Allelic state and effects of Vrn genes on soft wheat in in vivo and in vitro systems

Тип работы:
Реферат
Предмет:
Биология


Узнать стоимость новой

Детальная информация о работе

Выдержка из работы

BicHUK, fl, mnponeTpoBCBKoro ymBepcrneTy. Bionoria, eKonoria. Visnik Dnipropetrovs'-kogo universitetu. Seria Biologia, ekologia Visnyk of Dnepropetrovsk University. Biology, ecology.
Visn. Dnipropetr. Univ. Ser. Biol. Ekol. 2016. 24(1), 222−229.
doi: 10. 15 421/011627
ISSN 2310−0842 print ISSN 2312−301X online
www. ecology. dp. ua
УДК 577. 21+581. 143. 6:633. 11
Алельний стан i ефекти гешв VRN пшеницi м'-якоУ у rncreMi in vivo та in vitro
О.О. Авксентьева1, ВВ. Шулк2
'-КиЧвський нацюналъний утверситет iMeni Тараса Шевченка, Кив, Украта 2Харшвський нацюналъний утверситет iменi В. Н. Каразта, Харюв, Украта
Дослщжено прояв ефектш головно! генетично! системи контролю типу та темтв розвитку м'-яко! пшениц! — VRN (vernalization) на рiвнi цшсно! системи росдинного органiзму in vivo та популяци окремих кадусних клпин in vitro. Дослщжено алельний стан системи генв VRN, яю детермшують потребу або нечутливiсть Triticum aestivum L. до яровизаци та предетермшаци щею системою процесу кадусогенезу in vitro. У досщдах використовувади сучасну модельну систему — майже гзогент моногенно-дом!нантн! лши (NILs) ярого типу розвитку, що створен! в генофонах озимих сорпв пшениц! Мирошвська 808 i Ольвш. Молеку-лярно-генетичний анадiз аделiв локуот генiв VRN проводився на зернiвках i пересадковш кадуснiй культур! з використанням п'-яти пар специф! чних праймер1 В (Grain Gene Mass Wheat) методом ПЛР. Генетична система контролю темшв розвитку м'-яко! пшениц! детермшуе частоту кадусогенезу, аде не впливае на морфолоичн особливосп первинно! та пересадково! кадусно! ткани-ни. З'-ясовано, що у зершвках in vivo та культур! in vitro гзогенних л1н1й алельний стан генв VRN майже щентичний. Виявлено вщмшносп в адельному стан гена Vrn В1 у? золши Vrn 3 сорту МироЩвська 808 у зершвках i кадуснш культур^ що може бути пов'-язано з геномними перебудовами за умов шдукци кадусогенезу. Проведет дослщження свщчать про односпрямоватсть функщонування гещв системи VRN у систем in vivo та in vitro.
Ключовi слова: Triticum aestivum- NILs- генетична система VRN- темпи розвитку- культура in vitro- частота кадусогенезу- ПЛР анад1з- алельт вар1анти
Allelic state and effects of VRN genes on soft wheat in in vivo and in vitro systems
O.O. Aksentyeva1, V.V. Shulik2
'-Taras Shevchenko Kyiv National University, Kyiv, Ukraine 2V.N. Karazin Kharkiv National University, Kharkiv, Ukraine
The article investigates the effects of the main manifestations of the genetic system controlling the type and rate of wheat development -VRN (vernalization) at the level of an integrated system of plant organism in vivo and callus certain population of cells in vitro. The paper studies the system of allelic VRN genes, which determine the need or insensitivity Triticum aestivum L. to vernalization and predetermination process of callusogenesis by the present system in vitro. In the experiments the modern model system of nearly isogenic lines (NILs) of spring type was used. The NILs were created in genotypes of the winter varieties Myronivska 808 and Olvia. Molecular genetic analysis of allelic loci of VRN genes was carried out by PCR analysis on grains and secondary callus culture using five pairs of specific primers (Grain Gene Mass Wheat). In the course of the experiments, it was found that the genetic system controlling the wheat rate determined the frequency of callusogenesis. However, the studied genetic system did not affect the morphological characteristics of primary and secondary callus tissue. In both hexaploid wheat cultivars the maximum frequency of callusogenesis appeared to be characterized in the Vrn 2 isogenic line and the original variety, slowly developing and intensely accumulating vegetative mass in vivo. The minimal frequency of callusogenesis was determined in the VRN 1 and VRN 3 isogenic lines, characterized by the rapid development of vegetation. The callus was derived from immature wheat embryos by morphological features analysis. Calluses with low water content, mainly, amorphous, compact, transparent, white or with yellowish tint were identified. Using PCR analysis, in grains in vivo and in the callus culture in vitro the
КиОвський нацюнальнш утверситет мет Тараса Шевченка, пр. Академка Глушкова, 2, Кшв, 3 022, Украта Taras Shevchenko Kyiv National University, Akademik Glushkov Ave., 2, Kyiv, 3 022, Ukraine Tel.: +38−066−281−98−25. E-mail: avksentyeva@rambler. ru
Харювський нацюнальнш утверситет жею В. Н. Каразта, майдан Свободи, 4, Харпв, 61 022, Украта V.N. Karazin Kharkiv National University, Svobody Sq., 4, Kharkiv, 61 022, Ukraine Tel.: +38−066−807−89−33. E-mail: vikoza. vika@mail. ru
almost identical allelic status of VRN genes was revealed. In grains and callus of Vrn 1 isogenic lines of both wheat varieties the presence of a dominant gene VRN A1 and recessive VRN B1 and VRN D1 was detected, whereas in VRN 2 — a dominant gene VRN B1 and recessive VRN A1 and VRN D1. However, the dominant allele VRN D1 in the studied NILs was detected. Therefore, in varieties of grains and callus cultures all genes are represented only by recessive alleles VRN A1, VRN B1 and VRN D1. Differences were found in the callus culture of VRN 3 isogenic line of Myronivska 808 on the allelic state of theVRN B1 gene. The obtained results could be associated with genomic reconstructions during callusogenesis induction. Our studies indicate the unidirectional system of VRN genes functioning, which appears to be the main control system of type and rate of soft wheat development in the system in vivo and in vitro. This allows us to assume the role of the VRN genetic system in the determination of callusogenesis, and also the adequacy of the functioning of the system in vitro processes, determining the system of integration of plants. Thus, our study confirms that the callus tissues cells of higher plants are able to preserve the cells properties of the whole organism along with the acquisition of new specific properties. Moreover, the culture in vitro is an adequate system for the study of the plant organism properties as a system.
