК клеток MCF-7, трансфицированных РНК5.
и D-боксов — отменяет действие аналогов мяоРНК на структуру рРНК в трансфицированных клетках (рис. 7, таблица).
Полученные данные позволяют заключить, что аналоги C/D-бокс-РНК, проникая в клетки человека, влияют на посттранскрипционный процес-синг рибосомных РНК. Хотя трансфекция аналогов C/D-бокс-РНК в клетки MCF-7 не вызывала de novo 2'--0-метилирования заранее заданных нуклеотидов-мишеней рРНК, под действием синтетических аналогов происходило увеличение глубины природного 2'--0-метилирования нуклеотидов 28S рРНК.
Недавно показали, что в ряде линий опухолевых клеток повышение уровня отдельных C/D-бокс-РНК сопровождается увеличением содержания фибрил-ларина — ключевого компонента ядрышкового ме-тилтрансферазного комплекса [12]. Кроме того, профиль 2'--0-метилирования рРНК может различаться в раковых клетках различного происхождения [14]. В связи с этим предполагают, что регуляция созревания рибосомных РНК может влиять на онкотранс-формацию клеток и контролировать жизненный цикл раковых клеток [30, 31]. Поэтому наблюдаемый нами эффект синтетических РНК на 2'--0-метилирование нуклеотидов рРНК клеток человека указывает на перспективность разработки систем регуляции посттранскрипционного созревания рРНК, которые могут заложить основу для создания новых терапевтических подходов. Предложенный метод анализа 2'--0-метилированных нуклеотидов в составе РНК может использоваться как для выявления модификаций РНК, возникающих в результате направленного искусственного воздействия, так и для поиска
диагностически значимых различий в профиле модификаций РНК в клетках человека.
ЗАКЛЮЧЕНИЕ
В данной работе представлена адаптация метода терминации обратной транскрипции для выявления положений 2'--0-метилированных нуклеотидов в РНК и анализа 5'--флуоресцентно меченных кДНК-продуктов капиллярным гель-электрофорезом на автоматическом генном анализаторе. С помощью предложенного подхода проанализировано влияние синтетических аналогов малых ядрышковыхБ-бокс-РНК на профиль 2'--0-метилирования 28S рРНК человека в клетках линии MCF-7. Показано, что трансфекция клеток синтетическими аналогамиБ-бокс-РНК приводит к усилению терминации ОТ на известных сайтах 2'--0-метилирования рРНК, что указывает на существенное повышение глубины модификации отдельных нуклеотидов рРНК-мишеней. При этом ключевую роль в действии синтетических РНК играют консервативные структурные элементы мяоРНК — С- и D-боксы.
В настоящее время полагают, что посттранскрипционные модификации разных нуклеоти-дов рРНК являются независимыми процессами. Так, направленное введение дополнительных 2'--0-метилированных нуклеотидов в состав рРНК не влияет на выход модификации других нуклеоти-дов [28, 32]. Наши данные показывают, чтоБ-бокс-РНК, которая содержит область узнавания, направленную в заранее заданный нуклеотид, и при этом не индуцирует 2'--0-метилирование нуклеотида-ми-шени, может повлиять на глубину модификации дру-
гих нуклеотидов рРНК. Возможно, что наблюдаемый нами эффект отражает функционирование нового природного механизма взаимосвязанной регуляции посттранскрипционных модификаций нуклеотидов рРНК. Реализация такого механизма может влиять на глубину 2'--0-метилирования одних нуклеотидов при нарушении модификации других нуклеотидов,
сближенных в пространственной структуре ядрыш-кового предшественника рРНК. •
Работа поддержана РФФИ (гранты № 13−04−1 058 и 14−04−31 468) и Междисциплинарным интеграционным проектом СО РАН № 84 (2012−2014 гг.).
