Наследственные мутации при ранних, семейных и билатеральных формах рака молочной железы у пациенток из России

Тип работы:
Реферат
Предмет:
Медицина


Узнать стоимость

Детальная информация о работе

Выдержка из работы

ЭКСПЕРИМЕНТАЛЬНЫЕ ИССЛЕДОВАНИЯ
УДК: 618. 19−006. 6(470): 575. 24/. 25
НАСЛЕДСТВЕННЫЕ МУТАЦИИ ПРИ РАННИХ, СЕМЕЙНЫХ И БИЛАТЕРАЛЬНЫХ ФОРМАХ РАКА МОЛОЧНОЙ ЖЕЛЕЗЫ У ПАЦИЕНТОК ИЗ РОССИИ
А.П. Соколенко1, М.Е. Розанов1, Н.В. Митюшкина1, Н.Ю. Шерина1,
А.Г. Иевлева1, Е.В. Чекмарева1, К.Г. Буслов1, Е.С. Шилов1, А.В. Того1,
Е.М. Бит-Сава1, Д.А. Воскресенский1, О.Л. Чагунава2, Д.Ю. Трофимов3, С.П. Коваленко4, Р. Devilee5, С. Cornelisse5, В.Ф. Семиглазов1, Е.Н. Имянитов1
ФГу «НИИ онкологии им. Н.Н. Петрова», г. Санкт-Петербург1,
Центр маммологии, г. Санкт-Петербург2,
НПФ «ДНк-технология"3,
НИИ молекулярной биологии и биофизики СО РАМН, г. Новосибирск4,
Leiden University Medical Center, The Netherlands5
Наследственные мутации могут вносить значительный вклад в формирование предрасположенности к развитию рака молочной железы (РМЖ). Настоящая работа была направлена на анализ 8 повторяющихся мутаций в 302 случаях РМЖ, отобранных по наличию клинических признаков наследственного рака (билатеральный характер поражения и/или ранний возраст возникновения заболевания (& lt-40 лет) и/или наличие семейного анамнеза). РМЖ-ассоциированные аллели были обнаружены у 46 (15,2%) женщин. Мутация BRCA1 5382insC была выявлена у 29 (9,6%) пациенток, CHEK2 1100delC — у 9 (3,0%), BRCA1 4153delA — у 3 (1,0%) и CHEK2 IVS2+1G& gt-A — у 2 (0,7%), по одному случаю носительства аллелей -BRCA1 185delAG, BRCA2 6174delT и NBS1 657del5. Мутация BRCA1 300T& gt-G (C61G) не была выявлена. Значительная доля наследственных РМЖ в России может быть диагностирована с помощью небольшого числа относительно простых ПЦР-тестов.
Ключевые слова: рак молочной железы, наследственный рак, «founder» мутации.
HEREDITARY MUTATIONS IN RUSSIAN PATIENTS WITH EARLY, FAMILY AND BILATERAL BREAST CANCES A.P. Sokolenko, M.E. Rozanov, N.V. Mityushkina, N. Yu. Sherina, A.G. Ievleva, E.V. Chekmareva, K.G. Buslov, E, S. Shilov, A. V Togo, E.M. Bit-Sava. D.A. Voskresensky, O.L. Chagurnva, D. Yu. Trofimov, S.P. Kovalenko, P. Devilee, C. Cornelisse,
VF. Semiglazov, E.N. Imyanitov N.N. Petrov Research Institute of Oncology, St. Petersburg- Mammography Center, St. Petersburg- Scientific-industrial firm «DNA-technology" — Research Institute of Molecular Biology and Biophysics, RAMS, Novosibirsk-
Leiden University Medical Center, the Netherlands Hereditary mutations can significantly contribute to predisposition to breast cancer. This study was undertaken to analyze 8 recurrent mutations in 302 breast cancer cases selected according to clinical signs of hereditary cancer (bilateral cancer and/or young age of disease occurrence (& lt-40 years) and/or the presence of family history). Breast cancer-associated alleles were detected in 46 (15. 2%) women. Mutation BRCA1 5382insC was detected in 29 (9. 6%) of patients, CHEK2 1100delC in 9 (3. 0%), BRCA1 4153delA in 3 (1. 0%) and CHEK2 IVS2+1G& gt-A in 2 (0. 7%). Such mutations as BRCA1 185delAG, BRCA2 6174delT and NBS1 657del5 were detected each in one case. Mutation BRCA1 300T& gt-G (C61G) was not detected. Most hereditary breast cancers in Russia can be diagnosed by means of a small number of PCR-tests.