Keywords: Triticum aestivum- NILs- VRN genetic system- rate of development- culture in vitro- frequency of callusogenesis- PCR analysis- allelic variants
Вступ
Тип, темпи розвитку та тривалсть онтогенезу у м'-яко! пшениц детермшуються декшькома генетичними системами — генами VRN (vernalization response) i PPD (photoperiod response), що визначають реакцю пшенищ на яровизащю та триватсть дня, а також генами VRD, яш визначають тривалсть яровизацшного перюду та комплекс гешв EPS-earliness per se (скороститсть як така) (Cockram, 2007- Kumar et al., 2012- Stelmakh, 1998). Цд гени, впливаючи на швидюсть розвитку рослин (Potokina et al., 2012), визначають також низку шших щнних для господарства ознак: структуру врожаю, морозо- та зимо-стшюсть, стшюсть до захворювань (Khotyljov, 2002). Роль цих генетичних систем у контролд переходу рослин пшениц вдд вегетативного до генеративного розвитку неод-накова. Головна серед даних генетичних систем — система гешв VRN (три — п'-ять локусдв), яка впливае на термши переходу до колосшня i, вДдповддно, на загальну трива-лдсть вегетацшного перюду (Emtceva, 2012- Distelfeld, 2009- Dubcovsky, 2006- Trevaskis, 2010). Реакця на яровизащю у пшенищ контролюеться щонайменше п'-ять-ма генами, з яких три основнД гени Vrn-A1, Vrn-B1 i Vrn-D1 локалзоват вДдповДдно у хромосомах 5 А, 5 В i 5D. Озимий тип розвитку рослин проявляеться тшьки в тому випадку, якщо ц три основт гени рецесивт. При цьому присуттсть тшьки одного домшантного гена Vrn-A1 забезпечуе повну нечутливiсть рослин до яровизаци, домшантт гени Vrn-B1 i Vrn-D1 лише частково знижу-ють потребу в нш (Golovina et al., 2010- Shheiban'- and Salina, 2013). Гени VRN активно дослвджуються на моле-кулярно-генетичному р! вт (Li et al., 2011- Oliver et al., 2013), вони клоноват (Yan, 2003) i в останн роки для пшенищ описано декшька! х алельних варiантiв (Bespalova, 2010- Muterko, 2015- Stepanenko, 2012). Гени Vrn-A1a i Vrn-B1a — транскрипцiйнi фактори (Chu et al., 2011- Trevaskis, 2003). Ген Vrn-A1 кодуе MADS-box транкрипцшний фактор, локус Vrn-B1 мстить два тан-демно дуплiкованi гени, що пригтчують фактор цвтння ZCCT, а Vrn-D1 кодуе бшок, под1бний до шпбгтор1 В Raf-к1наз (Stepanenko, 2012).
На р1вш цшсного рослинного органiзму досить детально дослiдженi вагомi аспекти функцiонування сис-теми гешв VRN. Оск1льки кожна рослинна кл1тина мютить повну спадкову iнформацiю (повний «геном»), то лопчно вважати, що за умов порушення цшсносп рослинного оргашзму, зокрема, у системi in vitro, збертатимуться тД самi ефекти гешв VRN, що у системi
in vivo. Однак це питання не досл! джене, хоча його виршення вагоме для поглиблення юнуючих уявлень про функщонування рослинного оргашзму як системи.
Калусоутворення — процес дедиференцаци та активно! прохпфераци та росту дедиференцшованих клтин. Ц процеси у систем! in vitro супроводжуються суттевими перебудовами структурно-функц1оналъниих особливо-стей клтгин, що показано у низц дослщжень: йстолопч-них, бюх! мчних, цитох! мчних, цитоморфолопчних тощо (Kunah, 2005). Також у культур! in vitro спостерггаеться високий р! вень геномно! м! нливост! — одще! з характер-них рис калусно! культури (Kunah, 1998). Геномна неста-б!льн!сть у популяцй'- калусних дедиференцшованих клттин виникае за до р! зноман!гаих внутр1шн! х i зовнш-нх факторов. Геномнi порушення можуть спостерiгатися на ргвт хромосом (полiплоiдiя, анеуплощя, рiзнi аномалй'- мiтозу тощо) та на рiвнi ДНК, що пов'-язують 3i змiнами рiвня метилування нуклешових кислот, як у первинному калусi (primery callus), так i у пересадковш калуснiй куль-турi (Stelpflug et al., 2014- Temel and Gozukirmizi, 2013).
Отже, в кулътурi in vitro вщбуваються певнi порушення у функщонувант генетичного апарату рослинно! кл!-тини. Разом i3 тим, культура in vitro широко використо-вуеться як модель для вивчення рiзних аспекпв морфоге-нетичних процеав у рослин. У зв'-язку iз цим постае питання адекватносп ще! моделi тим процесам, якi в! дбу-ваються у системi цшсно! рослини, тобто in vivo. Це стасуется, зокрема, функцiонування системи гешв VRN -головно! для регуляци темпiв розвитку (швидкосп мор-фогенетичних процесгв) пшеницi м'-яко! in vivo.
