Поиск рнк аутохтонного для России вируса гепатита е в наиболее вероятных источниках инфекции

Тип работы:
Реферат
Предмет:
Медицина


Узнать стоимость

Детальная информация о работе

Выдержка из работы

14. Инструкции по контролю специфической стерильности экспериментальных препаратов, приготовленных из культур чумного и холерного микробов. Саратов- 1982.
15. Drivenek M., Dresler J., Klimentova J. et al. Lett. Appl. Microbiol. 2010- 109(1): 199−211.
16. Безопасность работы с микроорганизмами I-II групп патоген-ности (опасности): Санитарно-эпидемиологические правила СП 1.3. 1285−03. М.- 2003.
Поступила 27. 03. 13
MALDI-TOF MASS-SPECTROMETRIC ANALYSIS IN THE ACCELERATED IDENTIFICATION OF THE VIBRIO GENUS MICROORGANISMS
Afanasev M. V., Mironova L. V., Basov E. A., Ostyak A. S., Kulikalova E. S, Urbanovich L. Ya, Balahonov S. V.
Irkutsk Antiplague Research Institute, Federal Service for Supervision of Consumer Rights Protection and Human Welfare, Irkutsk, Russia
The goal of this work was to develop methodological approaches to identification of the Vibrio genus representatives using the MALDI-TOF mass-spectrometric analysis technologies. The aspects of the biological safety in sample preparations for mass-spectrometric analysis were studied, reference spectra of six typical V. cholerae strains were developed. Identification of 55 strains, representatives of the Vibrio genus, including 45 V. cholerae strains with different epidemic importance, was performed using the MALDI Biotyper 3.0 basis comprising V. cholerae reference spectra. The possibility of reliable definition of the tested strain taxonomic belonging to the species level was demonstrated. Thus, the results completely corresponded to the data of classical microbiological identification. Stability and reproducibility of the offered research method was experimentally shown.
The results allow identification of the Vibrio genus representatives to be implemented with the use of the mass-spectrometric analysis as an effective method that defines a species belonging of the basic Vibrio genus representatives in the shortest terms.
Key words: Vibrio genus- MALDI-TOF mass-spectrometric analysis- identification.
© КОЛЛЕКТИВ АВТОРОВ, 2014 УДК 616. 36−002−022:578. 891]-078
Воронина О. Л., Кунда М. С., Гудов В. П., Аксенова Е. И., Шилова В. С., Ярош Л. В., ЭльгортД.А. ,
Лунин В. Г., Семененко Т. А.
поиск РНК АУТОхТОННОГО ДЛЯ РОССИИ вируса гепатита е в наиболее
вероятных источниках инфекции
ФГБУ Научно-исследовательский институт эпидемиологии и микробиологии им. почетного академика Н.Ф. Гамалеи
Минздрава Р Ф, 123 098, Москва, Россия
Исследования, проводившиеся на протяжении 30 лет с момента открытия вируса гепатита Е (ВГЕ), доказали наличие аутохтон-ного ВГЕ в неэндемичных районах — Европе и России в целом. Мониторинг антител к ВГЕ (анти-ВГЕ) у населения РФ выявил регионы с повышенной серопревалентностью, что свидетельствует о высокой вероятности инфицирования ВГЕ лиц, проживающих в этих областях. Особую опасность контакт с ВГЕ может представлять для пациентов из групп риска. В настоящем исследовании проведено тестирование сывороток крови этих контингентов на наличие анти-ВГЕ. Серопозитивные сыворотки от лиц из регионов с высоким процентом выявления анти-ВГЕ, пациентов из групп риска, образцы с высокой вероятностью содержания ВГЕ, в том числе от животных, являющихся возможным резервуаром ВГЕ, были использованы для выделения РНК. Разработанная система детекции РНК ВГЕ как в ОТ-ПЦР в реальном времени, так и в варианте гнездовой ПЦР, подтвердила свою чувствительность на синтетических контролях и положительных контролях коммерческой тест-системы компании «Genesig» (Великобритания).
