Молекулярная идентификация генотипов яровой пшеницы по аллельным вариантам HMW субъединиц глютенинов

Тип работы:
Сельскохозяйственные науки

Узнать стоимость новой

Детальная информация о работе

Выдержка из работы

УДК 633. 11:577. 114: 577.2. 08:631. 52
МОЛЕКУЛЯРНАЯ ИДЕНТИФИКАЦИЯ ГЕНОТИПОВ ЯРОВОЙ ПШЕНИЦЫ ПО АЛЛЕЛЬНЫМ ВАРИАНТАМ HMW СУБЪЕДИНИЦ ГЛЮТЕНИНОВ 1,2Абдулина И.Р., '-Вафин Р.Р., 2Тюлькин С.В., 1Зайнуллин Л.И., 1Алимова Ф.К., 3Асхадуллин Д.Ф., 3Асхадуллин Д.Ф., 3Василова Н.З.
ФГАО ВПО «Казанский (Приволжский) федеральный университет», Казань, e-mail: vafin-ramil@mail. ru-
2ФГБУ «Татарская межрегиональная ветеринарная лаборатория», Казань-
3ГНУ «Татарский научно-исследовательский институт сельского хозяйства Россельхозакадемии», Казань
Целью настоящей работы являлась молекулярная идентификация перспективных генотипов яровой пшеницы селекции ТатНИИСХ по аллельным вариантам HMW субъединиц глютенинов и апробация разработанного нами способа проведения ПЦР-ПДРФ-генотипирования с электрофорезной детекцией в агарозном геле. В результате молекулярно-генетической оценки 70 образцов яровой пшеницы установлено, что 32 генотипа Triticum aestivum имеют ассоциированную с высокими качествами зерна комбинацию субъединиц Ax2*/5 + 10 и могут рассматриваться как наиболее перспективные генотипы для дальнейшей селекционной работы по созданию сортов с высокими мукомольно-хлебопекарными качествами зерна. При апробации предложенного способа проведения ПЦР-ПДРФ, отличающегося от прототипа дополнительным введением этапа ПДРФ-анализа, нами получен обеспечиваемый заявленным способом технический результат, выраженный в эффективной идентификации аллельных вариантов HMW-GS, ввиду корректной интерпретации генерируемых ПЦР-ПДРФ-фрагментов.
Ключевые слова: HMW-GS, аллель, генотип, пшеница, идентификация, ПЦР, ПДРФ
MOLECULAR IDENTIFICATION OF SPRING WHEAT GENOTYPES BY ALLELIC VARIANTS OF THE HMW GLUTENIN SUBUNITS 1 2Abdulina I.R., '-Vafin R.R., 2Tyulkin S.V., '-Zaynullin L.I., '-Alimova F.K., 3Askhadullin D.F., 3Askhadullin D.F., 3Vasilova N.Z.
Kazan (Volga region) federal university, Kazan, e-mail: vafin-ramil@mail. ru-
2Tatar trans-regional veterinarian laboratory, Kazan-
3Tatar research institute of agriculture of RAAS, Kazan
The aim of this study was a molecular identification of perspective spring wheat genotypes of the Tatar research institute of agriculture by allelic variants of HMW glutenin subunits and approbation of the PCR-RFLP genotyping method with detection by agarose gel electrophoresis developed by us. In result of the molecular-genetic evaluation of 70 samples of spring wheat was found that 32 Triticum aestivum genotypes are associated with high grain quality combination of Ax2*/5 + 10 subunits and can be considered as the most perspective genotypes for further breeding to create varieties with high flour and baking qualities of grain. When testing a proposed PCR-RFLP method which was differed from a prototype by introducing additional stage of the RFLP-analysis, we have obtained technical result expressed in effective identification of allelic variants of HMW-GS in view of the correct interpretation of the generated PCR-RFLP fragments.
Keywords: HMW-GS, allele, genotype, wheat, identification, PCR, RFLP
Идентификация генотипов пшеницы по аллельным вариантам HMW субъединиц глютенинов является важным звеном в мар-кер-вспомогательной селекции сортов с высокими мукомольно-хлебопекарными качествами зерна [1, 2, 3, 4, 5].
Наиболее высокоточными подходами к оценке аллельного полиморфизма HMW субъединиц глютенинов служат способы идентификации на основе молекулярно-генетических методов исследования [1, 2, 3, 4, 5].