Вивчення молекулярно-генетичних механiзмiв функ-щонування VRN генiв проводили переважно на моделях сорпв або замщених лшш пшеницi яро!, котр! несуть один! з ген! в VRN у дом! нантному або рецесивному стан! (Zhmurko, 2010- Lihenko, 2014). Однак для глибшого розум! ння законом! рностей прояву ефект! в гешв важливе вивчення! х ус! х алельних вар! ант!в, сум! щених в одному генотип! (генофон) як ц! л!сн!й систем! генетичного контролю розвитку пшениц! м'-яко! Для ще! мети адекватни-ми моделями можуть слугувати моногенно домшантт майже! зогенн! лши (NILs), як! несуть у певному поеднанн! (дом!нантне або рецесивне) вс! три головт гени VRN. Отже, мета ще! статт — з'-ясувати ефекти гешв VRN на калусогенез i виявлення можливих зм! н !х алельних вар! ант!в у систем! in vitro у майже! зогенних за цими генами лшш двох сорт! в пшениц! м'-яко!
Матерш i методи дослщжень
Рослинний матeрiал. У досладженн використано май-же 1зогент моногеннодом1нантн1 лши (NILs) ярого типу розвитку, створен в генофонах озимих сортв Миронв-ська 808 i Ольв1я. Лши розр1зняються за станом (домъ нантний або рецесивний) алелiв уах трьох гетв VRN. Колекця 1зогенних за генами VRN лшш створена нау-ковцями Селекцшно-генетичного шстигуту НААН Укра-!ни та щдтримуеться на кафедр1 фшологи та бюхши рос-лин i м! крооргзн1зм!б (ФБР1М) Харк1вського нацюналь-ного уЩБерситету iменi В. Н. Каразша протягом 10 роив. Пвд час проведення ПЛР аналзу адельного стану генiБ системи VRN як контрольн зразки використовували шкть 1зогенних лшш пшениц Paha NIL i виидний сорт Paha? з ввдомими аделями (генами), що мають шдифь кадшн номери у National Society of Genetic Counselors, NSGC (www. nsgc. org).
Отримання калусноТ культури. Первинн калусн (primery callus) культури 1зогенних лшш отримувади, використовуючи як експлант зрш зародки. Насшня урожаю 2010−2012 рошв, отримане в умовах вирощу-вання на експериментальнш дшянщ кафедри ФБР1М ХНУ 1мен1 В. Н. Каразша, стеришзували за розробленим протоколом (Avksent'-eva and Petrenko, 2009), витриму-вали у термостап протягом доби. В умовах стерильносп ввдокремлювади зрш зародки ввд ендосперму та культи-вували 1зольоваш зародки в термостап за температури 26 °C протягом 3−4 тижшв на живидьному середовищ1 Мураше та Скуга (МС) ?з повним набором макро- та м1кросолей та додаванням стимулятора росту 2,4-Д у концентраци 2 мг/л для шдукцп первинного калусогенезу. Частоту калусогенезу розраховували як вщношення кшь-
kocti первинних калусш до загально! кшькосп експлан-tib у ввдсотках. Проводили морфолопчну оц1нку утворе-них первинних калусш. Пересадкову культуру одержу-вали шляхом пасивування первинних калусiв на середо-вище того самого складу (МС + 2 мг/л 2,4-Д), культи-вували у термостатi у темрявi за 26 °C i використовували для ПЛР-аналiзу алельного стану генш VRN.
ПЛР-анал1з алельного стану локус1 В ген1 В VRN. Молекулярно-бiологiчнi дослвдження проводили на зерншках i калуснш культурi тругого-третього пасажу. ДНК видшяли з п'-яти зерншок i3 використанням набору реактивiв Diatom Prep 100 (1зоген, Рос1я) за методикою виробника (метод сорбцц). ДНК iз калусно! тканини вид1ляли з використанням СТАВ-буферу за стандартною методикою (DNA Extraction, 2003). Для вивчення алельного стану гетв використовували алельспецифiчm прай-мери в1дпов1дно до даних Grain Gene Mass Wheat (http: //maswheat. ucdavis. edu) (табл. 1). ПЛР проводили у багатоканальному амшпфжатои «Терцикл» (ДНК-технологи, Роая) за стандартними умовами для амптфжацп специфiчних праймерiв (табл. 2). Розподл продукт1 В ПЛР здшснювали шляхом електрофорезу протягом 90−120 хви-лин у 1,5% агарозному гелi з додаванням бромистого етидю (10 мг/мл). Спектри фрагмент1 В ДНК реестрували в ультрафюлел (312 нм) за допомогою фотокамери Nikon.
Статистична обробка результат1 В. Проведено три бюлопчт серй'- досл1д1 В з анатзу ефективносп процесу калусогенезу за культивування по три чашки Петрi на кожну iзолiнiю з 5−10 експлантами у чашщ. Результати оброблено методом однофакторного дисперсiйного анат-зу (Atramentova and Utevs'-ka, 2007). Результати ПЛР аналзу обробляли iз застосуванням програми TotalLab (TL120. v2009).
