Импульсный двойной электрон-электронный резонанс в структурных исследованиях спин-меченых нуклеиновых кислот

Тип работы:
Реферат
Предмет:
Физика


Узнать стоимость

Детальная информация о работе

Выдержка из работы

ОБЗОРЫ
УДК 541. 67+577. 323
Импульсный двойной электрон-электронный резонанс в структурных исследованиях спин-меченых нуклеиновых кислот
О. С. Федорова1*, Ю. Д. Цветков2
'-Институт химической биологии и фундаментальной медицины СО РАН, 630 090,
Новосибирск, просп. Академика Лаврентьева, 8
2Институт химической кинетики и горения им. В. В. Воеводского СО РАН, 630 090, Новосибирск, ул. Институтская, 3 *E-mail: fedorova@niboch. nsc. ru Поступила в редакцию 06. 08. 2012
РЕФЕРАТ Обзор посвящен применению метода двойного электрон-электронного резонанса (PELDOR) для изучения структур спин-меченых ДНК и РНК, в том числе имеющих сложное пространственное строение: тетрамеров, аптамеров, рибопереключателей, трех- и четырехспиральных сочленений. Описаны результаты использования метода для изучения влияния поврежденных нуклеотидов на структуру ДНК. КЛЮЧЕВЫЕ СЛОВА двойной электрон-электронный резонанс (PELDOR), спиновые метки, ДНК, РНК, олигонуклеотиды.
ВВЕДЕНИЕ. ОСНОВЫ ТЕОРИИ МЕТОДА
Метод двойного электрон-электронного резонанса, PELDOR, или DEER (сокращение от Pulsed Electron Double Resonance или от Double Electron Electron Resonance, в дальнейшем используется первое сокращение), предложенный в Институте химической кинетики и горения СО РАН в 1981 году [1], в настоящее время является наиболее популярным ЭПР-методом, широко используемым в структурных исследованиях систем, содержащих парамагнитные центры.
Обзорные статьи, в которых излагается теория метода и приводятся примеры его приложений для структурных исследований, публикуются практически ежегодно. Отметим лишь работы последних пяти лет [2−8]. Несомненно, что благодаря разработке эффективных методов направленного введения спиновых меток наибольшие успехи достигнуты в исследовании биомакромолекул методом PELDOR. Многие из этих работ посвящены изучению ДНК и РНК в конкретных биохимических системах. Однако в обзорах [2−8] они рассматриваются лишь фрагментарно, только наряду с другими примерами приложений PELDOR. Цель данного обзора — систематически изложить результаты приложений PELDOR для структурных исследований важного класса биомакромолекул — ДНК и РНК. В обзор вошли работы, выполненные преимущественно в период с 2003 по первую половину 2012 года.
Как правило, для исследований методом PELDOR в молекулы вводят две спиновые метки. Метками обычно служат нитроксильные радикалы. Дипольное и обменное магнитные взаимодействия между метками содержат информацию о расстояниях между метками, их взаимной ориентации, об образовании из них агрегатов и комплексов, о пространственном распределении спиновых меток в исследуемой системе. Важнейшей уникальной особенностью метода является возможность его приложений для хаотически ориентированных систем.
Мы приведем лишь наиболее существенные для анализа результатов PELDOR данные, относящиеся к теории метода. Детальное изложение теории метода можно найти в обзорах [2, 4, 9], а описание методических вопросов и спектрометров PELDOR — в [10].
Магнитное диполь-дипольное взаимодействие спиновых меток, А и В определяется дипольной частотой [4, 9, 11]:
D 2
= 2жум =-(1 — 3с°8 в) +. (1)
г
Здесь О = 327 рад нм3/мкс — константа диполь-дипольного взаимодействия, г — расстояние между спинами, 9 — угол между направлением внешнего магнитного поля и вектором, соединяющим спины, J — обменный интеграл. Для определения диполь-ной частоты, а значит и расстояния между спинами,
Рис. 1. А — Импульсная последовательность 3рPELDOR. Под действием на спиновую систему двух импульсов на частоте уд возникает сигнал спинового эха. Эффект PELDOR регистрируется как спад сигнала эха У (Т) при действии на спиновую систему дополнительного импульса накачки на частоте ув, как функция временной раздвижки Т. Б — Положение импульсов регистрации и накачки, действующих на спины, А и В в спектре ЭПР
используется трехимпульсная последовательность PELDOR (3рPELDOR). На рис. 1А показана эта последовательность, состоящая из двух типов импульсов на частотах уд и ув. Импульсы я/2 и я на частоте VА, действующие на спины, А в спектре ЭПР (рис. 1Б), используются для образования сигнала спинового эха от них, по которому регистрируется эффект PELDOR. Интервал т между импульсами на частоте vA зафиксирован. В этом интервале расположен действующий на спины В п-импульс накачки на частоте vВ с задержкой Т, отсчитываемой от первого я/2-импульса. Импульс накачки меняет ориентацию спинов В, что приводит к изменению дипольного взаимодействия между спинами, А и В. Это изменение регистрируется как спад амплитуды сигнала спинового эха, У (Т), при изменении задержки Т в интервале 0 — т. Спад У (Т) модулирован на частоте vdd, что позволяет определить расстояние г между спинами. Модуляция в спаде сигнала PELDOR впервые обнаружена и исследована в работах [12, 13].
Используется также четырехимпульсная последовательность (4рPELDOR). В ней сигнал эха образуется под действием трех импульсов я/2, я, я на частоте уд, а его изменение возникает за счет я импульса, приложенного в интервале между вторым и третьим импульсами на уб.
Кинетика спада сигнала PELDOR для хаотически ориентированной пары спиновых меток с фиксиро-
ванным r в приближении достаточно коротких СВЧ импульсов описывается соотношением [4, 9]:
V (r, T) = 1 — pb{1 — f (r, T)}, (2)
где
f (r, T) =& lt- cos[(((1 -3cos2 в) + J))T] & gt-. (3)
Здесь pb — вероятность поворота одного спина в паре импульсом накачки, & lt-… >-9 означает усреднение по углу 9. Интегрирование (2), (3) дает спадающую функцию, модулированную затухающими осцилляциями на частоте wdd (рис. 2А, кривая 1). Фурье-анализ такого спада сигнала PELDOR дает так называемый пейковский дублет (рис. 2Б), что позволяет получить сведения о расстоянии r и об обменном интеграле J [4, 9], так как
vll = I 2vdd — J I и = I vdd + J I. (4)
При достаточно больших временах (Т^ю) функция V (r, T) стремится к предельному значению Vp (рис. 2А),
VP =(- Pb Г «1 — (-1), (5)
величина которого определяется числом дипольно взаимодействующих спинов N [4, 9], что позволяет определять число спин-меченых молекул в агрегатах и комплексах.
Максимальное расстояние, измеряемое методом PELDOR, определяется максимально длинным временем фазовой релаксации в исследуемой спиновой системе и обычно лежит в области ~ 8 нм. Минимальное расстояние зависит от длительности импульса накачки и в оптимальных условиях эксперимента составляет ~ 1.5 нм [4].
Расстояние в парах спиновых меток может быть по тем или иным причинам не фиксировано. В этом случае вводится функция распределения по расстояниям F® между метками (спектр расстояний), определяемая как F® = dn®/dr, где dn® есть доля пар спиновых меток в агрегате с расстоянием между метками в паре в диапазоне от r до r+dr. В случае непрерывного распределения по расстояниям, функция, описывающая спад сигнала PELDOR, может быть представлена как [14]:
Г2
V (T) = Vp + (1 — Vp) pb f F® f (r, T) dr. (6)
ri
Пределы интегрирования r1 и r2 в соотношении (6) ограничивают физически разумный диапазон рас-
V Т
dd
2л±
и
J = 0
¦ - - 1-
: (: 2л '-II
V (T)?NTЕR. Выше рассмотрено дипольное взаимодействие внутри пар или внутри определенных групп спиновых меток. Если эти взаимодействия считать независимыми, то полная функция, описывающая спад сигнала V (T), может быть представлена как [4, 9]:
^)= щт) ттКА ЩТ)
?
(7)
Рис. 2. А — Спад сигнала PELDOR У (Т), модулированный частотой Vdd + J (кривая 1). Предельное значение спада Ур (Т ^ ж). Экспоненциальный спад сигнала PELDOR для парамагнитных частиц, равномерно распределенных в объеме (кривая 2). Б — Фурье-преобразование модулированного спада (J = 0).
В — Функция распределения спиновых меток по расстояниям F® — г0 — расстояние в парах, А — ширина функции F® на полувысоте
стояний между спиновыми метками. Соотношение (6) является уравнением Фредгольма первого рода, решение которого неустойчиво в силу погрешностей экспериментальной величины V (T). Расчет F® сводится, по существу, к решению обратной задачи методами регуляризации Тихонова [15]. При этом необходимо иметь в виду, что сохраняются свойства неустойчивости решения. Методы расчета функции распределения по расстояниям в радикальных парах из экспериментальных данных PELDOR разработаны в [16−19], а для трех спиновых меток — в [20]. В работе [21] приведена программа расчета F® из кинетики спада V (T) сигнала PELDOR. Максимум функции F® соответствует расстоянию между спиновыми метками г0, а ее ширина, А — пространственному разбросу расстояний (рис. 2В). Отметим, что в соответствии с (5), (6) расчет F® позволяет независимо определять N — число спинов в группе.
В реальных системах, содержащих группы спинов, имеются два типа дипольных взаимодействий: между парамагнитными центрами внутри группы, V (T)?NTRА, и между парамагнитными центрами различных групп,
В большинстве случаев методом PELDOR изучают системы с равномерно распределенными в объеме спиновыми метками или группами меток. Для хаотически распределенных в трехмерном пространстве парамагнитных центров спад сигнала PELDOR описывается экспоненциальной функцией [4]
V? NTER (T) = ^0^-2^^] = V (0)exV[-аTA/3], (8)
где Дю½ = 8.2×10& quot-13С см3-с-1 — дипольная ширина линии и С — концентрация парамагнитных центров (в см-3). Величины, а и, А в общем случае зависят от размерности пространства. Например, А = 3 для трехмерного пространства (рис. 2А, кривая 2), А = 2 для плоскости, А = 1 для линии [4, 9]. Возможен расчет величин, а и, А и для более сложных случаев пространственного распределения парамагнитных центров [22]. Сопоставление экспериментально найденных и расчетных величин, а и, А открывает возможность исследовать особенности пространственного распределения методом PELDOR.
Разработаны методы, основанные на регистрации экспоненциального спада V (T)?NTER и его зависимости от концентрации парамагнитных центров, позволяющие разделить для дальнейшего анализа V (T)?NTER
и т^А [23, 24].
Импульсы, А и В действуют селективно в разных узких интервалах частот спектра ЭПР. Если величина анизотропии магнитно-резонансных параметров парамагнитных центров достаточно велика, как для нитроксильных спиновых меток, то возникает ориентационная селективность воздействия СВЧ-импульсов на спиновую систему. Эта селективность заключается в том, что по-разному ориентированные в пространстве радикалы в разной степени возбуждаются импульсами, формирующими сигнал спинового эха, и импульсом накачки. Теоретический анализ и эксперимент показали, что если проводить измерения, меняя положение импульсов, А и В в спектре или ДVАВ, то можно из спадов сигнала PELDOR получать сведения о взаимной ориентации спиновых меток и их ориентации относительно вектора г, соединяющего пару меток [25−27]. Схема проведения таких экспериментов для типичного спектра ЭПР нитроксильной метки в 3-сантиметровом диапазоне длин волн показана на рис. 3.