Во всех исследованных образцах РНК ВГЕ отсутствовала, что свидетельствует о низкой частоте встречаемости вирусоноси-тельства аутохтонного ВГЕ и необходимости расширения выборки до десятков тысяч человек для достоверного выявления РНК вируса.
Ключевые слова: вирус гепатита Е- анти-ВГЕ IgG- анти-ВГЕ IgM- РНК ВГЕ.
30 лет назад М. С. Балаян и соавт. идентифицировали вирус гепатита Е (ВГЕ) с помощью иммуноэлектронной микроскопии [1].
Через 20 лет по результатам исследования эндемичных по ВГЕ районов Узбекистана и Киргизии С. Н. Кузиным и соавт. было показано, что в Кашкадарьинской области Узбекистана антитела к ВГЕ были обнаружены у 22,1% пациентов с острым гепатитом Е (ГЕ), включая смешанные инфекции (гепатит, А (ГА) или гепатит В (ГВ)). В неэндемичных районах антитела к ВГЕ обнаружены у 4% доноров в Сургуте, у 1,6% пациентов с ВИЧ и у 1,1% медицинских работников в Москве [2].
Еще через 10 лет в Нижегородской области среди мигрантов из эндемичных по ВГЕ районов А. В. Поляниной и соавт. анти-ВГЕ IgG выявлены у 31,9±3,7% обследованных. Среди «условно-здорового» населения частота выявления анти-ВГЕ IgG составила 4,4±2,1% [3]. Таким образом, резких изменений в показателях сероконверсии за прошедшие годы не обнаружено.
Гепатит Е отличает фульминантное течение у беременных женщин в эндемичных по ВГЕ районах. Изучение этой группы пациентов в 2000-х годах показало, что частота обнаружения анти-ВГЕ IgG среди беременных женщин, проживающих в Египте, составила 61,4%, а в России — 1,2% [4]. Таким образом, в неэндемичных районах (в том числе в России) и в этой группе выявление лиц, контактировавших с ВГЕ, чрезвычайно редко.
Подтверждением фактов завоза вируса ГЕ из эндемичных районов служат ретроспективные исследования заболеваемости ГЕ в 2000—2012 гг. в Санкт-Петербурге (установленные с помощью исследования анти-ВГЕ IgG, IgM в сыворотке больных), показавшие, что и в эти годы ГЕ преимущественно болели мигранты из стран с тропическим и субтропическим климатом и лица, приехавшие на учебу из Индии [5].
Как показали исследования геномов ВГЕ, генотипы 1 и 2 распространены в эндемичных районах: генотип 1 — в странах тропических и субтропических районов Азии и Африки, генотип 2 — в Мексике, Нигерии, Чаде, и циркулируют среди людей [6]. ВГЕ генотипа 3 распространен повсеместно как среди животных, так и среди людей [7]. ВГЕ генотипа 4, ранее признанный эндемичным для Индии [8], в настоящее время обнаружен у свиней в Нидерландах и Бельгии и является причиной гепатита у человека [9].
Заболевания, вызываемые ВГЕ генотипов 3 и 4, по всей видимости, следует отнести к зоонозам. Это предположение высказал М. С. Балаян в 2000 г [10], и оно находит все больше подтверждений, в том числе и филогенетических. A.M. Purdy и Yu.E. Khudyakov, проанализировав 55 геномов ВГЕ,
представленных в ОепВапк, пришли к заключению, что дивергенция между штаммами, циркулировавшими у крыс, и штаммами, способными заражать свиней и человека, могла произойти 7,44−104 лет назад (в интервале 2, Ы04- 1,4−105 лет). Штаммы только антропотропных генотипов 1 и 2 имеют еще более позднее происхождение, чем генотипов 3 и 4 [11]. За время взаимодействия с человеком ВГЕ динамично изменял популяцию. Резкий рост популяции для генотипа 1 произошел в 1980-е годы, в настоящее время размер популяции стабилен. Популяция генотипа 3 не менялась с 1760-х годов, но стала расти в XX веке, особенно быстро в 1940—1960-х годах, но столь же резко сократилась в 1990-х до уровня XIX века. Филогенетический анализ генотипа 3 показал, что он не однороден и распадается на 3 клада. В клады 3.1 и 3.2 входят штаммы, поражающие человека и свиней, причем в кладе 3.1 87,5% штаммов из Азии, а в кладе 3.2 60% штаммов из Европы. Характер изменения популяций кладов 3.1 и 3.2 сходен с характером изменения популяции генотипа 3, но степень изменения для клада 3.1 выше, чем для 3.2. Таким образом, даже внутри одного генотипа существуют географические различия, что позволяет говорить об аутохтонном европейском ВГЕ.