Key words: breast cancer, hereditary cancer, «founder» mutations.
Наследственные мутации являются причиной 5−10% случаев рака молочной железы (РМЖ). В настоящее время к числу РМЖ-ассоциированных генов относят BRCA1, BRCA2, CHEK2, NBS1, p53 и ATM. Роль генов BRCA1 и BRCA2 в возникновении РМЖ изучена наиболее подробно. Дефекты генов BRCA характеризуются высокой пенетрантностью и широкой географической представленностью. Как в BRCA1, так и в BRCA2 обнаружено несколько сотен различных мутаций, затрагивающих различные участки этих генов. Последнее обстоятельство значительно затрудняет исчерпывающий анализ BRCA статуса. К счастью, в некоторых странах и этнических группах спектр повреждений BRCA ограничен специфическими мутациями с так называемым эффектом основателя («founder»), что значительно упрощает диагностику наследственных форм РМЖ [12, 14−16]. В отличие от BRCA1 и BRCA2, инактивация гена CHEK2 увеличивает риск возникновения РМЖ в несколько меньшей степени. В этом гене описаны только две наследственные РМЖ-ассоциированные мутации. Аллель CHEK2 1100delC присутствует у 0,2−1,5% жителей Европы и Северной Америки. Другая мутация, CHEK2 IVS2+1G& gt-A, обнаружена в Польше, Белоруссии, Германии и Северной Америке, в то время как для других стран значимость этого генетического варианта остается неясной [1, 3, 5, 8]. Ассоциация гена NBS1 с развитием РМЖ показана только для его делеционного варианта 657del5, который встречается главным образом у славян. Как и в случае CHEK2, дефекты NBS1 характеризуются низкой пенетрантностью в отношении развития РМЖ [2, 8, 21]. Зародышевые мутации в гене р53 вызывают развитие синдрома Ли-Фраумени, сопровождающегося возникновением мультиор-ганных неоплазий. В ряде случаев повреждения р53 были описаны в семьях с множественными случаями РМЖ [10, 11]. Вовлеченность гена АТМ в молекулярный патогенез наследственного РМЖ остается спорным фактом [11].
Предшествующие исследования российских больных РМЖ установили, на удивление значимый «эффект основателя» для мутации BRCA1 5382insC [20]. Кроме того, в значительной доле случаев к развитию РМЖ в нашей стране причастен аллель CHEK2 1100delC [4].
Определённый вклад в эпидемиологию РМЖ принадлежит мутации NBS1 657del5 [2]. Помимо уже изученных «founder"-аллелей, существует еще несколько генетических вариантов, заслуживающих внимания исследователей. В частности, делеция BRCA1 4153delA была впервые выявлена в России в семьях больных раком яичника, а впоследствии обнаружена в Польше, Литве, Белоруссии и Латвии. В этих же четырех странах часть случаев РМЖ ассоциирована с носительством еще одной мутации, BRCA1 300T& gt-G (часто упоминаемой как С6Ш). В России данный генетический вариант еще не изучался [6, 8, 9, 18, 22]. «Еврейские» мутации BRCA1 185delAG и BRCA2 6174delT [16] также нуждаются в анализе, учитывая высокий уровень интеграции между еврейским и русским сообществами в России. И, наконец, необходимость тестирования мутации СНЕК2 IVS2+1G& gt-A обусловлена высокой представленностью этого варианта в Польше и Белоруссии [1, 8].
С целью увеличения вероятности обнаружения генетических дефектов, ассоциированных с развитием РМЖ, мы сконцентрировали наше внимание на случаях раннего, семейного и билатерального рака. В представленной работе нами установлено, что мутации BRCA1 5382^С и СНЕК2 1100delC составляют основную долю известных «йэи^ег"-аллелей в России. Помимо этого, определённый вклад в заболеваемость РМЖ зарегистрирован для мутаций BRCA1 4153delA.