Б
г
г
0
Н0, мТ
Рис. 3. Схема, поясняющая проведение экспериментов по ориентационной селективности для нитроксиль-ных меток. Спектр ЭПР определяется главными значениями тензора СТВ — А, А, А. А, В — импульсы
1 XX уу 22 •
регистрации и накачки соответственно. Спад сигнала У (Т) регистрируется при разных фиксированных значениях АлдВ на крайней линии спектра, соответствующей крайней компоненте А22
Развитые к настоящему времени теория и методы эксперимента PELDOR позволяют получать и исследовать строение и свойства многих биологически важных молекул. Ниже мы рассмотрим результаты изучения ДНК и РНК этим методом.
PELDOR СПИН-МЕЧЕНЫХ ДНК И РНК
Спиновые метки для ДНК и РНК
Разработка способов направленного введения спиновых меток открыла целый каскад приложений метода ЭПР в биохимии и биофизике. Это — определение элементов вторичной и третичной структуры мембранных белков, включая влияние среды, исследование ориентаций и движения отдельных фрагментов белка в физиологических условиях, определение конформационных переходов в ходе функционирования белок-мембранных систем и многое другое.
Как правило, эти исследования выполняются с помощью традиционного стационарного метода ЭПР и систематически публикуются в серии сборников „Биологический магнитный резонанс“ под редакцией Л. Берлинера и др. (к 2011 году вышло 28 книг). Ниже мы остановимся только на работах, связанных с применением метода РЕЬБСЖ для изучения структур ДНК и РНК. Результаты первых исследований в этой области представлены в томах 19 и 21 этой серии [28, 29].
Важнейший этап этих работ, который по существу определил возможность их постановки и выполнения, — создание эффективных методов направленного синтеза спин-меченых биологически важных соединений. Серия методов решения этой задачи для нуклеиновых кислот и олигонуклеотидов рассматривается в обзорах [30−32]. Недавно опубликован краткий обзор, посвященный методам введения спиновых меток в ДНК и РНК [33].
Наиболее популярные спиновые метки, используемые для мечения белков и нуклеиновых кислот, это 2,2,6,6-тетраметилпиперидин-П-оксил (ТЕМРО),
2,2,5,5-тетраметилпирролин-1-оксил-3-ацетилен (ТРЛ) и 2,2,6,6-тетраметил-3,4-дегидропиперидин-П-оксил-4-ацетилен (TEMPA):
ТЕМРО ТРА ТЕМРА
В них неспаренный электрон локализован на N-0-фрагменте.
В первых работах метку вводили по пятому положению остатков урацила в нуклеиновой кислоте [34]. Поскольку ограничение конформационной подвижности спиновых меток повышает точность определения расстояний методом PELD0R, в последние годы спиновые метки стали вводить в нуклеиновые кислоты на жестких линкерах. Один из таких методов, часто применяемых в настоящее время, — метод Соногаши-ры [35, 36], основанный на замещении йода в органическом соединении на алкинильный остаток. Реакция протекает при катализе солями Pd (II) и Си (1). Применительно к нуклеиновым кислотам в положение С5 йод-уридина вводят остатки ТРЛ или TEMPA по реакции Л [34, 37−40] с образованием аддуктов.
Реакция А:
где Rib — остаток рибозы.
Реакция Б:
$
Эта реакция стереоспецифична, протекает с большим выходом и используется для синтеза спин-меченых ДНК и РНК.
Линейные дуплексы нуклеиновых кислот
Строение олигорибонуклеотидных дуплексов длиной 12 нуклеотидов (РНК1) и 15 нуклеотидов (РНК2) изучено в работе [45]. Метки ТЕМРО были введены по 2'--ПН2-группам рибозы в остатках уридина (U) по реакции с изотиоцианатами TEMPO:
Т, нс
Рис. 4. Спады сигналов VlNTRA для пяти спин-меченых ДНК [46]. Глубина модуляции составляет 1, 17, 5, 20 и 20% для ДНК1−5 соответственно. (Воспроизведено с разрешения American Chemical Society.)
Этот метод позволяет вводить спиновые метки как в мономеры, применяемые в фосфитамидном методе синтеза олигонуклеотидов, так и в готовые рибо-и дезоксирибоолигонуклеотиды. С использованием реакции Соногаширы спиновая метка ТРА вводится также в защищенные по аминогруппам остатки аде-нина и цитозина в ходе синтеза рибоолигонуклеоти-дов [41].
В последнее время для введения спиновых меток в олигонуклеотиды широко применяют метод азид-алкинового циклоприсоединения, получивший название „химии защелки“ („click chemistry“) [42]. В этом случае спиновая метка вводится в олигонуклеотид по катализируемой Cu (I) реакции между ацетиленовой группой, введенной в гетероциклическое основание в положение С7 7-деазааденина или С5 урацила, и 4-азидо-ТЕМРО в растворе [43] или в ходе твердофазного синтеза олигонуклеотидов [44] с образованием аддуктов.
РНК1:
РНК2:
5'GCUGAUAUCAGC3'- з I CGACUAUAGUCG5.
ь GGC AGCG3
CAGAUCUG GUCUAGAC 3. GCGA CGGSi
U
Модулированный спад сигнала PELD0R обнаружен только в случае РНК1. Фурье-анализ позволил определить расстояние между спиновыми метками -3.5 ± 0.2 нм. Для РНК2 обнаружен только экспоненциальный спад сигнала PELD0R, свидетельствующий
о равномерном распределении спиновых меток, т. е. об отсутствии процесса образования дуплекса между спин-мечеными олигонуклеотидами РНК2 в водном растворе (буфер 0.1 М ПаС1, 0. 01 М Па-фосфат, 0.1 мМ Na2EDTA, pH 7. 2) при концентрации 0.3 мМ. Это свидетельствует о возможном образовании внутримолекулярных шпилечных структур, доминирующим над бимолекулярным процессом образования дуплекса.
При помощи 4рPELD0R-метода были определены расстояния между спиновыми метками ТРА, введенными по реакции, А в остатки 2'--дезоксиуридина (^ спиралей дуплекса ДНК [46]. Метки вводили в остатки ^ расположенные в пяти разных местах дуплекса, так что число пар оснований, п, между метками было разным: п = 0, 2, 8, 10, 12 соответственно, для ДНК1-ДНК5, например (жирным выделены спин-меченые остатки
Рис. 5. Фурье-спектр, полученный из VINTRA для ДНК1 [46]. Показаны линии, соответствующие Vx (9 = 90°) и V, | (9 = 0°). (Воспроизведено с разрешения American Chemical Society.)
ДНК1 3'--GCGAUACATGCG-5'- 5'--CGCTAUGTACGC-3'-
ДН К 5 3'--СС1ГСАСТАТАТАСТСАСС-5'-
5'--ССАСТСАТАТАТСАСиСС-3'-
Исследовали замороженные (35 К) водные буферные растворы дуплексов с добавками 20% этиленгли-коля для стеклования. Обнаружили модуляцию спада сигнала PELDOR для всех ДНК (рис. 4). Период биений спадов увеличивается с увеличением расстояния между спиновыми метками. Фурье-спектры во всех случаях представляют собой пейковский дублет. Пример такого дублета для ДНК1 приведен на рис. 5. Линии в этом дублете (на 7.4 и 14.8 МГц) соответствуют параллельной (9 = 00) и перпендикулярной (9 = 900) ориентации вектора, соединяющего спиновые метки г относительно направления внешнего магнитного поля. Используя соотношения (1) и (4), можно оценить расстояние между метками. В этом случае г = 1. 92 нм, а обменный интеграл J = 0.
Для ДНК2-ДНК5 расстояния, найденные из Фурье-спектра, оказались равными 2. 33, 3. 47, 4. 48 и 5. 25 нм соответственно. При помощи метода МД (молекулярная динамика) проведен расчет этих расстояний для исследованных спин-меченых ДНК [46]. Результаты сопоставления расчетных и экспериментальных значений с указанием возможных ошибок приведены на рис. 6. Коэффициент корреляции этих результатов составляет 0. 997, что, как полагают [46], подтверждает наличие В-конформации в спирали дуплексов в замороженных водных растворах.
rAB, расчет методом МД, A
Рис. 6. Корреляция расстояний rAB, полученных в эксперименте с ДНК1-ДНК5, с расстояниями, вычисленными для тех же ДНК методом МД [46]. (Воспроизведено с разрешения American Chemical Society.)
Детальное сопоставление методов PELDOR и FRET (fluorescence resonance energy transfer) [46] показало, что эти методы дополняют друг друга при исследовании спин-меченых систем.
Синтезированы шесть дуплексов РНК, меченных ТРА [41]. Достаточно глубокая модуляция, зарегистрированная на спадах сигнала PELDOR, позволила рассчитать функции распределения, F®, и определить с хорошей точностью расстояния в дуплексах, которые лежат в диапазоне от 1. 93 ± 0. 12 до 3. 87 ± 0. 13 нм, в зависимости от числа пар оснований между метками. Сравнение полученных в работах [41] и [46] результатов измерения расстояний в ДНК показывает, что при одинаковом числе пар оснований расстояния между метками в ДНК и РНК, которые находятся в разных спиралях дуплекса, различаются. Так, при нахождении меток в основаниях на расстоянии 10 п.н. значения в ДНК равны 4. 48 ± 0.5 нм, а в РНК — 3. 87 ± 0. 13 нм [41]. Разница находится за пределами ошибки измерений и соответствует двум разным конформациям — А-форме в РНК и более растянутой В-форме в ДНК. Оказалось, что полученные результаты хорошо соответствуют расчетам расстояний методами МД, коэффициент корреляции составляет 0. 976 [41]. Этот результат, по мнению авторов, позволяет считать, что дуплексы ДНК и РНК сохраняют свою конформацию в замороженных (40 К) водно-фосфатных буферных растворах.
В работе [47] метки ТРА вводили не в гетероциклическое основание, а в фосфоротиоатные группы ри-
бозофосфатного остова через метиленовый линкер в определенные места дуплексных цепочек. После образования дуплексов из меченых в разных положениях полинуклеотидов открывается возможность определения расстояний для широкого набора радикальных пар. Используя приготовленные таким способом образцы (измерения проведены при 50 К в замороженных водных растворах дуплексов ДНК), методом PELDOR из положения максимумов функции парного распределения определены восемь расстояний между метками ДНК-дуплекса длиной 12 п.н. Минимальное и максимальное расстояния составляют соответственно 2. 56 и 3. 88 нм для ДНК. Метод введения меток не ограничивает, по мнению его авторов [47], длину полинуклеотида. В работе приведены данные для ДНК, содержащей 68 п.н. с метками, расположенными напротив друг друга на расстоянии 9 нуклеотидов от одного конца дуплекса. Найденное методом PELDOR расстояние (2. 52 нм) соответствует расстоянию 2.5 нм, рассчитанному методом МД.
Авторы работы [47] полученные результаты измерений сопоставили с результатами расчетов с использованием данных спектроскопии ЯМР, учитывающих возможные конформации рассматриваемой ДНК, и обнаружили отличную корреляцию (К2 = 0. 98) между результатами PELDOR-измерений и расчетом. По их мнению, предложенный метод введения меток может широко использоваться в структурных исследованиях комплексов ДНК и РНК с белками.
Близка по постановке к [47] работа [48], где спиновые метки вводили также в фосфоротиоатные группы РНК, а данные о шести расстояниях в парах в диапазоне 2. 5−4. 72 нм сравнивали с результатами рентгеноструктурного метода. Обнаружена уверенная корреляция между этими измерениями с К2 = 0. 97. Это свидетельствует о том, что введение такой метки не меняет существенно строения РНК.