Высокий процент обнаружения анти-ВГЕ IgG среди работников ферм в Нижегородской области, достигающий у скотников 20,0±3,1%, подтверждает, что аутохтонный гепатит Е, скорее всего, является зоонозом [3].
К группам риска по аутохтонному ВГЕ относятся также больные с ослабленным иммунным статусом, например перенесшие пересадку органов. Учитывая энтеральный путь заражения гепатитом Е, к группе риска следует отнести и людей без определенного места жительства.
Гепатит Е может протекать в разных формах, от бессимптомной до фульминантной. Работы последних лет показали, что доказательством того, что инфекция вызвана именно ВГЕ, являются 4 маркера: анти-ВГЕ IgG, анти-ВГЕ 1§ М РНК ВГЕ и низкая авидность анти-ВГЕ IgG [12].
В настоящей работе мы поставили задачу определить частоту выявления РНК ВГЕ в разных группах вероятных источников вируса.
Материалы и методы
Биологические образцы. Группы образцов, использованных для выделения РНК ВГЕ, были сформированы на основе масштабного исследования интенсивности циркуляции ВГЕ на территории России, проведенного Т. А. Семененко и соавт. на выборке из 5754 образцов сывороток крови из 16 субъектов Российской Федерации (образцы входят в банк сывороток крови, созданный в НИИЭМ им. Н.Ф. Гамалеи) [13]. При формировании групп образцов было учтено представительство групп риска по ВГЕ и регионов с повышенным показателем серопре-валентности к ВГЕ. Группы включали: сыворотки крови больных, перенесших трансплантацию почки и наблюдающихся в консультативно-диагностическом нефрологическом отделении ГКБ № 52- образцы фекальных масс от больных из указанной группы- сыворотки крови больных гепатитом С (ГС) из 34-го инфекционного отделения вирусных гепатитов ГКБ им. С.П. Боткина- сыворотки крови «условно здоровых» пациентов, сдававших кровь в центре профилактики СПИДа (Калуга) — сыворотки крови трудовых мигрантов из Средней Азии и лиц без определенного места жительства, проходивших амбулаторное обследование в НИИСП им. Н.В. Склифосовского- сыворотки крови свиней из коллекции сывороток лаборатории клинической иммунологии- фрагменты печеней, удаленных у реципиентов (НИИСП им. Н.В. Склифосовского) — печени свиней в возрасте 180−240 дней из частного фермерского хозяйства- образцы фекальных масс оленей из Ханты-Мансийского автономного округа (ХМАО) — смешанную кровь оленя и кабана из частного охотничьего хозяйства Подмосковья.