Таблиця 1
Праймери для 1дентификац1Т р1зних алел1 В ген1 В у гексамлоУДноТ мшениц1 (Grain Gene Mass Wheat)
Локус Алель Праймер Послiдовнiсть Розмр продукту, пар нуклеотидiв
VRN- A1 Vrn-A1a VRN AF VRN-INT1R GAAAGGAAAAATTCTGCTCG GCAGGAAATCGAAATCGAAG 965+876
Vrn-A1b 714
Vrn-A1c 734
vrn-A1 734
Vrn-A1a VRN AF VRN1R GAA AGGAAAAATTCTGCTCG TGCACCTTCCCCCGCCCCAT 750+650
Vrn-A1b 480
vrn-A1 500
Vrn-A1c 500
VRN- A1 Vrn-A1c Intr1/A/F2 Intr1/A/R3 AGCCTCCACGGTTTGAAAGTAA AAGTAAGACAACACGAATGTGAGA 1170
VRN- A1 vrn-A1 Intr1/ C/F Intr1/AB/R GCACTCCTAACCCACTAACC TCATCCATCATCAAGGCAAA 1068
VRN- B1 Vrn-B1 Intr1/B/F Intr /B/R3 CAAGTGGAACGGTTAGGACA CTCATGCCAAAAATTGAAGATGA 709
VRN- B1 vrn-B1 Intr1/B/F Intr /B/R4 CAAGTGGAACGGTTAGGACA CAAATGAAAAGGAATGAGAGCA 1149
VRN- D1 Vrn-D1 Intr1/D/F Intr1/D /R3 GTTGTCTGCCTCATCAAATCC GGTCACTGGTGGTCTGTGC 1671
VRN- D1 vrn-D1 Intr1/D/F Intr1/D/ R4 GTTGTCTGCCTCATCAAATCC AAATGAAAAGGAACGAGAGCG 997
Результати та Тх обговорення
Калусогенез NILs. Дослвджено вплив генотипу на ефективнiсть процесу калусоутворення та морфологiчну характеристику iзогенних за генами контролю типу роз-
витку лшш пшеницi (6 iзолiнiй та вихiднi сорти Миронiвська 808, Ольв^я — носй'- рецесивних генш генетично! системи VRN). Результати дослвджень показали, що всi генотипи формували первинний калус, але цей процес вiдбувався з рiзною частотою — 61−93% (табл. 3). Також дослвджуват iзолiнii розрiзняли за
швидкстю формування первинного калусу. Каллусоге-нез почався на 7−10-ту добу у вах 1зслшш Vrn 1, Vrn 2, Vrn 3 обох сорпв, в експланпв i3 зародив сорпв цей процес проходив повiльнiше — на 14−17-ту добу культи-вування. Незважаючи на те, що зрш зародки майже не
використовують як експлант за культивування м яко! пшеницi in vitro (Bavol, 2008), у наших попередтх (Avksent'-eva and Petrenko, 2009) та одержаних у цш роботi даних зрiлi зародки виявилися ефективними екс-плантами для отримання первинного калусу.
Умови проведення ПЛР з алельсмециф1чмими праймерами
Таблиця2
Праймери Умови ПЛР
Початкова денатурация, t° (хв) Кшьюстъ циклш Денатурация, t° © В! джиг, t° © Елонгагця, t° © Фшальна елонгагця, t° (хв)
VRN AF // VRN-INT1R 94 (10) 38 94 (45) 55 (45) 72 (60) 72 (5)
VRN AF // VRN1R 94 (7) 40 95(30) 60 (30) 72 (60) 72 (10)
Intr1/C/F // Intr1/AB/R 94 (7) 38 94 (30) 57 (30) 72 (45) 72 (7)
Intr1/A/F2 // Intr1/A/R3 94 (7) 38 94 (30) 60 (30) 72 (45) 72 (7)
Intr1/B/F // Intr/B/R3 // Intr/B/R4 94 (10) 44 (Touch-down) 94 (45) 58−63 (45) 72 (69) 72 (10)
Intr1/D/F // Intr/D/R3 // Intr/D/R4 94 (10) 44 (Touch-down) 94 (45) 63−65 (45) 72 (90) 72 (10)
Таблиця3
Частота 1ндукци первинного калусогенезу (%) i3oreMMnx за генами VRN. мнш м'-якоТ iiiiiciiiiiii
Сорт 1золшш Частота калусогенезу, % Морфолог! чна характеристика
Vrn 1 74,3 ± 3,0
Мирошвська Vrn 2 93,2 ± 4,2 Компактний,
808 Vrn 3 66,6 ± 2,1 гетерогенний,
сорт 84,4 ± 3,7 малооводнений,
НГР (), 05 3,8 прозорий,
Vrn 1 70,5 ± 3,1 аморфний,
Ольвш Vrn 2 90,0 ± 4,0 жовтого в1дпнку,
Vrn 3 61,5 ± 1,9 з елементами
сорт 80,5 ± 2,7 диференц! ювання
ИР0,05 4,2
Р! зниця м! ж показниками ефективностi калусогенезу в iзолiнiй сорпв Ольвiя та Миротвська 808 була несутгевою, але в цiлому iзолiнii сорту Ольвiя характе-
ризувалися дещо нижчими показниками частота калусогенезу пор1вняно з лЫями сорту Миротвська 808. Та-кож не спостернали вщмшност! за морфолопчною характеристикою калусних тканин (табл. 3). Максимальною частотою калусогенезу в обох сорпв гексапло! дно! пшениц характеризувалися! золш1я Угп 2 1 вихвдний сорт, а мЫмальною — шлшц Угп 1 1 Угп 3. Пор1внюючи? золшц, у цшому, можна констатувати, що вони мають великий потенщал калусоутворення та ран-жуються за його! нтенсивтстю, незалежно ввд генотипу сорту: Угп 2 & gt- сорт & gt- Угп 1 & gt- Угп 3. За морфолопчними ознаками отримат калуси (рис. 1а, б- табл. 3) з1 зрших зародов, в основному, були малооводнеш, аморфш, компактт, прозор1, мали жовтуватий вщтшок. У калусах уах дослвджуваних! золшш часто виявляли зони меристематично! активност! та шод! спостерналн спон-танний ризогенез. Вщмшностей за морфолопею калусних тканин м! ж !зогенними лшями двох сорпв Ольви та Миротвсько! 808 не спостерналн.