В рассмотренных выше исследованиях показано, что разработанные методы введения спиновых меток в линейные дуплексы ДНК и РНК позволяют достаточно точно (~ 1%) определять расстояние между спин-мечеными нуклеотидами. Важным результатом является достаточно строгая корреляция между результатами PELDOR и рассчитанными методами МД. Расчеты проводились, как правило, для равновесных водных растворов при комнатных температурах, а измерения PELDOR — для быстро замороженных стеклообразных растворов. Можно заключить, что при замораживании мгновенно фиксируется кон-формационное состояние, существующее при комнатных температурах в исследуемых ДНК и РНК. Это обосновывает возможность изучения методом PELDOR ДНК и РНК в различных окружениях и в ходе разных взаимодействий и реакций.
При переходе от В- к А-конформации ДНК меняются расстояния между нуклеотидами. Такое изменение зафиксировано и исследовано методом PELDOR [49]. В этом случае изучены спин-меченые комплементарные дуплексы ДНК:
3'--СТСбСАССТАСАТССТАСвв-Б'-
5'--САСССТССАТСТАвСАТвСС-3'-
0=9−0
О
?
Метку 4-амино-TEMPO вводили по атому N2 остатков гуанина, расположенных либо в одной (верхней) спирали (положения (4- 19), (4- 20)), либо в обеих спиралях. В последнем случае метки занимали положение (4- 14'-) или (4- 18'-) в разных спиралях.
Переход между В- и А-формами ДНК происходит в полярных средах. Спин-меченые дуплексы ДНК исследовали при температурах 60−70 К в водном буфере с добавками 10% (объемных) криопротектора — глицерина. В качестве добавок, стимулирующих переход В ^ А, использовали трифторэтанол (TFE). На рис. 7 показано как меняется спектр расстояний при различном объемном содержании TFE. Форма В переходит в форму, А при концентрациях, соответствующих более 70% TFE. Разница между средними расстояниями для А- и В-форм составляет 0.8 нм. В табл. 1 приведены расстояния между метками для всех исследованных образцов ДНК в Аи В-формах. Здесь же, для сопоставления, приведены результаты расчета методом МД расстояний между атомами кислорода в группах & gt-N0 спиновых меток в исследованных дуплексах.
Таблица 1. Экспериментальные и расчетные расстояния между спиновыми метками (нм) для А- и В-форм ДНК [49]
ДНК- дуплекс PELD0R В-форма, 0−0-расстояние, расчет МД PELD0R А-форма, 0−0-расстояние, расчет МД
(4−20) (4−19) (4−18'-) (4−14'-) 5.6 ± 0.2 5.1 ± 0.2 4.9 ± 0.2 3.2 ± 0.2 5.6 ± 0.3 5.1 ± 0.3 4.8 ± 0.4 3.6 ± 0.3 4.8 ± 0.2 4.6 ± 0.3 4.3 ± 0.3 2.8 ± 0.3 4.5 ± 0.4 4.4 ± 0.4 4.2 ± 0.4 3.3 ± 0. 3
r, нм
85
75
65
50
Рис. 7. Изменение спектра расстояний при добавлении TFE в водный раствор ДНК-дуплекса с метками в положениях (4−18) [49]. (Воспроизведено с разрешения John Wiley & amp- Sons, Inc.)
Рис. 8. Показаны пары спиновых меток в ДНК-дуплексах, расстояния между которыми определены в [52]. (Воспроизведено с разрешения John Wiley & amp- Sons, Inc.)
Спиновые метки ТРА вводили в гетероциклические основания таким образом, чтобы они были ориентированы либо в большую, либо в малую бороздку дуплекса. Это позволило сделать выбор между Аи В-конформациями гибрида. Как оказалось, в одной половине случаев это была В-, а в другой скорее А-конформация. При взаимодействии достаточно длинных дуплексов ДНК и РНК с белками и мембранами возможно образование конформационных изгибов и нарушений линейной структуры, появление различно ориентированных в пространстве коротких дуплексных участков. Такая гетерогенная система смоделирована смесями ДНК-дуплексов одинаковой длины со спиновыми метками в разных участках [52]. Спиновые метки в этой работе последовательно вводили по реакции с изоцианатом ТЕМРО в 2'--амино-группы остатков уридина ДНК-дуплексов таким образом, чтобы расстояние между метками составляло 9, 12, 15, 18 или 21 п.н. :
0
Чувствительность к определению расстояний в нанометровом диапазоне в PELD0R, согласно [49], значительно выше, чем в других методах, таких, как стационарный ЭПР или метод кругового дихроизма (КД). Это позволяет ставить задачи по исследованию переходов между различными конформерами А- или В-форм РНК или ДНК в различных условиях молекулярного окружения и полярности.
При помощи расчета методом МД показано [50], что, если спиновая метка типа ТРА находится в большой бороздке ДНК или РНК, то изменяется взаимная ориентация пары оснований в молекуле. Этот эффект менее существен для меток, расположенных в малой бороздке. Тем не менее конформационные изменения, возникающие при введении меток в ДНК и РНК, следует учитывать при интерпретации ориентационных эффектов PELD0R.
Измерены расстояния между спиновыми метками в четырех гибридных ДНК/РНК-дуплексах [51].
5'--GCU CGU CAU GGU CCU CAT TGT ACT AGC-3'-
3'--CGA GCA GTA CCA GGA GTA ACA TGA UCG-5'-
(жирным обозначены нуклеотиды, в которые вводились спиновые метки).
Всего синтезировано пять дважды спин-меченых дуплексов. Оптимально приготовленные образцы (исследовали замороженные при 77 К растворы ДНК) для Х-диапазона PELDOR-спектрометра (достаточно высокое соотношение сигнал/шум, большое время релаксации Tf» 8 мкс) содержали 12.5×10−6 моль л-1 дуплекса ДНК в 50% растворе дейтероэтиленгликоля в D20. На рис. 8 схематично показаны пары спиновых меток, расстояния между которыми определены в различных дуплексах.
Регистрировали спад сигнала PELDOR и анализировали функции распределения по расстояниям F®, рассчитанные методом регуляризации Тихонова [15]. Определено шесть расстояний между метками в диапазоне 2. 8−6.8 нм. Наибольший интерес вызы-
r, нм
r, нм
Рис. 9. Изучение смесей спин-меченых дуплексов. Функции распределения по расстояниям для смеси дуплексов с расстояниями между метками 2.8 и 4.1 нм. А — Смесь в соотношении 3/1- Б — та же смесь в соотношении 1/3 [52]. (Воспроизведено с разрешения John Wiley & amp- Sons Inc.)
r, нм
Рис. 10. Функция распределения по расстояниям F® для ДНК-дуплекса с тремя метками (1, 2, 3) и для дуплекса с двумя метками (4), возникающего в результате деградации ДНК под действием фермента Endo IV [54]. (Воспроизведено с разрешения John Wiley & amp- Sons, Inc.)
вают результаты изучения смесей указанных выше спин-меченых дуплексов (рис. 9). Установлено [52], что в случае смеси из двух различных дуплексов деконволюция сложной функции F® путем введения для каждого из дуплексов функции распределения в виде гауссовской кривой позволяет с хорошей точностью определить среднее расстояние в каждом дуплексе и его концентрацию в смеси. В то же время в смесях, содержащих большее число дуплексов, при анализе таких F® возникают трудности, связанные, по-видимому, как с неточностями и неоднозначностью решения обратной задачи восстановления F® из кинетики V (T), так и с возможными превращениями под влиянием, например, стэкинг-взаимодействий в сложной смеси, меняющими пространственную геометрию дуплексов [52].
Дуплексы, содержащие мисматчи (неканонические пары) АА и ТТ, изучены в работе [53]. Две спиновые метки ТЕМРО были введены по реакции каталитического циклоприсоединения («click chemistry») в один из олигонуклеотидов по разные стороны от мисмат-чей:
* *
5'--d (TAGGTCAXYACT)-3'-
3'--d (ATCCAGTZWTGA)-5'-,
*
где, А — 7-деазааденозин, содержащий при С7 спиновую метку TEMPO- XY — неканоническая пара dA х dA или dT х dT в положениях 8 или 9 дуплекса. В каноническом дуплексе, когда XY/ZW = AT/TA, расстояние между спиновыми метками составляло 1. 83 нм. В дуплексах ТТ/ТА и АТ/АА, содержащих
неканоническую пару ТТ или АА в положении 8, расстояние между неспаренными электронами составило 1. 73 нм. Если дуплексы содержали неканонические пары в 9-м положении, дуплексы АТ/ТТ и АА/ТА, то расстояние между спиновыми метками составило 1. 87 и 208 нм соответственно. Таким образом, введение неканонической пары в 8-е положение уменьшает расстояние между метками, а в 9-е — увеличивает по сравнению с каноническим дуплексом. Следовательно, появление мисматча в ДНК влияет на структуру соседних пар оснований, вызывая их сближение или расхождение.
Исследованы также ДНК-дуплексы, содержащие три спиновых метки TEMPO [54]. Эти метки Y были введены в алкинил-олигонуклеотид по атомам С5 остатков уридина с помощью метода «click chemistry». В одну из цепей ДНК, кроме двух спиновых меток, введена также тетрагидрофурановая вставка X (дефект THF, см. ниже табл. 3 и 5). Таким образом, исходная система в буферном растворе содержала три спиновых метки и один дефект в дуплексе.
5'--GYAAGGTCCAGXGAYG-3'
3'--САТТССАССУСТСТАС-5'-
Спады сигналов PELDOR в такой трехспиновой системе анализировали стандартным методом [21], модифицированным для трехспиновой системы [20]. Как и следовало ожидать, спектр расстояний в такой
Рис. 11. А — Ориентация спиновых меток в структуре ДНК. Спиновые метки прикреплены к парам оснований 1 и 5. Нормаль к плоскости метки совпадает с ориентацией Azz компоненты тензора СТВ нитроксильной метки. Поскольку плоскости спиновых меток для них ориентированы так же, как и плоскости оснований, то в = в1 = в2. Б — Экспериментальная и рассчитанная зависимость угла в от положения метки в дуплексе[27]. (Воспроизведено с разрешения American Physical Society.)
системе содержал три линии с максимумами на расстояниях 2. 50, 3. 15 и 4. 60 нм и с шириной 0. 05, 0. 45, 0. 75 нм соответственно (рис. 10).
Далее исследовали взаимодействие такого ДНК-дуплекса с апуриновой/апиримидиновой эндонуклеазой IV из Escherichia coli (EndoIV) [54]. Известно, что под действием EndoIV происходит деградация ДНК [55] по апуриновым/апиримидиновым (АР) сайтам, а также аналогам АР-сайтов, содержащих вместо рибозы остатки тетрагидрофурана (THF). Распад дуплекса идет по остатку THF, так что в результате образуется дуплекс, содержащий только две спиновые метки, и фрагмент ДНК с одной меткой и с остатком THF:
быть получены при исследованиях ориентационной селективности в PELDOR-спектроскопии. Ориентационная селективность исследована в работах [25−27, 56]. Для ДНК предложена специально синтезированная метка ^ [57]. Она жестко связана с цитозином, который, в свою очередь, жестко ориентирован и закреплен в структуре ДНК водородными связями с соответствующим комплементарным основанием:
'-У
При исследовании спадов сигнала PELDOR-системы после денатурации обнаружена только одна линия (рис. 10) в спектре расстояний (максимум при 3. 20 нм и ширина 0. 75 нм), которую отнесли к спин-меченому дуплексу, остающемуся в результате деградации.
Полученные результаты демонстрируют потенциальные возможности PELDOR в изучении трехспиновых ДНК-систем и, что особенно важно, расширяют круг возможных систем для анализа механизмов взаимодействия ДНК с белками и ферментами.