СНЕК2 ^2+Ш& gt-А, BRCA1 185delAG- BRCA2 6174delT, NBS1 657del5.
Материал и методы
Пациентки
В исследование включены 152 пациентки с билатеральным и 150 больных ранним (до 40 лет включительно) и/или семейным РМЖ. Все пациентки проходили лечение в НИИ онкологии им. Н. Н. Петрова, г. Санкт-Петербург. Группа билатерального РМЖ состояла из 59 синхронных и 93 метахронных случаев заболевания. 109 образцов ДНК было получено из архивного патоморфологического материала и 43 выделено из лейкоцитов периферической крови. Средний возраст пациенток на момент возникновения первой опухоли составлял 49,7
Таблица 1
Последовательности олигонуклеотидов, использованных в ПЦР
Мутация Олигонуклеотид Последовательность Длина фрагмента
BRCA1 5382insC common 5'-AGAACCTGTGTGAAAGTATCTAGCACTG-3' 168 п.о.
wt 5'-AAGCGAGCAAGAGAATTCCAG-3'
mut 5'-AGCGAGCAAGAGAATTCCCA-3'
BRCA1 4153delA common 5'-GACTGCAAATACAAACACCCA — 3' 134 п.о.
wt 5'-AGCCCGTTCCTCTTTCTTC — 3'
mut 5'-AGCCCGTTCCTCTTTCTCA — 3'
BRCA1 185delAG common 5'-CAGTTAAGGAAATCAGCAATTACAATAGC -3' 173 п.о.
wt 5'-GCTATGCAGAAAATCTTAGAGTGTCC -3'
mut 5'-ATGCTATGCAGAAAATCTTAGTGTCC -3'
BRCA1 300T& gt-G common 5'-ATTATCTTTTCATGGCTATTTG-3' 158 п.о.
wt 5'- TATATCATTCTTACATAAAGGAA-3'
mut 5'- TATATCATTCTTACATAAAGGAC -3'
BRCA2 6174delT common 5'-CATAACCAAAATATGTCTGGATTGGAG-3' wt: 175 п.о. mut: 168 п.о.
wt 5'-CTGATACCTGGACAGATTTTCCAC-3'
mut 5'-CCTGGACAGATTTTCCCTTGC-3'
CHEK2 1100delC common 5'-CTGATCTAGCCTACGTGTCT-3' 120 п.о.
wt 5'-TTGGAGTGCCCAAAATCAGT-3'
mut 5'-CTTGGAGTGCCCAAAATCAT-3'
CHEK2 IVS2+1G& gt-A common 5'-CAGACTTTGAATAGCAGAGA-3' 114 п.о.
wt 5'-ACACTTTCGGATTTTCAGGG-3'
mut 5'-ACACTTTCGGATTTTCAGGA-3'
NBS1 657del5 forward 5'-TGATCTGTCAGGACGGCAG-3' wt: 82 п.о. mut: 77 п.о.
reverse 5'-CATAATTACCTGTTTGGCATTC-3'
года (возрастной интервал — 25−85 лет), контралатерального новообразования — 55,9 года (возрастной интервал — 28−87 лет). Группа монолатерального РМЖ включала 63 случая раннего рака, 80 пациенток, отобранных в связи с наличием рака молочной железы или рака яичников у родственниц первого поколения (матери или сестры), а также 7 больных с сочетанием указанных признаков. Средний возраст пациенток с монолатеральным РМЖ составил 45,4 года (возрастной интервал — 25−78 лет). Источником ДНК всех монолатеральных РМЖ были лейкоциты периферической крови. 116 билатеральных и 128 монолатеральных РМЖ, включенных в настоящее исследование, ранее уже тестировались на предмет носительства мутации NBS1 657del5 [2]. Аналогичные показатели составили 144 и 150 соответственно, для аллеля BRCA1 5382^С [20], 96 и 150 — для мутации СНЕК2 1100delC [4].
Детекция мутаций
Выделение ДНК и детекция мутаций NBS1 657del5, BRCA1 5382insC and CHEK2 1100delC описаны в работах [2, 4, 20]. Анализ мутаций BRCA1 4153delA, BRCA1 300T& gt-G, BRCA1 185delAG, BRCA2 6174delT и CHEK2 IVS2+1G& gt-A выполнен с помощью ПЦР в режиме реального времени с использованием SYBR Green I на приборе iCycler iQ Real Time Detection System (Bio-Rad). Последовательности олигонуклеотидов и характеристики ПЦР-продуктов представлены в табл.1.