Серологическое тестирование сывороток проводили с помощью наборов ЗАО «Вектор-Бест»: D-1056 Вектогеп Е —О, D-1058 Вектогеп Е —М, D-0362 Вектогеп, А —О, D-0562 ВектоHBsAg — антитела, D-0578 ВектоНВе —О, D-0566 ВектоHBcAg — антитела — стрип, D-0556 Вектогеп В — HBs-антиген-стрип, D-0771 БЕСТ анти-ВГС, D-2170 ВектоВЭБ-МА-
Таблица 1
Олигонуклеотиды для анализа РНК вируса гепатита Е
Название оли-гонуклеотида
Последовательность олигонуклеотида (5'- - 3'-)
E2 °F GTTTAATCTTGCTGAYAC
E2R CTCATGTTGGTTGTCATAATCCTG
E2NF CCGTCGTCTCAGCCAATGGCGAG
E2NR CCCTTRTCCTGCTGAGCRTTCTC
HEV3 80p CGGAGGTGGTTTCTGGGGTGACCGGGTTG
ACTCTCAGCCCTTCGCCCTCCCCTATATTCA CCCAACCAACCCCTTTGCAT
IgG, D-2172 ВектоВЭБ-ЕА-IgG, D-2176 ВектоВЭБ-VCA-IgM, D-1554 ВектоЦМВ — IgG, D-1552 ВектоЦМВ — IgM на приборе Thermo Scientific Multiskan EX.
Наличие нуклеиновых кислот вирусов гепатита В и С выявляли с помощью наборов ЗАО «Вектор-Бест»: D-0599 Реал-Бест ДНК ВГВ и D-0799 РеалБест РНК ВГС на приборе CFX96 Touch™ Real-Time PCR Detection System («Bio-Rad»).
Выделение РНК ВГЕ проводили с помощью фенольной экстракции (RNA-Extra-Phen, НИИЭМ им. Н.Ф. Гамалеи), сорбции на силикагеле (RNA-Extra-Sorb, НИИЭМ им. Н.Ф. Гамалеи- «BioLine»). Подготовку образцов фекальных масс для выделения РНК проводили, как описано в [14].
Реакцию обратной транскрипции (ОТ) проводили со следующими основными реактивами в реакционной смеси: рассеянная затравка dN (6) (ЗАО «Синтол») — dNTP («Медиген») — ингибитор РНКаз из плаценты человека, M-MuLV RT (НИИЭМ им. Н.Ф. Гамалеи).
ПЦР. Для амплификации кДНК использовали следующие реактивы: dNTP («Medigen») — Hot rescue DNA pol, ПЦР-буфер 10х, праймеры (НИИЭМ им. Н.Ф. Гамалеи).
Для проверки качества экстракции РНК проводили амплификацию кДНК с праймерами на внутренние контроли: фрагменты генов глицеральдегидфосфат дегидрогеназы (GAPD) и цитохрома b (Cytb).
ПЦР в реальном времени проводили в двух вариантах: с интер-калирующим красителем Sybr Green I («Sigma») в разведении 1: 40 000 и с TaqMan-зондами (НИИЭМ им. Н.Ф. Гамалеи) — на приборе АНК-32 (Институт аналитического приборостроения РАН).
В работе использовали несколько комплектов праймеров и зондов: N. Jothikumar и соавт. [15], J.M. Mansuy и соавт. [16], V. Enouf и соавт. [17], а также спланированные нами для ПЦР и ПЦР с внутренними праймерами (табл. 1):
Матрицу HEV3 80p синтезировали на приборе Polygen 12 column DNA-Synthesizer (Германия), используя фосфорамидит-ный метод. Спектры поглощения водных растворов олигонуклео-тидов в УФ-области снимали на спектрофотометре NanoDrop 2000 c («Thermo Scientific», США) при комнатной температуре. Для очистки олигонуклеотидов применяли высокоэффективную жидкостную хроматографию (ВЭЖХ), которую проводили с помощью хроматографа с градиентным режимом подачи растворителей Gilson (США) на колонке диаметром 10 мм и длиной 50 мм, заполненной сорбентом Waters OST-18, 5 мкм (XBridge OST C18, Oligonucleotide Separation Technology).
Для доказательства эффективности работы ферментной системы использовали контрольную матрицу и праймеры набора Hepatitis E Virus («Genesig», Великобритания), разработанного на основе исследования P. Gyarmati и соавт. [18] и позволяющего детектировать РНК всех 4 основных генотипов ВГЕ [19].