Сведения не только о расстояниях между спиновыми метками, но и об их взаимной ориентации могут
В соответствии со структурой ДНК плоскости меток копланарны плоскостям пар нуклеотидов в ДНК, поэтому векторы нормалей к плоскости меток параллельны друг другу (рис. 11А), а угол в между вектором г, соединяющим метки, и нормалью к плоскости разных меток будет один и тот же. Это обстоятельство позволило определить аналитически этот угол из спадов сигнала PELDOR, регистрируемых на разных частотах импульсов регистрации, А и накачки В, т. е. при различных Ауаб. Детальная теория такого анализа изложена в [56] вместе с экспериментальными результатами. В Х-диапазоне ЭПР проведены
измерения спадов сигналов PELDOR для разных значений разности частот (Ауаб) в диапазоне от 90 до 40 МГц с шагом 10 МГц. Положение второй метки в исследуемой серии образцов ДНК варьировало от N3 до N14 (рис. 11А). Полученные в результате данные для угла в в ДНК с разным положением меток приведены на рис. 11Б. Как показано на этом рисунке, этот угол, рассчитанный из геометрии дуплекса ДНК, полностью согласуется с определенным экспериментально. Полученные результаты открывают возможность изучения ориентации спиновых меток в более сложных структурах, чем линейные одно- и двухцепочечные ДНК и РНК.
Динамические свойства молекул нуклеиновых кислот имеют важное значение для понимания кинетики и механизмов таких клеточных процессов, как репликация и транскрипция, когда ДНК закручивается и изгибается при взаимодействии с активными центрами белков. Изучение механизмов молекулярной динамики нуклеиновых кислот является одной из актуальных задач современной биофизики. На ранних этапах теоретических и экспериментальных исследований считалось, что динамические свойства ДНК-дуплексов могут быть описаны моделью эластичного цилиндра [58]. Различные современные физические методы, применяемые для изучения механизмов подвижности ДНК-спирали [59−61], позволили сформулировать по крайней мере три возможных типа движений — изменение шага дуплекса без изменения радиуса спирали (А), изменение радиуса спирали с постоянным шагом спирали — растягивание и закручивание (В) и изгиб спирали без изменения радиуса и шага ©.
Выше мы неоднократно отмечали, что ширина линий в спектре расстояний, полученном из экспериментов PELDOR при низких температурах в замороженных стеклах, коррелирует со спектром возможных конформационных состояний спиновой системы, рассчитанным для той же системы современными методами МД в жидкости. Это означает, что PELDOR дает мгновенные снимки динамической ситуации данной молекулярной системы.
Используя такие возможности PELDOR, авторы [62] решили попытаться разделить механизмы А, В, С, исследуя конформационную гибкость дважды спин-меченой ДНК (20 нуклеотидов). Жесткие спиновые метки типа ^ были введены в нуклеотиды дуплекса. Метки вводили попарно в 10 дуплексов таким образом, чтобы положение одной из меток фиксировалось на одном конце дуплекса, а расстояние R до других последовательно увеличивалось на шаг одного витка спирали. Измерения PELDOR проведены на частотах диапазонов X (9 ГГц) и G (180 ГГц). Измерены спады сигналов PELDOR и их
зависимость от Ауав для всех дуплексов от (1. 5) до (1. 14), определена ширина линий, А = & lt-AR2>-½ в спектре расстояний в гауссовском приближении для F® (рис. 12А). Ширину линий определяли усреднением данных по ориентационной селективности [26], что исключило корреляцию в ориентациях меток при определении расстояний между ними. При исследовании ориентационной селективности на разных Ауав методами, изложенными в [25−27], определили взаимные ориентации меток для всех спиновых пар. Важным этапом работы стал теоретический расчет модулированных спадов сигнала PELDOR, ширины линий функции F® и взаимной ориентации меток для различных моделей движения А, В, С.
Оказалось, что только для В-модели (закручивание спирали) зависимость ширины функции распределения от положения метки описывает данные эксперимента (рис. 12Б). Закручивание и растягивание спирали в этой модели идентифицируется по данным ориентационной селективности, полученным в экспериментах на 180 ГГц. Оказалось, что вариации угла между направлениями по П-О-связи для ближайших меток составляет ±22°.
Полученные результаты, как отмечено в [62], находятся в полном соответствии с моделью кооперативных флуктуаций, так называемой моделью «дыхательных» движений ДНК-дуплекса, когда шаг спирали остается постоянным, а радиус спирали и длина молекулы ДНК изменяются коррелированно. По данным PELDOR, радиус спирали изменяется на 11%, а длина ДНК может меняться на ± 6%. Все эти результаты PELDOR коррелируют с данными малоуглового рентгеновского рассеяния (SAXSI) [61] и с результатами, полученными методом флуоресцентной микроскопии [59] для коротких ДНК-полинуклеотидов. Следует отметить, что широкий набор экспериментальных подходов (уникальный набор спин-меченых ДНК, изучение ориентационной селективности, измерения в разных диапазонах частот), использованных в этой работе [62], по-видимому, впервые показал возможности метода не только в структурных исследованиях, но и в изучении деталей динамики биомакромолекул.
В последнее время предложены спиновые метки — комплексы Gd (Ш) [63−65] или Си (11) [66]. У таких меток обычно спектр ЭПР в полиориенти-рованных системах достаточно сложен. Но в случае Gd (Ш) при измерениях на высоких частотах ~ 30 ГГц (Ка-диапазон) и при криогенных температурах ~ 10 К в спектре преобладает одна линия, соответствующая -И ^ +И-переходу, которая и используется в PELDOR-экспериментах. С использо-
LL
Рис. 12. А — Три модели кооперативных движений в двухцепочечной ДНК (см. текст). Б — Функции распределения по расстояниям, найденные в приближении гауссовского распределения из данных по ориентационной селективности для указанных на рисунке (в скобках) пар спиновых меток типа Q в ДНК-дуплексах. В — Зависимость ширины линии распределения по расстояниям, А = & lt-AR2>-½ от расстояния между метками (эксперимент) и теоретически рассчитанные кривые для механизмов подвижности А, В, С. Минимальное значение, А соответствует расстоянию между метками 1 и 9 в ДНК [62]. (Воспроизведено с разрешения American Chemical Society.)
Положение 2-й метки
го, нм
ванием в качестве меток комплексов Gd (Ш) (Gd538 и Gd595), введенных в концевые тимидины методом «защелки», изучена структура дуплекса, содержащего 14 п.н. [65]:
-d[TCTACTGCTTTAGA]
-d[AGATGACGAAATCT]
(Gd)-5'--
Измерения, проведенные методом 4рPELDOR, для этих комплексов ДНК дали расстояние между ионами около 5.9 ± 1.2 нм при ширине функции распределения по расстояниям ~ 2 нм. Авторы [65] считают, что использование этих ионов позволит расширить диапазон измеряемых методом PELDOR расстояний до ~ 10 нм, что существенно в случае конформаций сложных биомакромолекул. Очевидный недостаток таких меток по сравнению с нитроксильными — доста-
точно большое расстояние (1. 2−1.5 нм) между ионами и местом их присоединения к исследуемой молекуле, что приводит за счет подвижности таких меток к широкому распределению по расстояниям и снижению точности измерений. Отметим, что ряд особенностей методов анализа PELDOR-эксперимента для Gd (III) и Cu (II) детально рассмотрен в [65] и [66] соответственно.
Нелинейные дуплексы и третичные структуры ДНК и РНК
Вторичная структура ДНК и РНК может иметь вид не только линейной спирали, но и принимать более сложные конфигурации, относимые к третичной структуре биополимеров. Достаточно длинные одноцепочечные РНК, изгибаясь на 180о, образуют дуплексы своими комплементарными участками, в то время как некомплементарные участки образуют кольца, шпильки, петли, содержащие несколько нуклеотидов. Расстояния в таких вторичных структурах будут отличаться от расстояний между нуклеотидами в обычных спиралях.
Так получены данные о расстояниях в шпилечной структуре спин-меченых РНК, содержащих 20 нуклеотидов [67]. Нитроксильные метки TEMPO
A
GA G A
C*G
U-A
G-C
C-G
. G-CTAGUA.
UC
О с c-c
Й.
c-e
A-U
5, OACOG-Cj.
GT
O.
GACGUC’GGAAGACGUC'-AGUA CUGCAG CCUUCUGCAG UCAO
2 3
г, нм
Рис. 13. Исследование шпилечных структур в РНК методом PELDOR [67]. А — Спин-меченые нуклеозиды АТ, СТ и GT.
Б — Образование дуплекса РНК из двух шпилек, одна из которых содержит СТ. В — Изменение функции распределения по расстояниям в смесях, содержащих разное количество спин-меченой РНК. (Воспроизведено с разрешения John Wiley & amp- Sons, Inc.)
Б
4
вводили непосредственно в ПН2-группы гуанина, аденина и цитозина определенных нуклеотидов одноцепочечной РНК (рис. 13А). При этом число нуклеотидов между метками было фиксированным и равным 10. Методом PELDOR определяли расстояние между метками при образовании комплементарной спирали спин-меченой и немеченой РНК, а также в шпилечных структурах. В первом случае, независимо от типа нуклеотида и положения пары меток в дуплексе РНК, расстояние между метками оставалось одинаковым, равным 3.1 нм, что соответствует расчетным величинам для А-формы дуплекса.
В шпилечной структуре РНК, состоящей из 20 нуклеотидов, шесть комплементарных нуклеотидов образуют двойную спираль (стебель шпильки), четыре — петлю, остальные — моноспираль. При добавлении в систему полностью комплементарной РНК без спиновых меток формировался дуплекс, в котором метки находились только в одной цепи (рис. 13Б). Методом PELDOR проведены эксперименты с образцами, содержащими разное количество спин-меченой РНК. Функции распределения по расстояниям, полученные в этих экспериментах (рис. 13В), подтвердили существование в замороженных буферных растворах как спин-меченых шпилек с расстояниями между метками 1.8 нм, так и дуплексов с расстояниями 3.1 нм.
Одиночные РНК могут образовывать не только шпильки, но и более сложные структуры типа колец (или полуколец) в сочетании со шпильками. Такие элементы структуры могут акцептировать некоторые молекулы, они носят название «РНК-переключатели» (RNA riboswitches) и играют важ-
ную роль в механизмах, контролирующих передачу генетической информации в клетках.
Методом PELDOR изучены акцептирующие неомицин искусственно синтезированные РНК-переключатели, состоящие из 27 нуклеотидов [68]:
Спиновые метки ТРА были введены в остатки ура-цила (выделены жирным). Определяли расстояния между парами в положениях 4−14, 4−15, 14−26, 15−26. Сделана попытка определить изменения конформации переключателя при образовании его комплекса с неомицином [68]. Оказалось, однако, что функция распределения по расстояниям F® между спин-мечеными уридинами в таком комплексе практически не меняется по сравнению с исходной структурой РНК-переключателя. Это, по мнению авторов [68], указывает на конформационную стабильность структуры.
Изучена структура еще одного фрагмента, способного выполнять функции РНК-переключателя и/или РНК-аптамера по отношению к молекулам тетрациклина (Тс) [69]. Спиновые метки вводились в синтетический 57-звенный рибоолигонуклеотид либо по реакции (1-оксил-2,2,5,5-тетраметилпирролин-3-метил)-метантиосульфоната с 4-тиоуридином, либо по реак-
ции 4-изоцианато-2,2,6,6-тетраметилпиперидин-П оксила с 2-аминогруппами рибозы.
Здесь закрашенные круги — спин-меченые 4-тиоури-дины, незакрашенные — спин-меченые по 2'--амино-группами нуклеотиды.