Результаты и обсуждение
Частоты мутаций, обнаруженные в настоящем исследовании, приведены в табл. 2. Варианты BRCA1 5382insC и CHEK2 1100delC отчетливо преобладали среди других мутаций: данные генетические дефекты были выявлены у 29 (9,6%) и 9 (3,0%) из 302 пациенток, соот-
Таблица 2
Встречаемость наследственных мутаций в РМЖ «высокого риска»
Билатеральный РМЖ (n = 152) Ранний и/или семейный монолатеральный РМЖ (п = 150) Всего (n = 302)
BRCA1 5382 insC 16 (10,5%) 13 (8,7%) 29 (9,6%)
BRCA1 4153delA 1 (0,7%) 2 (1,3%) 3 (1,0%)
BRCA1 185delAG 1 (0,7%) — 1 (0,3%)
BRCA1 300T& gt-G — - -
BRCA2 6174delT 1 (0,7%) — 1 (0,3%)
CHEK2 1100delC 3 (2%) 6 (4%) 9 (3,0%)
CHEK2 IVS2+1G& gt-A 1 (0,7%) 1 (0,7%) 2 (0,7%)
NBS1 657del5 — 1 (0,7%) 1 (0,3%)
Всего 23 (15,1%) 23 (15,3%) 46 (15,2%)
Таблица 3
Косвенные клинические признаки наследственного РМЖ и вероятность носительства
наследственной мутации
Клинический признак наследственного РМЖ* BRCA1 мутации CHEK2 мутации Все наслед- ственные мутации** Описание мутаций
3 признака: билатеральность + молодой возраст + семейная история 3/13 (23,1%) 1/13 (7,7%) 4/13 (30,8%) BRCA1 5382insC (п=3), СНЕК2 IVS2+1G& gt-A (п=1)
2 признака 9/45 (20,0%) 1/45 (2,2%) 10/45 (22,2%) BRCA1 5382insC (п=7), BRCA1 4153delA (п=1), BRCA1 185delAG (п=1), СНЕК2 1100ае1С (п=1)
билатеральность + молодой возраст 6/21 (28,6%) 1/21 (4,8%) 7/21 (33,3%) BRCA1 5382ішС (п=4), BRCA1 4153delA (п=1), BRCA1 185delAG (п=1), СНЕК2 1100ае1С (п=1)
билатеральность + семейная история 2/17 (11,8%) 0/17 (0%) 2/17 (11,8%) BRCA1 5382insC (п=2)
молодой возраст + семейная история 1/7 (14,3%) 0/7 (0%) 1/7 (14,3%) BRCA1 5382insC (п=1)
1 признак 21/239 (8,8%) 9/239 (3,8%) 32/239 (13,4%) BRCA1 5382insC (п=19), BRCA1 4153delA (п=2), BRCA2 6174delT (п=1), СНЕК2 1100delC (п=8), СНЕК2 IVS2+1G& gt-A (п=1), NBS1 657del5 (п=1)
билатеральность 7/96 (7,3%) 2/96 (2,1%) 10/96 (10,4%) BRCA1 5382insC (п=7), BRCA2 6174delT (п=1), СНЕК2 1100delC (п=2)
молодой возраст 6/63 (9,5%) 2/63 (3,2%) 9/63 (14,3%) BRCA1 5382insC (п=4), BRCA1 4153delA (п=2), СНЕК2 1100delC (п=2), NBS1 657del5 (п=1)
семейная история 8/80 (10%) 5/80 (6,3%) 13/80 (16,3%) BRCA1 5382insC (п = 8), СНЕК2 1100delC (п = 4), СНЕК2 IVS2+1G& gt-A (п = 1)
Примечание: * - возраст на момент диагноза РМЖ & lt-/= 40 рассматривался как ранний- для метахронного билатерального РМЖ принимался во внимание возраст на момент диагноза первой опухоли- 5 билатеральных РМЖ были исключены из-за отсутствия данных о возрасте пациенток на момент диагноза первой опухоли (1 случай) или недостаточных данных о родственниках (4 случая) — семейной историей считали наличие РМЖ или рака яичника у матери или сестры. ** - кроме мутаций в BRCA1 и СНЕК2, учитывали
наследственные мутации в BRCA2 и NBS1.