Так, одним из подходов к идентификации аллельных вариантов HMW-GS пшеницы является способ проведения ПЦР с праймерами: иМШ9Б + иМШ9Я (Ах1/ Axnull-и Ax2*-аллели), UMN25 °F + иМ№ 5Я (0×2- и 0×5-аллели) и UMN26 °F + иМ№ 6Я 0у10- и 0у12-аллели) с последующей де-
текциеи результатов реакции преимущественно методами капиллярного или вертикального гель-электрофореза в ПААГ [4].
Цель настоящей работы — молекулярная идентификация генотипов яровоИ пшеницы селекции ТатНИИСХ по аллельным вариантам HMW субъединиц глютенинов и апробация разработанного нами способа проведения ПЦР-ПДРФ-генотипирования с электрофорезной детекцией в агарозном геле.
Материалы и методы исследования
Молекулярно-генетическая оценка 70 образцов яровоИ пшеницы преимущественно селекции ТатНИИСХ на предмет идентификации генотипов по аллельным вариантам HMW субъединиц глютенинов (ИЫЖ-ОЯ) проведена методами ПЦР- и ПЦР-ПДРФ-анализа на основе общеизвестного [4] и разработанного нами способов генотипирования.
Экстракция геномной ДНК из зерновок яровой Амплификация геномной ДНК проведена на тер-
пшеницы молочно-восковой спелости урожая 2012 г. моциклере «PTC-200» (MJ Research) с использовани-
осуществлена коммерческим набором «ДНК-сорб С» ем праймеров [4, 5], перечень которых представлен
(«ЦНИИ эпидемиологии», Россия). в табл. 1.
Условия проведения ПЦР- и ПЦР-ПДРФ-анализа для идентификации аллельных вариантов HMW субъединиц глютенинов пшеницы
Праймеры По следовательно сти праймеров (5/-3/) Локус (аллели) Режим амплификации ПДРФ-анализ
UMN19 °F CGAGACAATATGAGCAGCAAG Glu-A1 (Ax1/ Axnull, Ax2*) *1: 94 °C — 4 мин х40: 94 °C — 30 с, 60 °C — 30 с, 72 °C — 30 с *1: 72 °C — 5 м HaeIII 37 °C — 2 часа
UMN25 °F GGGACAATACGAGCAGCAAA Glu-D1 (Dx2, Dx5) *1: 94 °C — 4 мин *40: 94 °C — 30 с, 60 °C -30 с, 72 °C — 30 с *1: 72 °C — 5 мин HaeIII 37 °C — 2 часа
UMN26 °F CGCAAGACAATATGAGCAAACT Glu-D1 (Dy10, Dy12) *1: 94 °C — 4 мин *40: 94 °C — 30 с, 60 °C — 30 с, 72 °C — 30 с *1: 72 °C — 7 мин HaeIII 37 °C — 2 часа
Axnull-F ACGTTCCCCTACAGGTACTA Glu-A1 (Axnull) *1: 94 °C — 4 мин *40: 94 °C — 1 мин, 58 °C — 1 мин, 72 °C — 1 мин *1: 72 °C — 7 мин
Детекция результатов ПЦР- и ПЦР-ПДРФ-анализа выполнена методом горизонтального электрофореза в 3% агарозном геле в буфере TBE (рН 8,0), содержащем этидий бромид с последующей визуализацией результатов в ультрафиолетовом трансиллюминаторе (X = 310 нм).
Размеры фрагментов ДНК оценены по подвижности в сравнении со стандартными ДНК маркерами. В работе использованы реактивы для молекулярнобиологических исследований производства ООО «СибЭнзим» (Россия).
Выравнивание частичных нуклеотидных последовательностей аллелей HMW субъединиц глютенинов: CLUSTAL W (v. 1. 83). ПЦР-ПДРФ-моделирование: NEBcutter v.2.0.
Результаты исследования и их обсуждение
По результатам практических исследований, направленных на апробацию предложенного способа проведения ПЦР-ПДРФ, нами получен обеспечиваемый заявленным способом технический результат, выраженный в эффективной идентификации аллельных вариантов HMW-GS, ввиду корректной интерпретации при элек-трофорезной детекции в агарозном геле генерируемых ПЦР-ПДРФ-фрагментов
(рис. 2, 4, 6), сопоставимых с расчетными данными (рис. 1, 3, 5).