Предполагаемая структура данного РНК-фрагмента содержала три стебля, Р1, Р2 и Р3, и три петли. Методом PELDOR измерены расстояния между спиновыми метками, введенными в положения (Ш2/Ш1), (Ш2/и56), (и42/и56) и (С14/А41) в отсутствие и в присутствии Тс. Установлено, что свободный РНК-аптамер существует в двух конформациях. В присутствии лиганда Тс происходит сдвиг равновесия в сторону одной из конформаций.
Сообщается о первой попытке исследовать с помощью PELDOR влияние внутриклеточного окружения на спин-меченые ДНК и РНК-структуры [70, 71]. В обеих работах, которые появились почти одновременно, изучали поведение спин-меченых нуклеиновых кислот в относительно больших клетках (диаметром ~ 1 мм) — ооцитах Хвпорш aevis.
В работе [70] изучали 12-звенный ДНК-дуплекс, 14-нуклеотидную РНК-шпильку и 27-мерный РНК-переключатель, чувствительный к неомици-ну (табл. 2). Спиновую метку ТРА вводили в гетероциклические основания по реакции Соногаширы. Для проведения PELDOR-экспериментов использовали примерно по 50 клеток, в каждую из которых
при помощи микроинъекций вводили по 30−50 нл
2. 5−5.0 мМ свободной спиновой метки или дважды меченной нуклеиновой кислоты. На это требовалось около 10 мин. Затем клетки отмывали буфером, переносили в ЭПР-кювету, замораживали в жидком азоте и проводили измерения.
Расстояния между спиновыми метками в РНК-шпильке и неомициновом рибопереключателе не зависели от того, где находился образец — в ооцитах или вне клетки (в буфере). Это означает, что данные РНК имеют жесткие структуры, одинаковые in vivo и in vitro. В противоположность этому расстояние между метками в коротком ДНК-дуплексе зависело от условий, в которых находился образец: в растворе или в клетке. В растворе расстояние между спиновыми метками было меньше, чем в клетке. Объяснением этому, по мнению авторов, было наличие стэкин-га оснований при нахождении дуплекса в растворе и нарушение стэкинга, если ДНК находится в клетке и взаимодействует с клеточными белками и другими молекулами.
В работе [71] метку ТЕМРА присоединяли по реакции Соногаширы к концевым остаткам тимидина каждой цепи (обозначены жирным шрифтом) ДНК-дуплекса:
5'--d[TATCGAA]-3'-
3'--d[ATAGCTT]-5'-.
Такой спин-меченый дуплекс вводили путем микроинъекции в ооциты X. laevis. Сравнивали между собой замороженные при 45 K клетки и буферный физиологический раствор, содержащие спин-меченые ДНК. В обоих случаях после замораживания концентрация парамагнитных частиц существенно уменьшалась, что не помешало оценить расстояние между метками в ДНК в буфере — 3. 20 нм, а в клетках — 3. 22 нм. Главный эффект состоял в существенном увеличении ширины функции распределения. В буфере эта величина составляла 0. 43 нм,
Таблица 2. Нуклеиновые кислоты, исследуемые в [70]
Образец Нуклеотидная последовательность*
РНК-шпилька (U6-U11) 5'--GGC-ACU-UCG-GUG-CC-3'-
Неомициновый рибопереключатель (U14-U26) 5'--GGC-UGC-UUG-UCC-UUU-AAU-GGU-CCA-GUC-3'-
ДНК-дуплекс 5'--GCT-GAT-ATC-AGC-3'- 3'--CGA-CTA-TAG-TCG-5'-
*Жирным выделены нуклеотиды, по которым вводилась спиновая метка.
а в клетках увеличивалась до 1. 04 нм. Судя по представленным данным PELDOR, последняя величина может быть и большей, т. е. соответствовать практически равномерному распределению спинов. Этот эффект обусловлен, по-видимому, [71] достаточно быстрой деградацией ДНК в клеточной среде, протекающей до замораживания образцов.
Одной из главных проблем таких весьма актуальных исследований остается повышение стабильности спиновых меток в клеточной среде. Возможен и переход к опытам, значительно сокращающим время от введения в клетку раствора спин-меченой ДНК до замораживания.
Многие из функциональных ДНК и РНК образуют специфические третичные структуры, строение и динамика которых определяют их функционирование. В таких третичных структурах расстояния между введенными спиновыми метками зависят как от конформации биополимера, так и от пространственной ориентации отдельных его звеньев.
Изучено также влияние ионов Mg2+ на рибозим, имеющий разветвленную структуру «головки молотка» («hammerhead ribozyme», HHRz) [72]. Определены функции распределения по расстояниям для спиновых меток TEMPO, введенных в различные петли структуры HHRz. Показано, что при введении в раствор HHRz ионов Mn+2 в зависимости от концентрации Mn+2 возрастает количество рибозимов, имеющих петли с наименьшим расстоянием ~ 2.4 нм между метками. Предполагается, что именно такие комплексы РНК с ионами металлов участвуют в каталитическом процессе разрезания РНК.
Изменение расстояний между спиновыми метками за счет конформационных превращений оценили методом PELDOR и в других сложных РНК и ДНК с различными третичными структурами, например РНК, содержащую трехспиральное сочленение (three-way-junction) [73]. Подобная структура образуется в упаковочном моторе (packaging motor) бактериофага ф29 при упаковке двухцепочечной геномной ДНК в предформированный капсид. Упаковочный мотор — это РНК-белковый комплекс, использующий энергию гидролиза АТР для конденсации геномной ДНК. Структура РНК, входящей в состав этого мотора, изучена недостаточно, поэтому интересно было исследовать ее методом PELDOR. Эта РНК представляет собой димер, структуру которого рассматривали ранее в качестве возможного интермедиата, образующегося в данном процессе. Спиновые метки R5 вводили по межнуклеотидным фосфотиоатным группам. Ниже изображен элемент этой структуры, где указаны положения, по которым вводили спиновые метки (обозначены звездочками):
Были измерены 17 расстояний между парами спиновых меток. Анализ этих данных позволил определить возможные пространственные ориентации трех спиралей в упаковочном моторе. Показано, что две из трех спиралей РНК этой структуры образуют острый угол по отношению друг к другу, что не согласуется с ранее предложенной моделью, в которой эти спирали состыковываются вдоль одной линии. Данная работа показала большие возможности метода, использованного для изучения пространственной геометрии сложных структур РНК.
Метод PELDOR применили для изучения конформации квадруплексов, образующихся в теломерных последовательностях на концах хромосом [74] (у человека они состоят из повторяющихся участков GGGTTA [75]). Исследовали структуру дважды ТЕМРА-меченного олигонуклеотида, формирующего квадруплекс, в котором спиновые метки введены в положения 5 и 11 олигонуклеотида (рис. 14А) [74]. Доказано, что в растворе, содержащем ионы K+, существует смесь двух структур — антипарал-лельная корзина (antiparallel basket) и параллельный пропеллер (parallel propeller), в соотношении 1: 1 (рис. 14Б, Г). Кроме того, последовательность TT (GGGTTA)3GGGA, слегка отличающаяся от предыдущей, в растворе в присутствии ионов K+ складывалась в новую структуру гибрид 3 + 1 (hybrid 3 + 1) (рис. 14В).
Изучено также четырехспиральное сочленение ДНК (или «Holliday junction») и изменение его структуры при взаимодействии с эндонуклеазой
I бактериофага Т7 [76]. ДНК была сформирована из двух цепей Y (обозначены красным цветом) и Z (обозначены синим цветом), которые формирова-
A
AGGGTTAGGGTTAGGGTTAGGG
Б 5
L, А 4
3
2
1
T, мкс
2 3 4 5 6
r, нм
7 8
Рис. 14. Исследование внутримолекулярной топологии теломерных квадруплексов хромосом человека [74]. А — Структура олигонуклеотида, стрелками отмечены положения спиновых меток. Модели для разных конформеров — antiparallel basket (Б), hybrid 3 + 1 (б), parallel propeller (Г). Черными стрелками показаны расстояния между спиновыми метками. (Воспроизведено с разрешения John Wiley & amp- Sons, Inc.)
ли структуру из четырех спирален, сочлененных в одном месте:
Метки TEMPO были введены по остаткам уридина в разных ветвях дуплекса (метки отмечены жирными буквами U). Замороженные буферные растворы содержали D2O и дейтероглицерин. Регистрация спадов сигналов PELDOR и их анализ выполнены стандартными методами [21]. Результат действия эндонуклеазы на четырехспиральное сочленение ДНК показан на рис. 15. До введения фермента наблюдалось широкое распределение по расстояниям между метками TEMPO в области от 3 до 6 нм, а с увеличением концентрации фермента, по-видимому, вследствие стабилизации комплекса ДНК-фермент, в спектре расстояний наблюдается одна линия с расстоянием между метками в этом комплексе 5.6 нм (рис. 15).
Получены также сведения об изменениях расстояний между метками, введенными в Т7-эндонуклеазу I, при образовании комплекса дуплекс-фермент [76]. Показано, что эти изменения
Рис. 15. Зависимость кинетики спада сигнала PELDOR (А) и спектра расстояний (Б) от весового соотношения дуплекс/фермент в замороженном буферном растворе: 1/0. 00 (1), 1/0. 25 (2), 1/0. 50 (3), 1/1. 00 (4), 1/1. 25 (5) [76]. (Воспроизведено с разрешения American Chemical Society.)
при реорганизации структуры белка невелики (не превышают нескольких А), но надежно регистрируются методом PELDOR.
Таким образом, надежно установлено, что при образовании комплекса между Т7-эндонуклеазой I и четырехспиральным ДНК-сочленением происходит индуцированная подгонка конформаций обоих биополимеров. Конформационные изменения, наблюдаемые при образовании комплекса дуплекс-фермент, находят подтверждение при его расчетах методами МД. Отметим высокий экспериментальный уровень (надежность и точность PELDOR-эксперимента и его обработки) работы [76].
Влияние дефектов на структуру ДНК
В работах [77−79] изучено влияние различных модифицирующих повреждений на изменение структуры ДНК, в частности расстояний между введенными спиновыми метками. Такими повреждениями могут быть различные факторы: структурные агрегаты или группы, связывающие в определенном месте ДНК, замещение нуклеотидов различными структурами, разрыв одной из цепей ДНК в дуплексе и т. п. Все эти факторы, химически модифицирующие ДНК, проявляются в эндогенном метаболизме, их изучение физическими методами представляет большой интерес для биологов и биохимиков.
Изменения расстояний между метками в ДНК-дуплексах, содержащих различные структурные повреждения и вставки в одной из цепей дуплекса, анализировали в работе [77]. Спиновые метки 4-амино-ТЕМРО вводили по остаткам гуанина другой цепи ДНК (см. также ссылку [49]) в положения (4−11) (А) и (4−19) (В), а вторая цепь дуплекса содер-
Таблица 3. Спин-меченые дуплексы ДНК с дефектами и вставками, исследованные в [77]
A
3'--C-T-G-G-G-A-C-G-T-A-G-A-T-C-C-T-A-C-G-G-5'-
5'--G-A-C-C-C-T-G-C-A-T-C-T-A-G-G-A-T-G-C-C-3'-
3'--C-T-G-G-G-A-C-G-T-A-G-A-T-C-C-T-A-C-G-G-5'-
5'--G-A-C-C-C-T-G-C-A-T-C-T-A-G-G-A-T-G-C-C-3'-
c
3'--C-T-G-G-G-A-C-G-T-A-G-A-T-C-C-T-A-C-G-G-5'- 5'--G-A-C-C-C-T-G|C-A-T-C-T-A-G-G-A-T-G-C-C-3'-
D
3'--C-T-G-G-G-A-C-G-T-A-G-A-T-C-C-T-A-C-G-G-5'- 5'--G-A-C-C-C-T-G ¦ A-T-C-T-A-G-G-A-T-G-C-C-3'-
Зазор
E1
E2
E3
E4
E5
3'--C-T-G-G-G-A-C-G-T-A-G-A-T-C-C-T-A-C-G-G-5'-
X ,=8-oxoG
=G
=THF
=Et
=Pr
X2=G
X2=8-oxoG
X2=G
X2=G
X2 = G
O-f-O- Ol'-O*
о і
I 1 pr- jE" Ї
3'--C-T-G-G-G-A-C-G-T-A-G-A-T-C-C-T-A-C-G-G-5'- 5'--G-A-C-C-C-T-G C-A-T-C-T-A-G-G-A-T-G-C-C-3'- /
Вставка А,
B
E
5'--G-A-C-C-C-T-X1 C-A-T-C-T-A-G-G-A-X2 G-C-C-3
F
жала различные повреждения — «разрыв» (nick) ©, «зазор» (gap) (D), «модифицированные нуклеотиды» (Е1-Е5) и «вставку лишнего нуклеотида с образованием петли» (bulge) (F) (табл. 3).