ветственно. Аллель BRCA1 4153delA обнаруживался у 3 (1,0%) женщин, CHEK2 IVS2+1G& gt-A — у 2 (0,7%). По одному случаю (0,3%) носи-тельства мутаций было зарегистрировано для аллелей BRCA1 185delAG, BRCA2 6174delT и NBS1 657del5. Мутация BRCA1 300T& gt-G (C61G) не была выявлена ни в одном из проанализированных случаев. В целом, наследственные мутации присутствовали у 23/152 (15,1%) пациенток с билатеральными карциномами и в 23/150 (15,3%) случаях раннего и/или семейного РМЖ.
Связь между вероятностью обнаружения «founder» мутаций и числом косвенных клинических признаков наследственного рака (билатеральность, молодой возраст, семейная история) представлена в табл. 3. Частота мутаций BRCA1 была выше у пациенток с несколькими признаками генетической предрасположенности к РМЖ: 2 или 3 признака — 12/58 (20,7%), 1 признак — 21/239 (8,8%) (p=0,01). Напротив, для CHEK2 такая тенденция в распределении мутаций не наблюдалась: 2 или 3 признака — 2/58 (3,4%), 1 признак — 9/239 (3,8%) (р=0,91). Носители мутаций двух оставшихся генов (BRCA2 и NBS1) имели по одному клиническому признаку наследственного рака.
В результате исследования обнаружено 46 наследственных мутаций, 29 (63,0%) из них составили носительницы аллеля BRCA1 5382insC. 9 (19,6%) — CHEK2 1100delC, 3 (6,5%) -BRcA1 4153delA, 5 (10,9%) — пациентки с другими генетическими дефектами. Определение полной нуклеотидной последовательности РМЖ-ассоциированных генов BRCA1 и BRCA2 доступно лишь в наиболее экономически развитых странах. Для государств с ограниченными экономическими возможностями скрининг небольшого числа «founder» мутаций является наиболее реалистичной альтернативой. В этой связи большую значимость приобретает процесс формирования диагностических панелей. При создании соответствующих тестов во внимание принимаются несколько аспектов, в частности частота мутации, её пенетрант-ность, а также уровень доказательств о причастности данного генетического варианта к формированию онкологического риска (табл. 4). Единственным генетическим вариантом, полностью соответствующим упомянутым
выше критериям, является мутация BRCA1 5382insC, помимо воспроизводимо доказанной высокой пенетрантности, данный генетический дефект характеризуется высокой встречаемостью как при наследственном раке (10%), так и в случайной выборке РМЖ (3,7%) [20]. На втором месте в списке мутаций для тестирования должна быть, по-видимому, мутация BRCA1 4153delA, учитывая заметную частоту и, безусловно, высокую пенетрантность этого аллеля. Значимость мутации CHEK2 1100delC в российской популяции также весьма велика, несмотря на менее выраженную, по сравнению с BRCA1, пенетрантность данного аллеля, его высокая встречаемость свидетельствует о целесообразности включения CHEK2 1100delC в диагностическую панель [3, 4]. По некоторым данным, аллель CHEK2 1100delC может быть причастен к развитию рака в BRCA-негативных семьях с множественными случаями РМЖ, но не рака яичника [7, 13, 17].
Вопрос о целесообразности рутинного тестирования других «founder» вариантов остается открытым. Причины для сохранения в составе диагностической панели мутации BRCA1 185delAG кажутся наиболее весомыми, учитывая как высокую пенетрантность этого дефекта, так и значительную долю лиц еврейской национальности в Российской Федерации. Ситуация с другой «еврейской» мутацией, BRCA2 6174delT, несколько отличается- помимо того, что эта мутация редко встречается в нашей стране, она обладает относительно низкой пенетрантностью. Степень предрасположенности к заболеванию у носительниц аллеля BRCA2 6174delT сравнима с таковой для CHEK2 1100delC. Более того, некоторые исследователи относят этот вариант к полиморфизмам [15, 19]. Подобно BRCA2 6174delT, аллели CHEK2 IVS2+1G& gt-A и NBS1 657del5 также характеризуются низкой встречаемостью и неполной пенетрантностью в отношении развития РМЖ [1, 2, 8, 21]. Тем не менее следует отметить, что три дополнительных ПЦР-теста лишь незначительно увеличивают общую стоимость молекулярно-генетического тестирования, поэтому даже частота 0,3% среди пациенток с высоким риском развития РМЖ может являться поводом для включения мутации в диагностическую панель.