Отличительным признаком предложенного способа генотипирования от прототипа [4] является дополнительное введение этапа ПДРФ-анализа с эндонуклеазным расщеплением ампликонов рестриктазой
НаеШ с последующей детекцией результатов анализа методом горизонтального электрофореза в агарозном геле.
В результате молекулярно-генетической оценки на предмет идентификации генотипов по аллельным вариантам Glu-A1 -локуса HMW субъединиц глютенинов установлено, что из 70 происследованных образцов яровой пшеницы 13 растений (18,6%) имели субъединицу Ах1, кодируемую аллельным вариантом Glu-A1a (Ах1 -аллель), а 57 образцов (81,4%) — субъединицу Ах2*, ко -дируемую аллельным вариантом Glu-A1b (Ах2*-аллель) (табл. 2).
При оценке этих же образцов яровой пшеницы по Glu-D1 -локусу HMW-GS выяснено, что 44 растения (62,9%) характеризовались наличием комбинации субъединиц Бх5 и Бу10 (5 + 10), кодируемой аллельным вариантом Glu-D1d (0×5- и 0у10-аллели), а 26 образцов (37,1%) имели комбинацию субъединиц Бх2 и Бу12 (2 + 12), кодируемую аллельным вариантом GluD1a 0×2-и 0у12-аллели) (см. табл. 2).
Распределение же исследуемых генотипов по совокупной комбинации Glu-A1-/Glu-01 -локусов HMW субъединиц глютенинов было следующим: Ах1/5 + 10 = 12 (17,1%) — Ах½ + 12 = 1 (1,4%)-Ах2*/5 + 10 = 32 (45,7%) — Ах2*/2 + 12 = 25 (35,7%) образцов яровой пшеницы- с преобладанием желаемой для селекции на мукомольно-хлебопекарные качества зерна комбинацией субъединиц Ах2*/5 + 10.
¦ вюьоатсль ЗСТЕКСББ ¦
Рис. 1. Выравнивание фланкируемых с праймерами ПМЫ19Е + иМЫ19К нуклеотидных последовательностей Ах1-, Лхт11- и Ах2*-аллелей ОЫ-А1-локуса HMW субъединиц глютенинов пшеницы, НаеШ-рестрикционное картирование и моделирование НаеШ-ПЦР-ПДРФ-профилей
Рис. 2. Электрофореграмма технического результата предложенного способа проведения ПЦР-ПДРФ и прототипа в постановке ПЦР (праймеры ПМЫ19Е + иМЫ19Я) для идентификации аллельных вариантов (Ax1/Axnull и Ах2*) HMW субъединиц глютенинов пшеницы
Обозначения: М) ДНК-маркеры 100 Ьр (СибЭнзим). 1−4) HaeIII-ПЦР-ПДРФ-ана-лиз (предложенный способ): 1−2) Лх2*-аллель (172/153/19 Ьр) — 3−4) Лх1/Лхпи11-аллели (172/171/19 Ьр). 5−8) ПЦР-анализ (прототип): 5−6) Лх2*-аллель (344 Ьр) — 7−8) Лх1/Лхпи11-аллели (362 Ьр).
Рис. 3. Выравнивание фланкируемых с праймерами ПМЫ25Е + иМЫ25К нуклеотидных последовательностей 0×2- и Dx5-аллелей О1и-Б1-локуса НМЖ субъединиц глютенинов пшеницы, НаеШ-рестрикционное картирование и моделирование НаеШ-ПЦР-ПДРФ-профилей
Рис. 4. Электрофореграмма технического результата предложенного способа проведения ПЦР-ПДРФ и прототипа в постановке ПЦР (праймеры ПМЫ25Е + ПМШ5Я) для идентификации аллельных вариантов (0×2 и 0×5) НМЖ субъединиц глютенинов пшеницы
Обозначения: М) ДНК-маркеры 100 Ьр (СибЭнзим). 1−4) НаеШ-ПЦР-ПДРФ-анализ (предложенный способ): 1−2) Dx2-аллель (171/109/19 Ьр) — 3−4) Dx5-аллель (171/91/19 Ьр). 5−8) ПЦР-анализ (прототип): 5−6) Dx2-аллель (299 Ьр) — 7−8) Dx5-аллель (281 Ьр).