Во всех случаях использовали методику 4рPЕLDOR и стандартные методы обработки результатов. Измерения проводили при температуре 60 или 70 К. Образцы содержали 50 или 100 мкМ спин-меченой ДНК в физиологическом растворе с добавками 15−20% глицерина.
В качестве примера спектров расстояний, полученных из модулированных спадов сигнала PELDOR, на рис. 16 приведены данные для неповрежденных
дуплексов (4−11) и этих дуплексов с различными повреждениями. С целью исключения ориентационной селективности анализировали спад, усредненный из 10 спадов сигнала PELDOR, полученных вариаций магнитного поля для положения импульса регистрации в спектре ЭПР. По мнению авторов [77], все эти меры позволяют надежно оценить ошибку определения среднего расстояния и ширины из функции распределения по расстояниям (ошибка ~10%) (табл. 4).
Все результаты для дуплексов с метками в положениях (4−11) были разделены на две группы [77]. К первой отнесли дуплексы с повреждениями структуры типа С, D, F, Е1, Е2. Изменения в расстояниях
r, нм
Рис. 16. Функции распределения по расстояниям между спиновыми метками для неповрежденной ДНК с метками 4−11 (1) и ее изменение при введении повреждений типа пропил — (2), этил — (3), THF — (4) (см табл. 3). Показаны функции, полученные в стандартном эксперименте, с учетом ориентационной селективности [77]. (Воспроизведено с разрешения Oxford University Press.)
между метками в этой группе малы по сравнению с неповрежденной ДНК и в основном лежат в пределах ошибок измерений. Во второй группе, которую образуют дуплексы с повреждениями типа Е3, Е4, Е5, обнаруживается как значительное уменьшение расстояний, так и уширение функции распределения F®, сопровождающееся ее асимметрией. Близкая ситуация наблюдается и в случае дуплексов с метками в положении (4−19), где расстояния меняются от 5. 21 ± 0. 04 нм для исходной неповрежденной структуры до 5. 02 ± 0. 03 нм для поврежденных дуплексов типа (5. 4), (5. 5), а ширина функции распределения при этом меняется от 0. 33 ± 0. 02 до 0. 44 ± 0. 05 нм.
При обсуждении результатов предполагается, что ширина спектра распределения по расстояниям, как это обычно принято, характеризует конфор-мационную гибкость дуплексов. Следуя специально выполненным МД-расчетам, авторы [77] считают, что значительное изменение расстояний во второй группе поврежденных дуплексов связано с локальным изменением конформаций в месте повреждения и в комплементарном нуклеотиде дуплекса.
В общем, результаты работы [77], в которой изучали изменения в ДНК при повреждениях, в ряде случаев качественно согласуются с данными, полученными такими методами, как ЯМР. При этом считается, что в случае спин-меченых ДНК применение импульсного метода ЭПР в сочетании с расчетом ме-
Таблица 4. Экспериментальные расстояния гтах между спиновыми метками и ширины линий, А функции F® (нм) в исследованных в [77] дуплексах со спиновыми метками в положениях (4−11)
ДНК-дуплекс r max А
Неповрежденный
дуплекс 2. 81 ± 0. 01 0. 21 ± 0. 02
Разрыв 2. 87 ± 0. 01 0. 22 ± 0. 02
Зазор 2. 84 ± 0. 01 0. 26 ± 0. 02
Вставка A1 2. 85 ± 0. 02 0. 23 ± 0. 02
8-oxoG (дуплекс Е1) 2. 81 ± 0. 01 0. 22 ± 0. 02
8-oxoG (дуплекс Е2) 2. 84 ± 0. 01 0. 27 ± 0. 02
THF 2. 46 ± 0. 02 0. 35 ± 0. 02
Этил 2. 65 ± 0. 02 0. 38 ± 0. 04
Пропил 2. 48 ± 0. 02 0. 45 ± 0. 03
тодами МД является дополнительным (к традиционным ЯМР, КД, FRET и рентгеновской кристаллографии), весьма информативным методом изучения различных повреждений ДНК и ее слабых взаимодействий с другими молекулами и комплексами.
Чувствительность параметров, определяемых методом PELDOR, к структурам нуклеиновых кислот оказалась значительно выше, чем в работе [77], когда спиновые метки вводили в концы достаточно коротких олигонуклеотидов и их дуплексов [78, 79].
Метод 3рPELDOR использован для определения функции парного распределения между метками на концах 12-мерных олигонуклеотидов и их ДНК-дуплексов [78]. Синтезированные субстраты содержали спиновые метки по 5'-- и З'--концевым фосфатным группам.
Структуры одноцепочечных ДНК и ДНК-дуплексов длиной 12 нуклеотидов, а также их обозначения приведены ниже:
5'--R-d[CTCTCGCCTTCC]-R-3'- (sG/C12)
5'--R-d[CTCTCGCCTTCC]-R-3'- (G/C12)
3'--d[GAGAGCGGAAGG]-5'-
Один из нуклеотидов, расположенный в центре цепи G, мог быть модифицирован различными вставками и заместителями. Структуры спиновых меток и вводимых вставок приведены в табл. 5.
Для получения функций распределения по расстояниям между метками методом 3рPELDOR исследовали замороженные стеклообразные растворы спин-меченых ДНК в смеси вода/глицерин при 77 К. Функции распределения по расстояниям F® определяли из экспериментальных спадов VINTRA методом регуляризации Тихонова как с помощью стандартного алгоритма, так и с использованием гауссовской аппроксимации для F®.
Таблица 5. Структуры радикала R, нуклеотидов и ненуклеотидных вставок [78, 79]
г, нм
Рис. 17. А — Функция распределения по расстояниям (гауссовское приближение) между спиновыми метками в водноглицериновых растворах ДНК при 77 К [78]. 1 — одноцепочечная ДНК sG/C12 (синяя линия), 2 — дуплекс G/C12 (красная линия),
3 — дуплекс deg2p/C12,
4 — одноцепочечная ДНК THF/C12, 5 — дуплекс THF/C12. Б — Схема, поясняющая определение угла изгиба 9 для поврежденной ДНК. (Воспроизведено
с разрешения The Royal Society of Chemistry.)
Из приведенных на рис. 17А спектров расстояний и данных табл. 6 видно, что при образовании дуплексов происходит сужение функций распределения в 2−3 раза по сравнению с одноцепочечными ДНК. Введение вставок аналогов нуклеотидов приводит к уменьшению среднего расстояния между метками в дуплексах. В случае вставки deg2p наблюдается заметное уширение спектра расстояний по сравнению с дуплексами 0/012.
Очевидно, что сужение функций распределения по расстояниям между метками при образовании дуплексов связано с образованием двойной спирали ДНК, обладающей более жесткой структурой по сравнению с одноцепочечной ДНК. Наблюдаемая ширина спектра неискаженного дуплекса (0/012) обусловлена, по-видимому, хаотической ориентацией
спиновых меток за счет вращения вокруг связей Р-М Учитывая, что расстояние от атома азота до N-0-фрагмента спиновой метки составляет около 0.4 нм, максимальное уширение спектра за счет переориентации спиновых меток будет равно 1.6 нм. В этой области лежит величина экспериментального значения ширины спектра расстояний, А = 0. 98 ± 0.1 нм для неповрежденного дуплекса. Отметим, что эффектов, связанных с ориентационной селективностью в PELD0R, в этой работе, как и в [77], не обнаружено, что также связано, по-видимому, с некоррелированным разбросом ориентаций спиновых меток.
Включение ненуклеотидных вставок в структуру дуплекса влияет на среднее расстояние между метками. Уменьшение расстояния указывает на возможность изгиба дуплекса относительно места располо-
Таблица 6. Параметры функции распределения (нм) по расстояниям для 12-мерных олигонуклеотидов и их ДНК-дуплексов [78]
Образец* Среднее расстояние, r Ширина, A
sG/C12 4. 05 ± 0. 05 2.8 ± 0. 2
sTHF/C12 4. 32 ± 0. 05 2. 85 ± 0. 2
G/C12 4. 35 ± 0. 03 0. 98 ± 0. 1
deg2p/C12 4. 23 ± 0. 03 1. 39 ± 0. 1
THF/C12 4. 26 ± 0. 03 0. 95 ± 0. 1
& quot-Символ s обозначает одноцепочечную ДНК.
жения вставок за счет появления дополнительной степени свободы в области вставки. Схема, иллюстрирующая расчет угла конформационного искажения, показана на рис. 17Б. Используя экспериментально найденные значения г0 (дуплекс без вставки) и г для искаженного дуплекса можно получить приблизительную оценку величины угла 9 = 23° в дуплексе ТНF/C12 и 9 = 27° в петельном дуплексе deg2p/C12.
Увеличение длины и гибкости вставки в дуплексе deg2p/C12 по сравнению с двумя другими дуплексами приводит к дополнительному уширению (А = 1. 39 нм)
спектра расстояний. Величина уширения слишком велика, чтобы ее можно было объяснить одним только разбросом по углу изгиба дуплекса без учета возможного удлинения дуплекса. По этой причине сделанная выше оценка угла изгиба для этой вставки может служить только нижней границей среднего угла изгибания для данного дуплекса.
Таким образом, приведенные оценки показывают, что введение ненуклеотидных вставок в молекулу ДНК открывает возможность изгиба дуплекса относительно места введения вставки. Увеличение количества связей во вставке повышает гибкость вставки. Уменьшение жесткости дуплекса в районе вставки приводит к значительному увеличению разброса угла изгиба и общей длины дуплекса.
В работе [79] для исследования повреждений в протяженных ДНК-дуплексах (13 и 17 нуклеотидов) использовали тот же подход, что и в [78]. Однако основной целью этой работы стало изучение особенностей конформационных превращений ДНК при взаимодействии с Fpg-белком E. coli, одним из ключевых ферментов, вовлеченных в процессы репарации ДНК. Структура изученных дуплексов показана ниже:
5'--d[TCTCTCGCCTTCC]-3'-
3'--R-d[AGAGAGCGGAAGG]-R-5'-
5'--d[TCTCTCTCGCCTTCCTT]-
3'--R-d[AGAGAGAGCGGAAGGAA]-
(G/C13)
(G/C17)
Л
T, мкс
r, нм
Рис. 18. Данные PELDOR для комплексов ДНК с ферментом Fpg [79]. А — Спады сигналов PELDOR, VNTRA (T) для G/C17 (кривая 1), THF /C17/Fpg (2), G/C13 (3), THF /C13/Fpg (4). Для удобства кривые 1 и 2 сдвинуты относительно 3 и 4. Сплошные кривые — расчет с использованием функций F®, приведенных в части Б. Б — Функции распределения по расстояниям между метками, полученные из данных части, А без учета ориентационной селективности. Кривые 1 и 2 относятся к ДНК G/C17 и THF/C17/Fpg, кривые 3 и 4 относятся к ДНК G/C13 и THF/C13/Fpg. (Воспроизведено с разрешения Royal Society of Chemistry.)