СИБИРСКИМ ОНКОЛОГИЧЕСКИИ ЖУРНАЛ. 2008. № 3 (27)
Таблица 4 4^
Оценка целесообразности генетического тестирования отдельных наследственных мутаций в России °°
Мутация Воспроизводимость данных относительно ассоциации с развитием РМЖ (степень доказательности) Относительный риск (пе-нетрантность) заболевания Частота среди пациенток с РМЖ в России Целесообразность тестирования у пациенток в России Литература
BRCA1 5382 insC Очень хорошая & gt-6 Очень высокая Очень высокая Satagopan et al., 2001- Gorski et al., 2005- Sokolenko et al., 2006
BRCA1 4153delA Очень хорошая 2 или больше Высокая Высокая Gorski et al., 2005
BRCA1 185delAG Очень хорошая & gt- 10 Умеренная/низкая Высокая Satagopan et al., 2001
BRCA1 300T& gt-G Очень хорошая 15 Не обнаружена Спорная Gorski et al., 2005
BRCA2 6174delT Очень хорошая & gt-3 Умеренная/низкая Умеренная Satagopan et al., 2001
CHEK2 llOOdelC Очень хорошая & gt-2 Высокая Высокая CHEK2 Breast Cancer Case-Control Consortium, 2004- Chekmariova et al., 2006
CHEK2 IVS2+1G& gt-A Хорошая & gt-2 Умеренная/низкая Умеренная Bogdanova et al., 2005- Gorski et al., 2005
NBS1 657del5 Хорошая 2 или больше Умеренная/низкая Умеренная Steffen et al., 2004- Buslov et al., 2005- Gorski et al., 2005
А.П. СОКОЛЕНКО, ALE. РОЗАНОВ, Н.В. Ш1ТЮШЮШАII ДР.
разработка магнитоуправляемой системы для доставки химиопрепаратов ------------------------------------------------------------------------- 49
Таким образом, значительное число наследственных РМЖ в России может быть выявлено с помощью небольшого числа относительно простых ПЦР-тестов. Некоторые мутации (BRCA1 5382insC, BRCA1 4153delA, CHEK2 1100delC и, вероятно, BRCA1 185delAG) заслуживают наиболее пристального внимания и должны быть рекомендованы для обследования всех больных РМЖ (табл. 4). Детекция мутаций CHEK2 IVS2+1G& gt-A, BRCA2 6174delT и NBS1 657del5 в «случайной» выборке РМЖ представляется менее целесообразной, их анализ может быть ограничен группами высокого риска. Применение данного диагностического подхода может способствовать снижению смертности от опухолей молочной железы в России.
Настоящая работа поддержана грантами РФФИ (проекты 07−04−122-а, 07−04−172-а и 07−04−92 282-СИГ-а), Федерального агентства по науке и инновациям (проект 02. 512. 11. 2101) и Правительства Москвы (проект 07/15).
ЛИТЕРАТУРА
1. BogdanovaN., Enssen-Dubrowinskaja N., Feshchenko S. et al. Association of two mutations in the CHEK2 gene with breast cancer // Int. J. Cancer. 2005. Vol. 116. P. 263−266.
2. Buslov K.G., fyevleva A.G., Chekmariova E.V. et al. NBS1 657del5 mutation may contribute only to a limited fraction of breast cancer cases in Russia // Int. J. Cancer. 2005. Vol. 114. P 585−589.
3. CHEK2 Breast Cancer Case-Control Consortium: CHEK2*1100delC and susceptibility to breast cancer: a collaborative analysis involving 10,860 breast cancer cases and 9,065 controls from 10 studies // Am. J. Hum. Genet. 2004. Vol. 74. P 1175−1182.