Рис. 1. Калусогенез iзoгеммoT Vrn 1 лiмil м'-якоТ пшениц Triticum aestivum L. сорт Мироншська 808: а — щшьний, аморфний, прозорий первинний калус (primery callus) — б — загальний вигляд первинних калусiв у чашщ Петрi
Одержанi нами рашше дан (Zhmurko et al., 2013) по-казують, що рослини iзогенних лiнiй iз домшантним геном Vrn 2 в! др!зняються в1д рослин лiнiй Vrn 1 та Vrn 3 тривалшою вегетативною фазою та, у результат! цього, формуванням бшьшо! вегетативно! маси (!нтенсивнiшими ростовими процесами), але пов! льн!шими темпами роз-витку. У культур! in vitro л! н!я Vrn 2 характеризуеться
6! льшою iнтенсивнiстю калусогенезу, н! ж лши Vrn 1 та Vrn 3. Що стосуеться рослин обох сорт! в — Миротвська 808 та Ольв! я, у яких ус! гени vrn рецесивн!, то для них без яровизаци характерний т! льки вегетативний морфогенез, тобто т! льки р! ст без переходу до генеративно! фази онтогенезу (Achrem et al., 2012- Kim and Sung, 2014). У культур! in vitro у сорт! в спостер! гали калусогенез
високо! штенсивносп, як i у лши Vrn 2, яка повшьно розвиваеться in vivo. Одержат результати свщчать про односпрямоватсть функцiонування генiв VRN у культу-pi in vitro та у систем цшсно! рослини. Це дае щдставу припустити участь генетично! системи VRN у детермь наци калусогенезу, а також адекватнiсть И функцюну-вання у системi in vitro процесам, як1 вона детермшуе у системi цшсно! рослини.
ПЛР-ан^з нас1ння та пересадковоТ калусноТ культури. Молекулярний анал1з генiв Vrn-A1, Vrn-B1, Vnr-D1 проводили in vivo у зертвках 8 генотипiв — май-же iзогенних лiнiй NILs i вихдних сорив Миpонiвська 808 та Ольв1я. Алел1 локусу VRN-A1 вивчали з викори-станням VRNAF//VRN-INT1R пpаймеpiв. Очжуваний
po3MIp амплiфiкованих фрагментiв I3 використанням цих праймер1 В для найпоширетшого домiнантного алеля Vrn-A1a становить 965 i 876 пар нуклеотида, для реце-сивного алеля vrn-A1 — 734 пари нуклеотид1 В (рис. 2а). Серед проаналiзованих генотишв рецесивний алель vrn-A1 виявлений у сорив Миротвська 808 i Ольвiя та iзолiнiй Vrn 2 (рис. 2а). Решта iзолiнiй (Vrn 1 i Vrn 3) обох сорив несуть тшьки домiнантний алель Vrn-A1a.
За лггературними ведомостями, найпоширенший до-мшантний алель VRN-A1 характеризуемся вставками повторюваних послвдовностей у дшянщ промотора (Fu, 2005), у результатi чого продукт ПЛР представлено двома фрагментами 965 та 876 пар нуклетида. У наших дослъ дах виявлено тшьки продукт 965 пар нуклеотидав (рис. 2а).
1 2 3 4 5 6 965 и и 734 лн 7 8 12 3 4 5 6 7 8 11+9 пи M ^ iqg tvm * V V Щ 709 пн 12 3 4 5 997 пн tl^ M И 6 7 8 M tM"
VRN-Al M VRM-RI 1 б 1 VRN-D1 1 в 1

Рис. 2. Виявлення aлелiв генш VRN in vivo з використанням комбшацй'- мраймерш:
а — для гена Vrn-A1 — VRN AF//VRN-INT1R, б — для гена Vrn-B1 — Intr1/B/F//Intr1/B/R3//Intr/B/R4, в — для гена Vrn-D1 — Intr1/D/F//Intr/D/R3//Intr1/D/R4- сорт Миронiвська 808 (1−4): 1 — вихщний сорт, 2 — Vrn-1, 3 — Vrn-2, 4 — Vrn-3- сорт Ольвiя (5−8): 5 — Vrn-1, 6 — Vrn-2, 7 — Vrn-3, 8 — вихщний сорт
Аналiз локусу VRN-B1 (рис. 2б) показав наявнють домшантних алел1 В Vrn-B1 (709 пар нуклеотидав) у iзолiнiй Vrn 2 сорив Миронiвська 808 i Ольвiя, виявле-них щд час використання двох пар праймерiв (Touchdown PCR, дуплекс) Intr1/B/F Intr/B/R3 i Intr1/B/F Intr/B/R4. У решти дослвджених генотишв виявлено рецесивний алель vrn-B 1 i3 використанням праймерiв Intr1/B/F i Intr/B/R4 та довжиною амщпфшованого фрагмента 1149 пар нуклеотидiв ввдповщно (рис. 2б).
Алельний аналiз локусу Vrn-D1 показав присутнiсть тшьки рецесивного алеля vrn-D1 (997 пар нуклеотида) щд час використання праймерiв Intr1/D/F i Intr /D/R4 в уах дослвджуваних генотип1 В обох сорив (рис. 2в). У працях багатьох дослщниюв показано, що у ярих сорив пшеницi, як1 зростають у? врош, практично ввдсутнш алель Vrn-D1 (Bespalova, 2010- Lihenko, 2014- Potokina,
2012). Дослвджет 1зогент лши створет в генотип ози-мих сорив, але являють собою форми з ярим типом роз-витку. Наш1 дослвдження також тдтверджують виявле-ну законом1ртсть — вшсуттсть домшантного алеля Угп-Б1 в 1золшш м'-яко! пшениц з ярим типом розвитку.