Учитывая общеизвестный факт положительного влияния аллельных вариантов ОЫ^М и О1и-А1Ь на повышение мукомольно-хлебопекарных качеств и отрицательного влияния аллельных вариантов О1и^1а и О1и-А1а НМЖ-ОБ, приводящих к снижению хлебопекарных свойств пшеницы, можно констатировать, что из
70 исследованных образцов яровой пшеницы 32 генотипа ТгШеит aestivum имеют ассоциированную с высокими качествами зерна комбинацию субъединиц Лх2*/5 + 10 и могут рассматриваться как наиболее перспективные генотипы для дальнейшей селекционной работы по созданию сортов с высокими мукомольно-хлебопекарными качествами зерна.
Рис. 5. Выравнивание фланкируемых с праймерами UMN26 °F + UMN26R нуклеотидных последовательностей DyIO- и Dy^-аллелей Glu-DI-локуса HMW субъединиц глютенинов пшеницы, HaeIII-рестрикционное картирование и моделирование HaeIII-ПЦР-ПДРФ-профилей
Рис. 6. Электрофореграмма технического результата предложенного способа проведения ПЦР-ПДРФ и прототипа в постановке ПЦР (праймеры иМЫ26Е + иМЫ26Я) для идентификации аллельных вариантов (Бу10 и Оу12) ИМЖ субъединиц глютенинов пшеницы
Обозначения: M) ДНК-маркеры 1UU bp (СибЭнзим). 1−4) HaeIII-ПЦР-ПДРФ-анализ (предложенный способ): 1−2) DyI2-аллель (241/174 bp) — 3−4) DyIO-аллель (223/174 bp). 5−8) ПЦР-анализ (прототип): 5-б) Dy^-аллель (415 bp) — 7−8) DyIO-аллель (397 bp).
Таблица 2
Молекулярно-генетическая оценка образцов яровой пшеницы на предмет идентификации генотипов по HMW субъединицам глютенинов
№ п/п Сорт/линия HMW-глютенины № п/п Сорт/линия HMW-глютенины
ОІи-Б1-локус ОІи-Л1- локус ОІи-Б1-локус ОІи-Л1- локус
5 + 10 2 + 12 Ах1 Ах2* 5 + 10 2 + 12 Ах1 Ах2*
1 Казанская Юбилейная — + - + 36 К-27/00−2 + - - +
2 К-109/02−5 — + - + 37 К-23/00−3 + - - +
3 Экада 97 — + - + 38 К-414/01−1 + - + -
4 К-100/03−2 + - - + 39 К-21/00 + - - +
5 К-18/03−8 + - - + 40 К-58/01−2 + - - +
6 К-68/04−5 + - - + 41 К-48/04−2 + - - +
7 К-130/04−10 + - - + 42 К-106/01−2 — + - +
8 Злата + - - + 43 К-101/04−3 + - - +
9 К-88/02−19 + - - + 44 К-112/04−2 + - + -
10 К-6/01−2 + - - + 45 К-134/04−19 + - + -
11 К-5/03−6 — + - + 46 К-51/00−3 + - + -
12 К-48/03 + - + - 47 К-133/05−5 + - - +
13 К-100/03−8 — + - + 48 К-57/05−6 + - + -
14 К-21/02−5 — + - + 49 К-117/04−4 + - - +
15 К-46/04−9 + - - + 50 К-12/04 — + - +
16 К-68/04−1 + - - + 51 К-99/05−2 — + - +
17 К-23/04−1 + - - + 52 Кк-8/06−1 — + - +
18 К-49/04 + - + - 53 Кк-71/06−3 + - - +
19 К-7/04−2 + - - + 54 Кк-8/06−6 — + - +
20 Экада 113 — + - + 55 Кк-75/06−3 + - - +
21 Экада 109 + - - + 56 Кк-11/06−11 + - - +
22 К-93/05−2 + - + - 57 Кк-11/06−10 + - - +
23 К-29/02−5 + - + - 58 Кк-69/06−4 — + - +
24 К-109/02−13 + - + 59 Кк-6/07−2 + - - +
25 К-20/02−2 + - - + 60 Кк-69/06−1 — + - +
26 К-73/03−4 + - - + 61 Кк-71/06−8 + - - +
27 К-68/04−4 + - - + 62 Кк-75/06−5 — + - +
28 К-100/03−9 — + - + 63 О-192/03−5 — + - +
29 К-7/04−1 — + - + 64 О-25/05−2 — + +
30 К-65/05−2 + - + - 65 О-206/05−2, д. 515−10 + - + -
31 К-11/04−8 — + - + 66 О-186/04−1 + - - +
32 Экада 66 + - - + 67 О-464/02−2 — + - +
33 Казанская Юбилейная (неполег.) — + - + 68 О-513/00−21 — + + -
34 К-65/05−1 + - + - 69 Эр. 255/00−3-1 — + - +
35 Симбирцит + - - + 70 О-28/05−2 — + - +
Примечание: + - наличие соответствующих субъединиц HMW-глютенинов
— - отсутствие соответствующих субъединиц HMW-глютенинов
Выражаем благодарность Вафину Ри-шаду Абдулфартовичу за оказанную финансовую поддержку.
