Молекулярно-генетические методы отбора устойчивых к почковому клещу (Cecidophyopsis ribis) генотипов черной смородины

Тип работы:
Реферат
Предмет:
Сельскохозяйственные науки


Узнать стоимость

Детальная информация о работе

Выдержка из работы

Современное садоводство
4/2015
Contemporary horticulture
Electronic Journal
УДК [634. 723+634. 75]:632. 3/. 7:631. 528
М. А. Шавыркина, н.с., аспирант С. Д. Князев, д.с. -х.н. А. В. Пикунова, к.с. -х.н.
170
[ЛЕТ ВНИИСПК VNIISPK ANNIVERSARY
ФГБНУ ВНИИ селекции плодовых культур, Россия, Орел, info@vniispk. ru
Молекулярно-генетические методы отбора устойчивых к почковому клещу (Cecidophyopsisribis) генотипов черной смородины
Исследование выполнено при финансовой поддержке Российского научного фонда (проект № 14−16−127)
Аннотация
В статье приведены результаты анализа гибридных семей смородины черной селекции ВНИИСПК, полученных от анализирующих скрещиваний устойчивых и восприимчивых к почковому клещу родителей, на присутствие ДНК-маркера гена Ce. Всего проанализировано 47 генотипов на наличие и отсутствие SCAR маркера, амплифицируемого парой праймеров GMresa. В результате исследования был осуществлен отбор устойчивых генотипов на ранних стадиях развития (в школке сеянцев), выделены образцы, несущие SCAR маркер гена Се, которые будут подвергнуты дальнейшим селекционным наблюдениям, в т. ч. на качество плодов. Маркер опосредованная селекция позволяет проводить более точный отбор по определенным признакам, а так же сократить объем наблюдаемых гибридов на самых ранних этапах селекции, что в целом будет способствовать повышению эффективности селекции.
Ключевые слова: смородина черная, селекция, устойчивость, почковый клещ, SCAR маркер гена Се
UDC [634. 723+634. 75]:632. 3/. 7:631. 528
M. A. Shavyrkina, research worker, postgraduate student S. D. Knyazev, doctor of agricultural sciences А. V. Pikunova, candidate of agricultural sciences
Russian Research Institute of Fruit Crop Breeding, Russia, Orel, info@vniispk. ru
Molecular and genetic methods of selection
of blackcurrant genotypes resistant to gall mite (Cecidophyopsis ribis)
The research was done at the expense of the grant allocated by the Russian Science Foundation (Project No 14−16−127)
The article presents the results of the analysis of hybrid families of black currants of the VNIISPK breeding, obtained from analyses of crosses of resistant and susceptible to gall mite parents for the presence of a DNA marker gene Ce. 47 genotypes, were analyzed for the presence and absence of SCAR marker amplified by GMresa pare primers. As a result of the studies, the resistant genotypes were selected at early stages of development (nursery seedlings), as well as genotypes carrying SCAR marker gene Cе were revealed and they would
Abstract
Электронный журнал
Современное садоводство 4/2015 Contemporary horticulture
Electronic Journal
be subjected to further breeding observations, including the quality of the fruit. Marker assisted selection allows performing more precise selection for certain traits as well as reducing a number of studied hybrids at the earliest stages of breeding, which would enhance the efficiency of selection.
Key words: black currant, breeding, resistance, gall mite, SCAR marker gene Ce
Введение
Одной из основных проблем селекции смородины черной является повышение эффективности отбора устойчивых к болезням и вредителям генотипов. Внедрение молекулярно-генетических методов отбора устойчивых к болезням и почковому клещу генотипов в дополнении к фенотипической оценке в полевых условиях по другим параметрам будет способствовать повышению эффективности исследований в данном направлении.
Почковый клещ Cecidophyopsis ribis — наиболее опасный, ма- лоуязвимый вредитель смородины черной, который также является переносчиком очень опасного заболевания махровости, или реверсии [1]. Селекция на устойчивость затрудняется необходимостью создания инфекционных участков, которые представляют опасность для окружающих плантаций. [2]
В настоящий момент идентифицировано два гена устойчивости к почковому клещу: это ген Р [4]. и ген Ce [10]. Ген Р был идентифицирован у сибирского подвида смородины черной. Ген Ce определяющий устойчивость к почковому клещу, в результате сложных скрещиваний был передан смородине черной от крыжовника. Ген Се имеет преимущество перед геном Р в том, что обладающие им растения не поражаются реверсией. [5,10]