Оскшьки ген Угп-А1 — основний у детермшаци потреби або нечутливосп до яровизаци (Ьоико1апоу, 2005- ТгеуаБЫБ, 2010), то для дослвдження його алельного стану використовують значну к1льк1сть праймер1 В (табл. 1). Кр1м того, використання агарозного гелю не дозволяе розр1зняти фрагменти 734 Угп-А1с 1 734 угп-А1. У по-дальших дослвдженнях ми використовували праймери Шг1/А/Р2 1 1п1г1/А/Я3, а також Шг1/С/Р 1 Шг1/АВ/Я (рис. 3). У хода проведених анал1з1 В виявили рецесивний алель угп-А1 у генотипах сорив Мирошвська 808 1 Ольв1я та 1золшш Угп 2 обох сорив (рис. 36).
1 2 3 4 5 6 7 8 M 1 2 3 4 5 6 7 8
lefiSnii
VRN-Al с праймерами Intrl/A/FZ и Intrl/A/R3 VRN-Al
И с праимерами. Intrl/C/F ii Intrl/AB/R 1 б |

Рис. 3. Виявлення алелш гена Vrn-A1c (а) и vrn-A1 (б) in vivo за допомогою смециф1чми мраймср1 В Intr1/C/F i Intr1/AB/R та Intr1/A/F2 i Intr1/A/R3 вмповммо: Миpонiвська 808: 1 — вихщний озимий сорт, 2 — Vrn-1, 3 — Vrn-2, 4 — Vrn-3- Ольв1я: 5 — Vrn-1, 6 — Vrn-2, 7 — Vrn-3, 8 — вихвдний сорт
Дослвдження алельного стану гешв системи Vrn в умовах in vitro проводили на пересадковш калуснш культур! У генотип! золшш Vrn 1 i Vrn 3, як! швидко розвиваються, виявлено наявтсть домшантних алел! в гена Vrn-A1a за допомогою праймер! в VRNAF//VRN-INTIR i3 продуктом ампл! ф!кацй'- 965 пар нуклеотидав (рис. 4а). Також показано присуттсть рецесивних алел! в vrn-B1 i vrn-D1 п! д час використання праймер! в
Intr/B/F//Intr/B/R4 (1149 пар нуклеотидш) i Intr1/D/F//Intr1/D/R4 (997 пар нуклеотидав) (рис. 46, в). В! золшш, як1 розвиваються повшьними темпами (Vrn 2), у генотит присутнш домшантний алель Vrn-B 1 (рис. 46), виявлений парою праймерiв Intr1/B/F i Intr/B/R3 (1 170 пар нуклеотидав) i рецесивний алель vrn-A1, шдетифкований парою праймерiв Intr1/CF i Intr1/ABR (1 068 пар нуклеотидав) (рис. 4а).
M 1 2 3
4
7 8 M 1 2 34'-5& quot- 6 7 8М1 23 4 -5- Чг 1
i и" и. «
Н? Й
ggg f^J Ц| ттт
НШ ПЛ.
M
— -
Ш '-
^^В m
Vrn-A 1 (Vrn IA F + i n I-I ut IR) 1−1
6
VrnBl с IntrlBF+intrlBR3/IntrlBR4
VrnDl? IntrlDF+IntrlDR3/IntrlDR4
Рис. 4. Виявлення aлелiв ген1 В Vrn-A1 (a), Vrn-B1 (б) i Vrn-D1 (в) у пересадковш калуснш культурi i3oreHnx. liniii iiiiiciiiiiii за допомогою специф1чми праймер1в:
Миронiвська 808 1 — Vrn 1, 2 — Vrn 2, 3 — Vrn 3, 4 — вихщний сорт- Ольв^я: 1 — Vrn 1, 2 — Vrn 2, 3 — Vrn 3, 4 — вихдаий сорт
Зютавлення результат, отриманих у досл! дженнях у культур! in vitro i in vivo, показало, що алельний стан гешв VRN насшня та калусно! культури майже! ден-тичний (табл. 4). Зм! ни спостерггалися тшьки в калуснш культур! 1золшп Vrn 3 сорту Миротвська 808, а саме алельного стану Vrn-B 1. Ймов! рно, пвд час отримання
культури клтгин, а також щдукци калусоутворення у даному випадку в1дбувались геномн1 змши (перебудо-ви). Можливо, що шляхом добору гетерозиготний стан локусу Vrn-B 1 в умовах in vivo у популяци пролъ ферувальних калусних клпин зм1нився на стаб1льн1ший гомозиготний стан.
Алельнi liapiai м и гешв VRN в умовах in vivo та in vitro
Таблиця 4
в
Сорт / !золшш Генотип
Насшня Калусна культура
Мироншська 808 vrn-A1 vrn-B1 vrn-D1 vrn-A1 vrn-B1 vrn-D1
М 808 Vrn1 VRN-A1a vrn-B1 vrn-D1 VRN-A1a vrn-B1 vrn-D1
М 808 Vrn2 vrn-A1 VRN-B1 vrn-D1 vrn-A1 VRN-B1 vrn-D1
М 808 Vrn3 VRN-A1a VRN-B1/vrn-B1 vrn-D1 VRN-A1a vrn-B1 vrn-D1
Ольв1я vrn-A1 vrn-B1 vrn-D1 vrn-A1 vrn-B1 vrn-D1
Ольв1я Vrn1 VRN-A1a vrn-B1 vrn-D1 VRN-A1a vrn-B1 vrn-D1
Ольв1я Vrn2 vrn-A1 VRN-B1 vrn-D1 vrn-A1 VRN-B1 vrn-D1
Ольв1я Vrn3 VRN-A1a vrn-B1 vrn-D1 VRN-A1a vrn-B1 vrn-D1
Оскшьки для пересадково! калусно!'- культури харак-терне явище спонтанно! сомаклонально! мюливосп (Kunah, 1998) для певних роб! т i3 фггобютехнологи необхвдне п! дтвердження збереження вих1дного генотипу рослини-донора у ходi культивування in vitro. У ходi проведених дослвджень, головним чином, було пвдтверджено збереження генотипу вихвдних iзолiнiй пвд час культивування в умовах in vitro. У пересадкових калусних культурах дослвджуваних iзолiнiй не ввдбувалося спонтанно! сомаклонально! мшливосп, за винятком iзолiнi! Vrn 3 сорту Миронiвська 808.