СПИСОК ЛИТЕРАТУРЫ
1. Lapeyre B. // Top. Curr. Genet. 2005. V. 12. P. 85−91.
2. Baxter-Roshek J.L., Petrov A.N., Dinman J.D. // PLoS One. 2007. V. 2. № 1. e174.
3. Piekna-Przybylska D., Decatur W.A., Fournier M.J. // Nucl. Acids Res. 2008. V. 36. D178−183.
4. Decatur W.A., Fournier M.J. // Trends Biochem. Sci. 2002. V. 27. № 7. P. 344−351.
5. Liang X.H., Liu Q., Fournier M.J. // Mol. Cell. 2007. V. 28. № 6. P. 965−977.
6. Esguerra J., Warringer J., Blomberg A. // RNA. 2008. V. 14. № 4. P. 649−656.
7. Liang X.H., Liu Q., Fournier M.J. // RNA. 2009. V. 15. № 9. P. 1716−1728.
8. Song X., Nazar R.N. // FEBS Lett. 2002. V. 523. № 1−3. P. 182−186.
9. Kiss-Laszlo Z., Henry Y., Bachellerie J.P., Caizergues-Ferrer M., Kiss T. // Cell. 1996. V. 85. № 7. P. 1077−1088.
10. Макарова Ю. А., Крамеров Д. А. // Молекуляр. биология. 2007. Т. 41. № 2. С. 246−259.
11. Reichow S.L., Hamma T., Ferre'--D'-Amare'- A.R., Varani G. // Nucl. Acids Res. 2007. V. 35. № 5. P. 1452−1464.
12. Su H., Xu T., Ganapathy S., Shadfan M., Long M., Huang T.H., Thompson I., Yuan Z.M. // Oncogene. 2014. V. 33. № 11. P. 1348−1358.
13. Marcel V., Ghayad S.E., Belin S., Therizols G., Morel A. -P., et al. // Cell. 2013. V. 24. № 3. P. 318−330.
14. Belin S., Beghin A., Solano-Gonzalez E., Bezin L., Brunet-Manquat S., et al. // PLoS One. 2009. V. 4. № 9. e7147.
15. Teittinen K.J., Laiho A., Uusimaki A., Pursiheimo J.P., Gyenesei A., Lohi O. // Cell. Oncol. (Dordr.). 2013. V. 36. № 1. P. 55−63.
16. Montanaro L., Trere D., Derenzini M. // Am. J. Pathol. 2008. V. 173. № 2. P. 301−310.
17. Freed E.F., Bleichert F., Dutca L.M., Baserga S.J. // Mol. Biosyst. 2010. V. 6. № 3. P. 481−493.
18. Степанов Г. А., Семенов Д. В., Кулигина Е. В., Коваль О. А., Рабинов И. В., Кит Ю. Я., Рихтер В. А. // Acta Naturae. 2012. Т. 4. № 1 (12). С. 34−43.
19. Stepanov G.A., Semenov D.V., Savelyeva A.V., Koval O.A., Kuligina E.V., Rabinov I.V., Richter V.A. // Biomed. Res. Int. 2013. ID: 656 158.
20. Maden B.E., Corbett M.E., Heeney P.A., Pugh K., Ajuh P.M. // Biochimie. 1995. V. 77. № 1−2. P. 22−29.
21. Maden B.E. // Methods. 2001. V. 25. № 3. P. 374−382.
22. Cavaille J., Nicoloso M., Bachellerie J.P. // Nature. 1996. V. 383. № 6602. P. 732−735.
23. Liu B., Fournier M.J. // RNA. 2004. V. 10. № 7. P. 1130−1141.
24. Graifer D., Molotkov M., Styazhkina V., Demeshkina N., Bulygin K., Eremina A., Ivanov A., Laletina E., Venyaminova A., Karpova G. // Nucl. Acids Res. 2004. V. 32. № 11. P. 32 823 293.
25. Bulygin K., Malygin A., Hountondji C., Graifer D., Karpova G. // Biochimie. 2013. V. 95. № 2. P. 195−203.
26. Lestrade L., Weber M.J. // Nucl. Acids Res. 2006. V. 34. D158−162.
27. Liu B., Ni J., Fournier M.J. // Methods. 2001. V. 23. № 3. P. 276−286.
28. Liu B., Liang X.H., Piekna-Przybylska D., Liu Q., Fournier M.J. // RNA Biol. 2008. V. 5. № 4. P. 249−254.
29. Rodriguez-Galan O., Garcia-Gomez J.J., de la Cruz J. // Biochim. Biophys. Acta. 2013. V. 1829. № 8. P. 775−790.
30. Williams G.T., Farzaneh F. // Nat. Rev. Cancer. 2012. V. 12. № 2. P. 84−88.
31. Mannoor K., Liao J., Jiang F. // Biochim. Biophys. Acta. 2012. V. 1826. № 1. P. 121−128.
32. Qu G., van Nues R.W., Watkins N.J., Maxwell E.S. // Mol. Cell. Biol. 2011. V. 31. № 2. P. 365−374.

ПоказатьСвернуть
Заполнить форму текущей работой