Список литературы
1. Ghazy A.I. Molecular screening of high molecular weight glutenin genes in spring bread wheat genotypes in Saudi Arabia / A.I. Ghazy, A.I. Zanouny, K.A. Moustafa, A.A. Al-Doss // Journal of Food, Agriculture & amp- Environment. — 2012. -Vol. 10. — № 1. — P. 157−161.
2. Kocourkova Z. Wheat breeding for the improved bread-making quality using PCR based markers of glutenins / Z. Kocourkova, J. Bradova, Z. Kohutova, L. Slamova, P. Vejl, P. Horcicka // Czech J. Genet. Plant Breed. — 2008. — Vol. 44. -№ 3. — P. 105−113.
3. Lafiandra D. PCR analysis of x- and y-type genes present at the complex Glu-A1 locus in durum and bread wheat / D. Lafiandra, G.F. Tucci, A. Pavoni, T. Turchetta, B. Margiotta // Theor. Appl. Genet. — 1997. — Vol. 94. — P. 235−240.
4. Liu S. New DNA markers for high molecular weight glutenin subunits in wheat / S. Liu, S. Chao, J.A. Anderson // Theor. Appl. Genet. — 2008. — Vol. 118. — № 1. — P. 173−183.
5. Moczulski M. Multiplex PCR identification of wheat HMW glutenin subunit genes by allele-specific markers / M. Moczulski, B. P Salmanowicz // J. Appl. Genet. — 2003. -Vol. 44. — № 4. — P. 45971.
1. Ghazy, A.I. Molecular screening of high molecular weight glutenin genes in spring bread wheat genotypes in Saudi Arabia / A.I. Ghazy, A.I. Zanouny, K.A. Moustafa, A.A. Al-Doss //
Journal of Food, Agriculture & amp- Environment. 2012. Vol. 10. no. 1. pp. 157−161.
2. Kocourkova Z. Wheat breeding for the improved bread-making quality using PCR based markers of glutenins / Z. Kocourkova, J. Bradova, Z. Kohutova, L. Slamova, P Vejl, P Horcicka // Czech J. Genet. Plant Breed. 2008. Vol. 44. no. 3. pp. 105−113.
3. Lafiandra, D. PCR analysis of x- and y-type genes present at the complex Glu-A1 locus in durum and bread wheat / D. Lafiandra, G.F. Tucci, A. Pavoni, T. Turchetta, B. Margiotta // Theor. Appl. Genet. 1997. Vol. 94. pp. 235−240.
4. Liu, S. New DNA markers for high molecular weight glutenin subunits in wheat / S. Liu, S. Chao, J.A. Anderson // Theor. Appl. Genet. 2008. Vol. 118. no. 1. pp. 173−183.
5. Moczulski M. Multiplex PCR identification of wheat HMW glutenin subunit genes by allele-specific markers / M. Moczulski, B.P. Salmanowicz // J. Appl. Genet. 2003. Vol. 44. no. 4. pp. 459−471.
Абрамова З. И., д.б.н., профессор кафедры биохимии Института фундаментальной медицины и биологии Казанского (Приволжского) федерального университета, г. Казань-
Багаева Т. В., д.б.н., профессор, зав. кафедрой биотехнологии Института фундаментальной медицины и биологии Казанского (Приволжского) федерального университета, г. Казань.
Работа поступила в редакцию 14. 02. 2013.

Показать Свернуть
Заполнить форму текущей работой