Висновки
У культурi in vitro м! ж ус! ма iзолiнiями обох сорпв рiзниця за морфолопчними показниками калуав не проявлялась. Максимальна частота калусогенезу виявлена у
лши Vrn 2 та вих1дних сорт1 В, а мшшальна — у л1н1й Vrn 1 та Vrn 3. Це дае тдставу вважати, що система гешв Vrn контролюе морфогенез не тшьки у рослин м'-яко! пшениц in vivo, а i, у випадку порушення ц1л1сно! рослини, за калусогенезу в систем! in vitro.
У зерншках in vivo та культур! in vitro iзогенних лшш алельний стан генш VRN майже вдентичний. Т1льки в калуснiй культур! 1золшп Vrn 3 сорту Миротвська 808 виявлено змшу алельного стану гешв Vrn В1, що може бути пов'-язано з геномними перебудовами п! д час щдукци калусогенезу.
Таким чином, наш! дослвдження пвдтверджують, що клпини калусних тканин вищих рослин, поряд! з набут-тям нових специф! чних властивостей, здатн! збер! гати властивосп кл! тин ц1л1сного орган! зму, а культура in vitro — адекватна система для дослвдження властивостей рослинного оргашзму.
Подяки
Автори вдячнi д-ру бiол. наук В.1. Файту — завщувачу вщдшу генетики, та академжу НАНУ д-ру бюл. наук А. М. Стельмаху — головному науковому спiвробiтнику вiддiлу генетики Селекцшно-генетичного 1нстигуту -Нац1онального центру насшнезнавства та сортовивчення НААН Украши за наданi для дослвдження iзогеннi за генами VRN лши пшенищ.
Автори також висловлюють подяку ТОВ «Агроген» (м. Харкав) за допомогу у проведеннi молекулярно-генетичних дослвджень.
Робота виконана в рамках держбюджетно! теми «Дослвдження фiзiолого-бiохiмiчних i молекулярно-бiологiчних механiзмiв генетичного контролю розвитку та продукцшного процесу сшьськогосподарських культур» (№ 0112U000101).
Бiблiографiчнi посилання
Achrem, M., Skuza, L., Kalinka, A., Szucko, I., Filip, E., Slomin-ska-Walkowiak, R., Rogalska, S., 2012. Role of epigenetic mechanisms in plant response to low temperature. Acta Biol. Cracov. Bot. 54(1), 7−15. Atramentova, L.O., Utevs'-ka, O.M. (ed.), 2007. Statystychni me-tody v biologii'- [Statistical methods in biology]. HNU imeni V.N. Karazina, Harkiv (in Ukrainian). Avksent'-eva, O.A., Petrenko, V.A., 2009. Rol'- genotipa, sostava sredy i tipa jeksplanta v formirovanii pervichnogo kallusa izogennyh linij pshenicy [Role of the genotype, composition of medium and type of explant in formation of the first callus of wheat isogenic lines]. The Journal of V.N. Karazin Kharkiv National University. Series Biology 771(9), 157−166 (in Russian). Bavol, A. V., Dubrovnaja, O.V., Ljal'-ko, I.I., 2008. Regeneracija rastenij iz razlichnyh tipov jeksplantov mjagkoj pshenicy [The regeneration of plants from different types of wheat explants]. Physiology and Biochemistry of Cultivated Plants 40(2), 150 156 (in Russian).
Bespalova, L.A., Koshkin, V.A., Potokina, E.K., Filibok, V.A., Matvienko, I.I., Mitrofanova, O.P., Guenkova, E.A., 2011. Pho-toperiod sensitivity and molecular marking of genes Ppd and Vrn in connection with breeding alternative-habit wheat varieties. Russian Agricultural Sciences 36(6), 389−392. Chu, C. -G., Tan, C.T., Yu, G. -T., Zhong, S., Xu, S.S., Yan, L., 2011. A novel retrotransposon inserted in the dominant Vrn-B1 allele confers spring growth habit in tetraploid wheat (Triticum turgidum L.). G3. Genes, Genomes and Genetics 1(7), 637−645. Cockram, J., Jones, H., Leigh, F., O'-Sullivan, D., Powell, W., Laurie, D., Greenland, A., 2007. Control of flowering time in temperate cereals: Genes, domestication and sustainable productivity. J. Exp. Bot. 58(6), 1231−1244. Distelfeld, A., Tranquilli, G., Li, C., Yan, L., Dubcovsky, J., 2009. Genetic and molecular characterization of the VRN2 loci in te-traploid wheat. Plant Physiol. 149(1), 245−257. DNA extraction for PCR. Plant transformation facility, 2003. DNA Extraction from maize callus, maize leaf tissue, or soybean leaf tissue for PCR. Retrieved from www. agron. iastate. edu/ptf/ service/Callus%20DNA%20extraction. pdf Dubcovsky, J., Loukoianov, A., Fu, D., Valarik, M., Sanchez, A., Yan, L., 2006. Effect of photoperiod on the regulation of wheat vernalization genes VRN1 and VRN2. Plant Mol. Biol. 60(4), 469−480.
Emtseva, M.V., Efremova, T.T., Arbuzova, V.S., 2012. Heading time of substitution and near-isogenic lines of common wheat with dominant alleles Vrn-B1a and Vrn-B1c. Russian Journal of Genetics: Applied Research 2(4), 304−310.
Fu, D., Szucs, P., Yan, L., Helguera, M., Skinner, J., Zitzewitz, J., Hayes, P., Dubcovsky, J., 2005. Large deletions within the first intron in VRN-1 are associated with spring growth habit in barley and wheat. Mol. Genet. Genomics 273(1), 54−65.