В Шотландском Научно-Исследовательском Институте Сельскохозяйственных Культур (SCRI) был разработан и рекомендован для маркер-опосредованной селекции SCAR маркер, амплифицируемый парой праймеров GMresa, связанный с геном Се. [7]
Ранее данный маркер прошел проверку на сортах и формах из коллекции ВНИИСПК. Полученные данные о присутствии маркера совпадают с селекционными данными о наличии гена, основанных на результатах многолетних полевых наблюдений и анализе родословных. На основании чего, был сделан вывод, что данный метод может быть использован на ранних стадиях онтогенеза для отбора генотипов несущих ген Се. [3]
Целью наших исследований являлась оценка гибридов в селекционной школке на устойчивость к почковому клещу путем выявление SCAR маркера гена Се.
Материалы и методы
С потенциально устойчивыми к почковому клещу генотипами проведены анализирующие скрещивания с восприимчивыми к данному вредителю сортами (Гетьманская, Селеченская, Сокровище, Изюмная).
В качестве объектов исследования взяты 47 образцов из пяти комбинаций скрещивания:
4932(3349−48−27 х Изюмная) —
4962(Кипиана х Изюмная) —
4934(2061−37−111 х Селеченская) —
4950(Арапка х Сокровище) —
4967(3814−47−70 x Гетьманская)
Выделение растительной ДНК проводилось из молодых листьев по методике, предложенной J.J. Doyle and J. L. Doyle [8].
Скрининг гибридов на присутствие SCAR маркера гена Се проводился по методике Brennan et al. [7], оптимизированной к условиям лаборатории.
Реакцию амплификации проводили в реакционной смеси конечным объемом 20 мкл, содержащей 1,6 мМ MgCl2, 0,2 мМ каждого dNTP- 0,17 мкМ обоих праймеров (GMresaF 5^ TTACCGCAGATACAAGGTGAAG 3^ и GMresaR 5^ GGACTAGGCCTTCTTATGAC 3& quot-[6]- 0,3 единицы Taq DNA polimerase, 1x ПЦР буфер, и 10 нг геномной ДНК, в термоциклере GeneAmp ПЦР System2700 («Applied Biosystems», США). Режим амплификации: денатурация — 30 сек. при 94°С- отжиг праймера — 30 сек. при 60°С- синтез ДНК — 30 сек при 72 °C (числом циклов — 30) — предварительная денатурацией — 15 мин (94°С) и завершающая элонгация — 10 мин при 72 °C. Продукты амплификации разделяют путём горизонтального электрофореза в 2% агарозном геле в 1хТВЕ буфере c окрашиванием бромидом этидия. При разделении фрагментов на геле используют GeneRuler™ Express DNA Ladder (Fermentas) маркер молекулярных масс.
Результаты исследований
Для проверки качества и концентрации ДНК проводили амплификацию микросателлитного локуса g2-j08. При амплификации получены фрагменты размером около 150 п.н., что свидетельствует о работоспособности и соответственно пригодности ДНК этих образцов для дальнейших исследований (рисунок 1).
Рисунок 1 — Электрофореграмма амплификации SSR локуса g2-j08, 2% агарозный гель (вверху — названия образцов, м.м. — маркер молекулярного веса 50 bp, справа указан размер фрагмента ПЦР продукта в п.н.)
При проведении SCAR маркирования было определено наличие или отсутствие SCAR маркера гена Се у всех 47 изученных образцов 5 гибридных семей. В качестве положительного контроля использовали ДНК сорта Кипиана, для контроля возможной контаминации ввели отрицательный контроль, куда ДНК не добавляли. В семье 4932 (3349−48−27 х Изюмная) проанализировано 3 образца, наличие SCAR маркера не обнаружено. В семье 4962 (Кипиана х Изюмная) наличие SCAR маркера обнаружено у 1генотипа, отсутствие-у 1 генотипа (рисунок 2).
Рисунок 2 — Электрофореграмма ПЦР продуктов с парой праймеров GMresa к гену Ce- где М-маркер молекулярного веса 50 bp, справа указан размер фрагмента ПЦР продукта в п.н.- +К и -К — положительный и отрицательный контроли
В семье 4934 (2061−37−111 х Селеченская) — проанализировано 13 образцов, из них SCAR маркер был амплифицирован у 4 образцов. Наличие SCAR маркера не обнаружено в семье 4950 (Арапка х Сокровище), всего изучено 13 генотипов. Присутствие SCAR маркера выявлено у 2 образцов, отсутствие — у 14 образцов в семье 4967(3814−47−70 х Гетьманская)(таблица 1).
Таблица 1 — Анализ гибридных семей смородины черной на присутствие маркера гена Ce
Количество Количество Количество
проанализи- образцов с образцов с
рованных наличием SCAR отсутствием SCAR
Гибридная семья
4932 (3349−48−27(Се) х Изюмная) 3 0 3
4962 (Кипиана (Се) х Изюмная) 2 1 1
4934 (2061−37−111(Се) х Селеченская) 13 4 9
4950 (Арапка (Се) х Сокровище) 13 0 13
4967(3814−47−70 (Се) х Гетьманская) 16 2 14