Секвенирование ампликонов проводили на приборе 3130 Genetic Analyzer («Applied Biosystems» / «Hitachi»). Использовали наборы BigDye Terminator v. 3.1 Cycle Sequencing. Режим амплификации выбирали согласно рекомендациям к прибору. Электрофорез продуктов реакции осуществляли в капиллярах длиной 50 см с полимером POP-7.
Анализ последовательностей и выравнивание выполняли с помощью программы CLUSTALW2 — Multiple Sequence Alignment [20]. Идентификацию последовательностей ДНК проводили с применением геномной и программной базы BLAST.
Таблица 2
Маркеры к вирусам ВГА, ВГВ, ВГС, ВЭВ, ЦМВ в сыворотках двух групп пациентов
Определяемый маркер, доля
Группы пациентов анти-ВГА- анти-HBsAg НВе- анти- НВс/ суммарный HBsAg ДНК ВГВ анти-ВГС РНК ВГС анти- ВЭБ МА ДО анти- ВЭБ ЕА ДО анти-ВЭБ-VCAМ анти- ЦМВ ДО анти-ЦМВ
Больные после трансплантации почки 0,68 0,44 0,20 0,64 0,12 0,20 0,40 0,20 0,64 0,08 0,04 0,92 0
«Условно здоро- 0,62 0,50 0,50 0,50 0 0 0 0 0 0 0 0 0
вые» пациенты
Результаты и обсуждение
Для поиска аутохтонного ВГЕ использовали биологические образцы, полученные от пациентов, входящих в группы риска, а также образцы от животных, являющихся, по данным литературы [21], резервуаром ВГЕ генотипов 3 и 4. В качестве контроля использовали сыворотки пациентов с подтвержденным ГС (как заболеванием, вызванным РНК-содержащим вирусом). Сыворотки пациентов первоначально анализировали на наличие иммуноглобулинов классов М и G к ВГЕ.
Сыворотки трудовых мигрантов из Средней Азии и лиц без определенного места жительства, проходивших амбулаторное обследование в НИИСП им. Н. В. Склифосовского, были отрицательными по анти-ВГЕ IgG, анти-ВГЕМ, так же, как и сыворотки пациентов с подтвержденным ГС. Сыворотки «условно здоровых» пациентов из Калужской области все были положительными по анти-ВГЕ IgG, и только одна была отрицательной по анти-ВГЕМ. Таким образом, эта группа пациентов достоверно контактировала с ВГЕ. Следует отметить, что пациенты из Калуги были включены в исследование, поскольку в Калужской области при оценке интенсивности циркуляции ВГЕ в 16 субъектах России Т. А. Семененко и совт. показана более высокая частота обнаружения анти-ВГЕ иммуноглобулинов у населения [13].
Сыворотки больных, перенесших трансплантацию почки, по результатам анализа разделены на несколько групп:
1) отрицательные по анти-ВГЕ IgG и анти-ВГЕМ (52%) —
2) положительные по обоим классам антител (16%) — 3) положительные только по анти-ВГЕ IgG (8%) — 4) положительные только по анти-ВГЕМ (24%).
Следует отметить, что образцы были признаны положительными по обоим классам антител к ВГЕ в строгом соответствии с инструкциями по применению к наборам. Однако если обратить внимание на разницу величин оптической плотности образцов и критической оптической плотности, то следует признать, что она была чрезвычайно низкой в 50% случаев для анти-ВГЕМ и в одном случае для анти-ВГЕ в группе больных, перенесших трансплантацию почки. В группе «условно здоровых» пациентов в 57% случаев разница в оптических плотностях при определении анти-ВГЕ IgM была пороговой. Для анти-ВГЕ IgG все значения были достоверно высокими.