Golovnina, K.A., Kondratenko, E.Y., Blinov, A.G., Goncharov, N.P., 2010. Molecular characterization of vernalization loci VRN1 in wild and cultivated wheats. BMC Plant Biol. 10(1), 168.
Khotyljova, L., Kaminskaya, L., Koren, L., 2002. Influence of genetic systems of Vrn and Ppd genes on the ecological adaptation of wheat and Triticale. Biologija 4, 45−48.
Kim, D. -H., Sung, S., 2014. Genetic and epigenetic mechanisms underlying vernalization. The Arabidopsis Book 12, e0171.
Kumar, S., Sharma, V., Chaudhary, S., Tyagi, A., Mishra, P., Pri-yadarshini, A., Singh, A., 2012. Genetics of flowering time in bread wheat Triticum aestivum: complementary interaction between vernalization-insensitive and photoperiod-insensitive mutations imparts very early flowering habit to spring wheat. J. Genet. 91(1), 33−47.
Kunakh, V.A., 1998. Genomnaja izmenchivost'- somaticheskih kletok rastenij. Izmenchivost'- v processe dedifferencirovki i kallusoo-brazovanija in vitro [Genome variability in plant somatic cells. 4. Variability in the process of dedifferentiation and callus formation in vitro]. Biopolym. Cell. 14(4), 298−319 (in Russian).
Kunakh, V.A., 2005. Biotehnologija likars'-kyh roslyn. Genetychni ta fiziologo-biohimichni osnovy [Biotechnology of medicinal plants. Genetic and physiological and biochemical basis]. Logos, Kyiv (in Ukrainian).
Li, C., Distelfeld, A., Comis, A., Dubcovsky, J., 2011. Wheat flowering repressor VRN2 and promoter CO2 compete for interactions with NUCLEAR FACTOR-Y complexes. Plant J. 67(5), 763−773.
Lihenko, I.E., Stasjuk, A.I., Shherban'-, A.B., Zyrjanova, A. F, Li-henko, N.I., Salina, E.A., 2014. Izuchenie allel'-nogo sostava genov Vrn-1 i Ppd-1 u rannespelyh i srednerannih sortov jaro-voj mjagkoj pshenicy Cibiri [Analysis of the allelic variation of the Vrn-1 and Ppd-1 genes in Siberian early and medium early varieties of spring wheat]. Vavilovskij Zhurnal Genetiki i Se-lekcii 18, 691−703 (in Russian).
Loukoianov, A., Yan, L., Blechl, A., Sanchez, A., Dubcovsky, J., 2005. Regulation of VRN-1 vernalization genes in normal and transgenic polyploid wheat. Plant Physiol. 138(4), 2364−2373.
Muterko, O.F., Balashova, I.A., Fayt, V.I., Syvolap, J.M., 2015. Molecular-genetic mechanisms of regulation of growth habit in wheat. Cytology and Genetics 49(1), 58−71.
Oliver, S.N., Deng, W., Casao, M.C., Trevaskis, B., 2013. Low temperatures induce rapid changes in chromatin state and transcript levels of the cereal VERNALIZATION1 gene. J. Exp. Bot. 64(8), 2413−2422.
Potokina, E.K., Koshkin, V.A., Alekseeva, E.A., Matvienko, I.I., Filobok, V.A., Bespalova, L.A., 2012. The combination of the Ppd and Vrn gene alleles determines the heading date in common wheat varieties. Russian Journal of Genetics: Applied Research 2(4), 311−318.
Shherban'-, A.B., Salina, E.A., 2013. Jepigeneticheskaja reguljacija jekspressii genov jarovizacii [Epigenetic regulation of expression of vernalization genes]. Tcitologija 55(4), 234−237(in Russian).
Stelmakh, A., 1998. Genetic systems regulating flowering response in wheat. Euphytica 100(1), 359−369.
Stelpflug, S.C., Eichten, S. R., Hermanson, P. J., Springer N. M, Kaeppler, S.M., 2014. Consistent and heritable alterations of DNA methylation are induced by tissue culture in maize. Genetics 198(1), 209−218.
Stepanenko, I.L., Smirnova, O.G., Titov, I.I., 2012. A model of the gene network for flowering time regulation in winter wheat and barley. Russian Journal of Genetics: Applied Research 2(4), 319−324.
Temel, A., Gozukirmizi, N., 2013. Analysis of retrotransposition and DNA methylation in barley callus culture. Acta Biol. Hung. 64(1), 86−95.
Trevaskis, B., 2010. The central role of the VERNALIZATION 1 gene in the vernalization response of cereals. Fund Plant Biol. 37, 479−487.
Trevaskis, B., Bagnall, D., Ellis, M., Peacock, W., Dennis, E., 2003. MADS-box genes control vernalization-induced flowering in cereals. PNAS 100(22), 13 099−13 104. Yan, L., Loukoianov, A., Tranquilli, G., Helguera, M., Fahima, T., Dubcovsky, J., 2003. Positional cloning of the wheat vernalization gene VRN1. PNAS 100(10), 6263−6268.
Zhmurko, V., Avksentyeva, O., Bing, H., 2013. Influence of photo-periodic conditions on the development and content of nitrogenous compounds in the VRN NILs wheat Triticum aestivum L. Biologija 59(2), 231−240.
Zhmurko, V.V., 2010. Osobennosti projavlenija effektov genov PPD na tempy razvitija sortov i gibridov ozimoj pshenicy [Showing features of the PPD genes effects on the development pace of winter varieties and hybrids]. Faktory Jeksperimen-tal'-noj Jevoljucii Organizmov 8, 38−42 (in Russian).
Hadiumna do редкonегii 19. 03. 2016

Показать Свернуть
Заполнить форму текущей работой