Таким образом, в результате проведенных исследований проведен отбор гибридов на ранних стадиях онтогенеза, что позволяет проводить выбраковку восприимчивых генотипов в селекционной школке и интенсифицировать селекционный процесс. Выделены образцы, несущие SCAR маркер гена Се, которые будут подвергнуты дальнейшим селекционным наблюдениям по комплексу хозяйственных признаков.
Маркер-опосредованная селекция позволяет проводить более точный отбор по определенным признакам, а так же сократить объем наблюдаемых гибридов на самых ранних этапах селекции, что в целом будет способствовать повышению эффективности селекции.
Литература
1. Князев С. Д. Устойчивость к почковому клещу — актуальная проблема черной смородины // Молодые ученые России: Тезисы докладов Всероссийского совещания. -М., 1995. С. 56−59.
2. Князев С. Д., Огольцова Т. П. Селекция смородины черной на современном этапе. — Орел: ОрелГАУ, 2004. 238 с.
3. Пикунова А. В. Использование молекулярных маркеров для оценки исходного селекционного материала ягодных культур/А.В. Пикунова// Вестник Орловского государственного аграрного университета. 2011. Т. 30. № 3. С. 29−31.
4. Anderson, M. M. Resistance to gall mite (Phytoptus ribes Nal.) in the Eucorcosma section of Ribes. Euphytica 20 / M. M. Anderson. 1971. P. 422−426.
5. Brennan R. M. The use of metabolic profiling in the identification of gall mite (Cecidophyopsis ribes Westw) — resistant blackcurrant (Ribes nigrum. L.) genotypes. / R. M. Brennan, G. W. Robertson, J.W. McNicol Tyffe and J. E. Hall // Ann appl. Biol., 1992. № 121. P. 503−504. DOI: 10. 1111/j. 1744−7348. 1992. tb03460. x
6. Brennan R. et al. Future perspectives in blackcurrant breeding / R. Brennan et al. //Acta Hortic, 2002. V. 585. P. 39−45.
7. Brennan R. The development of a PCR-based marker linked to resistance to the blackcurrant gall mite (Cecidophyopsis ribis Acari: Eriophyidae)/ R. Brennan et al. //Teoretical and Applied Genetics, 2009. V. 118. P. 205−211. DOI: 10. 1007/s00122−008−0889-x
8. Doyle, J. J., Doyle, J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue / J.J. Doyle and J. L. Doyle // Phytochemical bulletin. 1987. V. 19 P. 11−15.
9. Knight R.L., Keep E., Briggs J.B., Parker J. Transference of resistance to black currant gall mite Cecidophyopsis ribis from gooseberry to black currant// Ann. Appl. Biol. 1974−76. P. 123−130.
10. Knight V.H. Screening black currant for resistance to the gull mite Cecidophyopsis Ribes (Westw.). In Breeding for resistance to insects and mites. Bulletin of the International Union for Biological Science, International Organization for Biological Control of Noxious Animals and Plants, 1981. P. 89−93.
References
1. Knyazev S.D. (1995): Resistance to bud mite is an urgent problem of black currant In: Col. Proc. of Young scientists of Russia. Moscow: 56−59. (In Russian).
2. Knyazev S.D., Ogoltsova T.P. (2004): Black currant breeding at present. Orel, OrelGAU. (in Russian).
3. Pikunova A.V. (2011): Using molecular markers to assess the initial breeding material of fruit crops. Vestnik OrelGAU, 30(3): 29−31. (In Russian).
4. Anderson M.M. (1971): Resistance to gall mite (Phytoptus ribes Nal.) in the Eucorcosma section of Ribes. Euphytica, 20(3): 422−426.
5. Brennan R.M., Robertson G.W., McNicol Tyffe J.W., Hall J.E. (1992): The use of metabolic profiling in the identification of gall mite (Cecidophyopsis ribes Westw) — resistant blackcurrant (Ribes nigrum L.) genotypes. Ann appl. Biol., 121: 503−504. DOI: 10. 1111/j. 1744−7348. 1992. tb03460. x
6. Brennan R.M., Gordon S.L. (2002): Future perspectives in blackcurrant breeding. Acta Hortic. 585: 39−45. DOI: 10. 17 660/ActaHortic. 2002. 585. 2
7. Brennan R., Jorgensen L., Gordon S., Loades K., Hackett C., Russell J. (2009): The development of a PCR-based marker linked to resistance to the blackcurrant gall mite (Cecidophyopsis ribis Acari: Eriophyidae). Teoretical and Applied Genetics, 118: 205−211. DOI: 10. 1007/s00122−008−0889-x
8. Doyle J.J., Doyle J.L. (1987): A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull., 19: 11−15.
9. Knight R.L., Keep E., Briggs J.B., Parker J. (1974): Transference of resistance to black currant gall mite Cecidophyopsis ribis from gooseberry to black currant. Ann. Appl. Biol., 76: 123−130.
10. Knight V.H. (1981): Screening black currant for resistance to the gall mite Cecidophyopsis Ribes (Westw.). In: Breeding for resistance to insects and mites. Bulletin of the International Union for Biological Science, International Organization for Biological Control of Noxious Animals and Plants: 89−93.

ПоказатьСвернуть
Заполнить форму текущей работой