4. Chekmariova E.V., Sokolenko A.P., BuslovK.G. et al. CHEK2 1100delC mutation is frequent among Russian breast cancer patients // Breast Cancer Res. Treatm. 2006. Vol. 100. P. 99−102.
5. Dong X., Wang L., Taniguchi K. et al. Mutations in CHEK2 associated with prostate cancer risk // Am. J. Hum. Genet. 2003. Vol. 72. P. 270−280.
6. Gayther S.A., Harrington P., Russell P. et al. Frequently occurring germ-line mutations of the BRCA1 gene in ovarian cancer families from Russia // Am. J. Hum. Genet. 1997. Vol. 60. P. 1239−1242.
7. Gorski B., Byrski T., Huzarski T. et al. Founder mutations in the BRCA1 gene in Polish families with breast-ovarian cancer // Am. J. Hum. Genet. 2000. Vol. 66. P. 1963−1968.
8. Gorski B., Cybulski C., Huzarski T et al. Breast cancer predisposing alleles in Poland // Breast Cancer Res. Treatm. 2005. Vol. 92. P. 19−24.
9. Gronwald J., ElsakovP., Gorski B., Lubinski J. High Incidence of 4153delA BRCA1 Gene Mutations in Lithuanian Breast and Breast-ovarian Cancer Families // Breast Cancer Res. Treatm. 2005. Vol. 94. P 111−113.
10. Grzybowska E., Zientek H., Jasinska A. et al. High frequency of recurrent mutations in BRCA1 and BRCA2 genes in Polish families with breast and ovarian cancer // Hum. Mut. 2000. Vol. 16. P. 482−490.
11. Iau P.T., Macmillan R.D., Blamey R.W. Germ line mutations associated with breast cancer susceptibility // Eur. J. Cancer. 2001. Vol. 37. P. 300−321.
12. Imyanitov E.N., Hanson K.P. Mechanisms of breast cancer // Drug Discov. Today Dis. Mech. 2004. Vol. 1. P. 235−245.
13. Menkiszak J., Gronwald J., Gorski B. et al. Hereditary ovarian cancer in Poland // Int. J. Cancer. 2003. Vol. 106. P. 942−945.
14. Narod S.A., Foulkes W.D. BRCA1 and BRCA2: 1994 and beyond // Nat. Rev. Cancer. 2004. Vol. 4. P 665−676.
15. Nathanson K.L., Wooster R., Weber B.L. Breast cancer genetics: what we know and what we need // Nat. Med. 2001. Vol. 7. P. 552−556.
16. Neuhausen S.L. Founder populations and their uses for breast cancer genetics // Breast Cancer Res. 2000. Vol. 2. P. 77−81.
17. Oldenburg RA., Kroeze-Jansema K., Kraan J. et al. The CHEK2*1100delC variant acts as a breast cancer risk modifier in non-BRCA1/BRCA2 multiple-case families // Cancer Res. 2003. Vol. 63. P. 8153−8157.
18. Oszurek O., Gorski B., Gronwald J. et al. Founder mutations in the BRCA1 gene in west Belarusian breast-ovarian cancer families // Clin. Genet. 2001. Vol. 60. P. 47071.
19. Satagopan J.M., Offit K., Foulkes W. et al. The lifetime risks of breast cancer in Ashkenazi Jewish carriers of BRCA1 and BRCA2 mutations // Cancer Epidemiol. Biomarkers. Prev. 2001. Vol. 10. P. 467−473.
20. Sokolenko A.P., Mitiushkina N. V, Buslov K.G. et al. High frequency of BRCA1 5382insC mutation in Russian breast cancer patients // Eur. J. Cancer. 2006. Vol. 42. P. 1380−1384.
21. Steffen J., Varon R., Mosor M. et al. Increased cancer risk of heterozygotes with NBS1 germline mutations in Poland // Int. J. Cancer. 2004. Vol. 111. P. 67−71.
22. Tikhomirova L., Sinicka O., Smite D. et al. High prevalence of two BRCA1 mutations, 4154delA and 5382insC, in Latvia // Fam. Cancer. 2005. Vol. 4. P. 77−84.
Поступила 19. 12. 07

ПоказатьСвернуть
Заполнить форму текущей работой