Таблица 7. Параметры (нм) функций распределения по расстояниям F® между двумя спиновыми метками в дуплексах ДНК [79]
Строение спиновых меток R, нуклеотидов и ненуклеотидных вставок приведено в табл. 5.
Анализ спадов сигналов PELDOR (рис. 18А) позволил получить функции распределения по расстояниям F® (рис. 18Б) и определить структурные параметры — значения расстояний в максимуме функции распределения, r (точность 0. 8%), и ширину функции на полувысоте, А (точность 10%) (табл. 7).
Как и в работе [78], положение спиновых меток по 5'-- и З'--концам комплементарного второго олигонуклеотида ДНК-дуплекса делало их чувствительными к возникновению изгибов в ДНК, вызванных либо наличием поврежденных сайтов, либо образованием комплексов с ферментом. Обнаружено, что Fpg-белок из E. coli вызывает изгибание даже неповрежденного 13-звенного дуплекса. Аналогичный результат ранее получили лишь при помощи рентгеноструктурного анализа и Fpg из Bacillus stearothermophilus [80−82]. Однако в случае неповрежденного 17-звенного дуплекса не обнаружили образования изгиба в присутствии фермента. Вероятно, это связано с тем, что фермент, который занимает на ДНК участок размером 10 нуклеотидов, не может передвигаться (скользить) вдоль цепи короткого ДНК-дуплекса, тогда как при связывании с 17-звенным ДНК-дуплексом такая возможность имеется. Не исключено, однако, что конформационная подвижность спиновых меток
17-звенного дуплекса выше, чем 13-звенного, о чем свидетельствует увеличение ширины функции F® для 17-звенного дуплекса (см. табл. 7).
В свободных ДНК-дуплексах, содержащих 8-oxoG, не отмечено изменений расстояния между метками по сравнению с неповрежденным дуплексом. Это не удивительно, поскольку 8-oxoG практически не изменяет структуру ДНК. В случае дуплексов, содержащих циклический THF-сайт, наблюдалось заметное уменьшение расстояния между метками. Этот результат подтвержден также путем компьютерного моделирования методом молекулярной динамики [79].
При взаимодействии дуплексов с Fpg-белком E. coli изгибы возникали и в 13-, и в 17-звенных дуплексах. Этот результат согласуется с данными, полученными методом РСА для «сшитого» аддукта Fpg с апурин/апиримидиновым сайтом [80−82]. Важно отметить, что данные РСА дают информацию о локальных участках ДНК в области повреждения, тогда как PELDOR — о глобальных изменениях структуры. Таким образом, структурные исследования обоих типов согласуются между собой и дополняют друг друга.
Зарегистрированные методом PELDOR [78, 79] изгибы ДНК-спирали в области поврежденного нуклеотида дают новую информацию о механизме поиска повреждений в ДНК ферментами репарации. Появление изгибов позволяет понять, почему ферменты, которые скользят вдоль цепи ДНК, останавливаются на поврежденных сайтах и осуществляют их репарацию. Полученные данные также важны для выяснения механизмов действия других ферментов, осуществляющих поиск специфических сайтов в ДНК.
ЗАКЛЮЧЕНИЕ
Подведем некоторые итоги изучения ДНК и РНК методом PELDOR. Показано, что в результате измерения расстояний между различными фрагментами поли- и олигонуклеотидов методом PELDOR можно определить конформации ДНК и РНК, изменение конформаций в результате структурных модификаций и превращений, оценить разброс в расстояниях между отдельными группами, жесткость структуры, определить ориентации спиновых меток, введенных в ДНК и РНК. Начаты исследования влияния среды и образования комплексов с белками на структурные параметры ДНК и РНК.
Рассмотренные в обзоре работы показывают особенности, преимущества и недостатки метода PELDOR по сравнению с аналогичными структурными методами. Из очевидных, наиболее существенных преимуществ отметим достаточно широкий диапазон измеряемых с высокой точностью расстояний меж-
Образец r, нм* max' A, нм*
G/C13 4. 96 1. 1
8-oxoG/C13 4. 96 1. 1
THF/C13 4. 83 1. 1
THF/C13/Fpg 4. 60 1. 2
G/C13/Fpg 4. 78 1. 1
G/C17 6. 00 1. 2
8-oxoG/C17 6. 02 1. 2
THF/C17 5. 98 1. 2
THF/C17/Fpg 5. 76 1. 2
G/C17/Fpg 5. 99 1. 4
*Ошибки в измерениях r и A составляют 0.8 и 10%
1 max
соответственно.
ду спиновыми метками (1. 5−8 нм), причем, что выделяет PELDOR из других структурных методов, определяются не только расстояния, но и функция распределения по расстояниям. Разработаны достаточно простые способы анализа данных экспериментов, проводимых в хаотически ориентированных системах, в смесях и растворах, удобных для химиков и биологов. Импульсные ЭПР-спектрометры коммерчески доступны. Все это определило популярность PELDOR в современной химической радиоспектроскопии, особенно в случае биологически важных систем.
В то же время, на наш взгляд, к недостаткам метода, по сравнению, например, с методом ЯМР, следует отнести необходимость введения спиновых меток в исследуемую молекулу. Однако направленное введение спиновых меток, несмотря на успешную разработку ряда химических методов, операция все еще достаточно трудоемкая. Кроме того, необходимо убедиться, что спин-меченая молекула не потеряла своих исходных физико-химических и биологических свойств. Из-за эффектов линкера «молекула-метка» измеренное расстояние между метками может не совпадать с молекулярным расстоянием. Как правило, все эти проблемы стоят и решаются в том или ином виде в большинстве рассмотренных выше работ. Необходимо также выбирать специальный растворитель, который должен стекловаться при замораживании, так как все измерения выполняются в стеклообразных матрицах при низких температурах. Отметим, что эти же недостатки присущи и измерениям расстояний по дипольному уширению линий в спектре стационарного ЭПР, ограниченного расстояниями, меньшими 2−2.5 нм [29].
По методической постановке PELDOR близок к широко применяемому методу FRET [83], при помощи которого исследуется передача возбуждения между введенными метками донора и акцептора. Отметим, что две флуоресцентные метки, которые вводятся для FRET-измерений, отличаются по строению (а не одинаковые, как в PELDOR) и, как правило, достаточно объемные по сравнению со спиновыми метками. Эффективность FRET пропорциональна величине 1/[1 + (r/R0)6], где R0 — радиус Фёрстера, r — расстояние между метками [84]. Радиус Фёрстера
СПИСОК ЛИТЕРАТУРЫ
1. Милов А. Д., Салихов К. М., Щиров М. Д. // Физика твердого тела. 1981. Т. 23. С. 975−982.
2. Schiemann O., Prisner T.F. // Quart. Rev. Biophys. 2007. V. 40. P. 1−53.
3. Jeschke G., Polyhach Ye. // Phys. Chem. Chem. Phys. 2007.
V. 9. P. 1895−1910.
зависит от ряда таких параметров, как интеграл перекрывания спектров донора и акцептора, квантового выхода флуоресценции, ориентации электрических диполей. Это требует, в отличие от PELDOR, проведения дополнительных экспериментов или калибровок для определения расстояния между метками, что снижает точность определения этих расстояний. Главное преимущество FRET — его предельно высокая чувствительность. Как и во многих современных оптических методах, с его помощью возможны измерения до единичных молекул, в том числе быстро-протекающих превращений в жидкостях. Предельная чувствительность PELDOR составляет около 1012 частиц в образце [10].
Таким образом, выбор метода исследования структуры и свойств поли- и олигонуклеотидов определяется, прежде всего, постановкой задачи и возможностями эксперимента. В идеале сочетание PELDOR и FRET дают наиболее полную информацию о строении и физико-химических свойствах биологически важных структур. Такие работы уже проводятся. Например, имеются публикации, в которых метод применяли для изучения особенностей строения белково-нуклеиновых комплексов [85, 86]. Среди них достаточно сложный надмолекулярный комплекс, моделирующий строение гистонов хроматина [87].
Полученная с помощью метода PELDOR информация вносит, на наш взгляд, существенный вклад в изучение строения и свойств ДНК и РНК. Открываются перспективы для исследований сложных нелинейных структур, взаимодействий полинуклеотидов с ферментами, белками, мембранами. Несомненно, что возможности PELDOR как структурного исследовательского метода будут возрастать с развитием техники импульсной ЭПР-спектроскопии.
Авторы благодарны О. В. Полукариковой за помощь при подготовке обзора.
Работа поддержана РФФИ (гранты № 10−04−70а, 11−03−0011а и 11−04−1 377а), НШ-64. 2012. 04, Отделением химии и наук о материалах РАН (проект 5.6. 3, грант 5. 6), ФЦП «Научные и научно-педагогические кадры» (государственные контракты № 8092, 8473).
4. Цветков Ю. Д., Милов А. Д., Марьясов А. Г. // Успехи химии. 2008. Т. 6. С. 515−551.
5. Sowa Z., Qin P.Z. // Prog. Nucl. Acid Res. Mol. Biol. 2008. V. 82. P. 147−197.
6. Schiemann O. // Meth. Enzymol. 2009. V. 469. Ch. 16. P. 329−351.
7. Reginsson G.W., Schiemann O. // Biochem. Soc. Trans. 2011.
V. 39. P. 128−139.
8. Reginsson G.W., Schiemann O. // Biochem. J. 2011. V. 434.
P. 353−363.
9. Milov A.D., Maryasov A.G., Tsvetkov Yu.D. // Appl. Magn. Reson. 1998. V. 15. P. 107−143.
10. Цветков Ю. Д., Гришин Ю. А. // Приборы и техника эксперимента. 2009. № 5. С. 5−28.
11. Maryasov A.G., Tsvetkov Yu.D. // Appl. Magn. Reson. 2000.
V. 18. P. 583−605.
12. Ponomarev A.B., Milov A.D., Tsvetkov Yu.D. // J. Struct. Chem. (Russ.). 1984. V. 25. P. 51−54.
13. Milov A.D., Ponomarev A.V., Tsvetkov Yu.D. // Chem. Phys. Lett. 1984. V. 110. P. 67−72.
14. Milov A.D., Samoilova R.I., Tsvetkov Yu.D., Jost M., Peggion C., Formaggio F., Toniolo C., Handgraaf J. -W., Raap J. // Chem. Biodiv. 2007. V. 4. Р. 1275−1298.
15. Tikhonov A.N., Arsenin V.Y. Solutions of ill-poset problems. N.Y.: Wiley, 1977.
16. Bowman K., Maryasov A.G., Kim N., DeRose V.J. // Appl. Magn. Reson. 2004. V. 26. Р 23−39.
17. Jeschke G., Koch A., Jonas U., Godt A. // J. Magn. Reson. 2002. V. 155. P 72−82.
18. Jeschke G., Panek G., Godt A., Bender A., Paulsen H. // Appl. Magn. Reson. 2004. V. 26. P. 223−244.
19. Chiang Y. -W., Borbat P.P., Freed J.H. // J. Magn. Reson. 2005. V. 172. P 279−295.
20. Jeschke G., Sajid M., Schulte M., Godt A. // Phys. Chem. Chem. Phys. 2009. V. 11. P. 6580−6592.
21. Jeschke G., Chechik V., Ionita P., Godt A., Zimmermann H., Bbanham J., Timmel C.R., Hilger D., Jung H. // Appl. Magn. Reson. 2006. V. 30. P. 473−498.
22. Milov A.D., Samoilova R.I., Tsvetkov Yu.D., Gusev V.A., Formaggio F., Grisma M., Toniolo C., Raap J. // Appl. Magn. Reson. 2002. V. 23. P. 81−95.
23. Milov A.D., Tsvetkov Yu.D., Formaggio F., Oancea S., Toniolo
C., Raap J. // J. Phys. Chem. B. 2003. V. 107. P 13 719−13 727.
24. Tsvetkov Yu.D. / Biological Magnetic Resonance (EPR: Instrumental Methods) // Eds C.J. Bender, L.J. Berliner. New York: Kluwer Academic/Plenum Publishers, 2004. V. 21.
P. 385.
25. Savitsky A., Dubinskii A.A., Flores M., Lubitz W., Mobius K. // J. Phys. Chem. B. 2007. V. 111. P. 6245−6262.
26. Marko A., Margraf D., Yu H., Mu Y., Stock G., Prisner T. // J. Chem. Phys. 2009. V. 130. 64 102.
27. Marko A., Margraf D., Cekan P., Sigurdsson S. T, Schiemann O., Prisner T.F. // Phys. Rev. E. 2010. V. 81. 21 911.
28. Biological Magnetic Resonance. Spin Labeling: The Next Millenium / Ed. L. Berliner. New York: Kluwer Academic/ Plenum Publishers, 1998. V. 14.
29. Biological Magnetic Resonance. Distance Measurements in Biological Systems by ESR / Eds L. Berliner, S. Eaton, G. Eaton. New York: Kluwer Academic/Plenum Publishers, 2000. V. 19.
30. Biological Magnetic Resonance. EPR: Instrumental Methods / Eds C. Bender, L. Berliner. New York: Kluwer Academic/Plenum Publishers, 2004. V. 21.
31. Schiemann O., Piton N., Plackmeyer J., Bode B.E., Prisner T.F., Engels J.W. // Nat. Protocols. 2007. V. 2. P. 904−923.
32. Krstic I., Endeward B., Margraf D., Marko A., Prisner T.F. // Top. Curr. Chem. 2012. V. 321. P. 159−198.
33. Shelke S.A., Sigurdsson S.T. // Eur. J. Org. Chem. 2012.
P. 2291−2301.
34. Spaltenstein A., Robinson B., Hopkins P.B. // J. Am. Chem. Soc. 1988. V. 110. P. 1299−1301.
35. Rossi R., Carpita A., Bellina F. // Org. Prep. Proc. Int. 1995.
V. 27. P. 127−160.
36. Chinchilla R., Najera C. // Chem. Rev. 2007. V. 107. P 874−922.
37. Gannett P.M., Darian E., Powell J.H., Johnson E.M. // Synthetic Communications. 2001. V. 31. P 2137−2141.
3 В. Gannett P.M., Darian E., Powell J., Johnson E.M. II,
Mundoma C., Greenbaum N.L., Ramsey C.M., Dalal N.S., Budil D.E. // Nucl. Acids Res. 2002. V. 30. P. 5328−5337.
39. Frolow O., Bode B.E., Engels J.W. // Nucleosides Nucleotides Nucl. Acids. 2007. V. 26. P. 655−659.
40. Piton N., Schiemann O., Mu Y., Stock G., Prisner T.F., Engels J.W. // Nucleosides Nucleotides Nucl. Acids. 2005. V. 24.
P. 771−775.
41. Piton N., Mu Y., Stock G., Prisner T.F., Schiemann O., Engels J.W. // Nucl. Acids Res. 2007. V. 35. P. 3128−3143.
42. Kolb H.C., Finn M.G., Sharpless K.B. // Angew. Chem. Int.
Ed. 2001. V. 40. P. 2004−2021.
43. Ding P., Wunnicke D., Steinhoff H. -J., Seela F. // Chem. Eur. J. 2010. V. 16. P. 14 385−14 396.
44. Jakobsen U., Shelke S.A., Vogel S., Sigurdsson S.T. // J. Am. Chem. Soc. 2010. V. 132. P. 10 424−10 428.
45. Schiemann O., Weber A., Edwards T.E., Prisner T.F., Sigurdsson S.T. // J. Am. Chem. Soc. 2003. V. 125. P. 3434−3435.
46. Schiemann O., Piton N., Mu Y., Stock G., Engels J.W., Prisner T.F. // J. Am. Chem. Soc. 2004. V. 126. P. 5722−5729.
47. Cai Q., Kusnetzow A.K., Hubbell W.L., Haworth I.S., Gacho G.C., Eps N.V., Hideg K., Chambers E.J., Qin P.Z. // Nucl. Acids Res. 2006. V. 34. P. 4722−4730.
4 В. Cai Q., Kusnetzow A.K., Hideg K., Price E.A., Haworth I.S., Qin PZ. // Biophys. J. 2007. V. 93. P. 2110−2117.
49. Sicoli G., Mathis G., Delalande O., Boulard Y., Gasparutto D., Gambarelli S. // Angew. Chem. Int. Ed. 200 В. V. 47. P. 735−737.
50. Yu H., Mu Y., Nordenskiold L., Stock G. // J. Chem. Theory Comput. 200 В. V. 4. P. 1781−1787.
51. Romainczyk O., Endeward B., Prisner T.F., Engels J.W. //
Mol. BioSystems. 2011. V. 7. P. 1050−1052.
52. Ward R., Keeble D.J., El-Mkami H., Norman D.G. // ChemBioChem. 2007. V. В. P. 1957−1964.
53. Wunnicke D., Ding P, Seela F., Steinhoff H. -J. // J. Phys. Chem. B. 2012. V. 116. P. 4118−4123.
54. Flaender M., Sicoli G., Aci-Seche S., Reignier T., Maurel V., Saint-Pierre C., Boulard Y., Gambarelli S., Gasparutto D. // ChemBioChem. 2011. V. 12. P. 2560−2563.
55. Takeuchi M., Lillis R., Demple B., Takeshita M. // J. Biol. Chem. 1994. V. 269. P. 21 907−21 914.
56. Schiemann O., Cekan P., Margraf D., Prisner T.F., Sigurdsson S. Th. // Angew. Chem. Int. Ed. 2009. V. 4 В. P. 3292−3595.
57. Barhate N., Cekan P., Massey A. P, Sigurdsson S. Th. // Angew. Chem. Int. Ed. Engl. 2007. V. 119. P 2655−2658.
5 В. Hagerman P.J. // Annu. Rev. Biophys. Biophys. Chem. 19ВВ. V. 17. P 265−286.
59. Gore J., Bryant Z., Nollmann M., Le M.U., Cozzarelli N.R., Bustamante C. // Nature. 2006. V. 442. P. 836−839.
60. Marko J.F. // Europhys. Lett. 1997. V. 3 В. P 183−188.
61. Mathew-Fenn R.S., Das R., Harbury PA. // Science. 200 В.
V. 322. P. 446−449.
62. Marko A., Denysenkov V., Margraf D., Cekan P, Schiemann O., Sigurdsson S. Th., Prisner T.F. // J. Am. Chem. Soc. 2011.
V. 133. P 13 375−13 379.
63. Raitsimring A.M., Gunanathan C., Potapov A., Efemenko I., Martin J.M.L., Milstein D., Goldfarb D. // J. Am. Chem. Soc. 2007. V. 129. P. 1413В-14 139.
64. Potapov A., Song Y., Meade T.J., Goldfarb D., Astashkin A.V., Raitsimring A. // J. Magn. Res. 2010. V. 205. P. 38−49.
65. Song Y., Meade T.J., Astashkin A.V., Klein E.L., Enemark J.H., Raitsimring A. // J. Magn. Res. 2011. V. 210. P 59−68.
66. Yang Z., Kise D., Saxena S. // J. Phys. Chem. B. 2010. V. 114.
P. 6165−6174.
67. Sicoli G., Wachowius F., Bennati M., Hobartner C. // Angew.
Chem. Int. Ed. 2010. V. 49. P. 6443−6447.
6 В. Krstic I., Frolow O., Sezer D., Endeward B., Weigand J.E., Suess B., Engels J.W., Prisner T.F. // J. Am. Chem. Soc. 2010.
V. 132. P. 1454−1455.
69. Wunnicke D., Strohbach D., Weigand J.E., Appel B., Feresin E., Suess B., Muller S., Steinhoff H. -J. // RNA. 2011. V. 17.
P. 182−188.
70. Krstic I., Hansel R., Romainczyk O., Engels J.W., Dotsch V., Prisner T.F. // Angew. Chem. Int. Ed. 2011. V. 50. P. 5070−5074.
71. Azarkh M., Okle O., Singh V., Seemann I.T., Hartig J.S., Dietrich D.R., Drescher M. // ChemBioChem. 2011. V. 12.
P. 1992−1995.
72. Kim N. -K., Bowman M.K., DeRose V.J. // J. Am. Chem. Soc. 2010. V. 132. P. 8882−8884.
73. Zhang X., Tung C. -S., Sowa G.Z., Hatmal M.M., Haworth I.S., Qin P.Z. // J. Am. Chem. Soc. 2012. V. 134. P. 2644−2652.
74. Singh V., Azarkh M., Exner T.E., Hartig J.S., Drescher M. // Angew. Chem. Int. Ed. 2009. V. 4 В. P. 9728−9730.
75. Wright W.E., Tesmer V.M., Huffman K.E., Levene S.D., Shay J.W. // Genes Dev. 1997. V. 11. P. 2801−2809.
76. Freeman A.D.J., Ward R., Mkami H.E., Lilley D.M.J., Norman
D.G. // Biochemistry. 2011. V. 50. P. 9963−9972.
77. Sicoli G., Mathis G., Aci-Seche S., Saint-Pierre C., Boulard
Y., Gasparutto D., Gambarelli S. // Nucl. Acids Res. 2009. V. 37. P. 3165−3176.
7 В. Kuznetsov N.A., Milov A.D., Koval V.V., Samoilova R.I., Grishin Yu.A., Knorre D.G., Tsvetkov Yu.D., Fedorova O.S., Dzuba S.A. // Phys. Chem. Chem. Phys. 2009. V. 11. P. 6826−6В32.
79. Kuznetsov N.A., Milov A.D., Isaev N.P., Vorobjev Yu.N., Koval V.V., Dzuba S.A., Fedorova O.S., Tsvetkov Yu.D. // Mol. BioSystems. 2011. V. 7. P. 2670−2680.
В0. Banerjee A., Santos W.L., Verdine G.L. // Science. 2006.
V. 311. P. 1153−1157.
В1. Qi Y., Spong M.C., Nam K., Karplus M., Verdine G.L. // J.
Biol. Chem. 2010. V. 2В5. P. 1468−1478.
В2. Gilboa R., Zharkov D.O., Golan G., Fernandes A.S., Gerchman S.E., Matz E., Kycia J.H., Grollman A.P., Shoham G. // J. Biol. Chem. 2002. V. 277. P. 19 811−19 816.
В3. Lacowicz J.R. Principles of Fluorescence Spectroscopy. 2nd Ed. New York: Kluwer Academic/Plenum Publishers, 1999.
В4. Forster T. // Ann. Physik. 194 В. V. 437. P. 55−74.
В5. Grohmann D., Klose D., Klare J.P., Kay C.W.M., Steinhoff H. -J., Werner F. // J. Am. Chem. Soc. 2010. V. 132. P. 5954−5955 В6. Sarver J. L., Townsend J. E., Rajapakse G., Jen-Jacobson L., Saxena S. // J. Phys. Chem. B. 2012. V. 116. P. 4024−4033.
В7. Ward R., Bowman A., El-Mkami H., Owen-Hughes T., Norman D.G. // J. Am. Chem. Soc. 2009. V. 131. P. 1348−1349.

ПоказатьСвернуть
Заполнить форму текущей работой