Сыворотки всех пациентов были тестированы на наличие ВГА, ВГВ, ВГС, вируса Эпштейна-Барр (ВЭБ), цитомега-ловируса (ЦМВ) и/или антител к ним. Сыворотки трудовых мигрантов из Средней Азии и лиц без определенного места жительства были отрицательными по всем показателям. Сыворотки пациентов с подтвержденным ГС были отрицательными по всем другим вирусам. Из группы «условно здоровых» пациентов 50% контактировали с ВГВ и 62% с ВГА. В группе больных, перенесших трансплантацию почки, как видно из табл. 2, представлены маркеры всех тестированных вирусов, особенно высока доля больных с анти-ВГА IgG, анти- НВс/суммарный, анти-ВЭБ NA IgG и анти-ЦМВ IgG.
При такой высокой вирусной нагрузке не могут быть исключены ложноположительные результаты по анти-ВГЕМ в этой группе пациентов, поскольку вирусы могут быть не-
специфическими модуляторами иммунного ответа, вызывая как усиление, так и подавление формирования антител к другим антигенам [22]. Кроме того, ряд заболеваний, таких как язвенный колит, хронический гепатит, могут вызывать увеличение титра антител к вирусам [23]. Наличие ревматоидного фактора в крови пациентов также может быть причиной ложноположительных результатов по анти-ВГЕМ [24]. Учитывая все перечисленные обоснования, мы можем утверждать, что данные для сывороток, в которых были ти-пированы только анти-ВГЕ IgM, в группе пациентов, перенесших трансплантацию почки, являются ложноположи-тельными.
Для подтверждения этого утверждения мы выделили РНК из сывороток и других биологических образцов, перечисленных в разделе «Материалы и методы» и проверили ее в ПЦР со специфическими праймерами и зондами к геному ВГЕ. Работа N. Jothikumar и соавт. [15], ставшая международным стандартом, послужила основой этого этапа исследований. Синтетическая матрица 80р, соответствующая фрагменту ORF3 (откры-
тая рамка считывания 3) ВГЕ, была успешно амплифицирована с праймерами, предложенными в упомянутой работе (рис. 1). Однако при амплификации кДНК всех перечисленных образцов сывороток в этой системе были получены отрицательные результаты. С целью повышения чувствительности далее была использована гнездовая ПЦР, как с праймерами, описанными в литературе [16], так и с разработанными нами для ORF2 ВГЕ и позволяющими амплифицировать кДНК вируса вне зависимости от генотипа. И в этом случае все образцы сывороток были отрицательными по ВГЕ. РНК ВГЕ не обнаружена и в сыворот-
2800
2000
1000


























1 «
5 10 15 20 25 30 35 40 45 5
Рис. 1. Амплификация матрицы НЕУ3 80р с праймерами к ОКГ3 ВГЕ.
ПЦР в реальном времени. По оси абсцисс — количество циклов, по оси ординат — флюоресценция, относительные единицы.
Рис. 2. Электрофореграмма продуктов амплификации кДНК образцов с 3 парами прай-меров: А — для ВГЕ, В — к внутреннему контролю Су& amp-, С — к внутреннему контролю
GAFD.
1 — маркер (100 п.о. +1,5+3 т.п.о.). Амплификация с праймерами А: 2 — сыворотка ВГЕ ^ положительная, 3 — отрицательная контрольная сыворотка, 4 — сыворотка свиньи 5145, 15−17 — печени свиней. Амплификация с праймерами В: 5 — сыворотка свиньи 5145, 6 — цельная кровь, 7 — отрицательный контроль. Амплификация с праймерами С: 8−9 — печени свиней, 10−13 — сыворотки ВГЕ
^ положительные.
ках свиней, в печени свиней, в удаленной печени реципиентов, в фекалиях оленей и в образце крови диких животных (рис. 2). При этом амплификация внутренних контролей подтвердила эффективность работы системы (см. рис. 2).
Для получения дополнительных доказательств чувствительности системы детекции ВГЕ мы использовали матрицу и праймеры набора Hepatitis E Virus («Genesig», Великобритания). Для выделения РНК, помимо наборов для фенольной экстракции и очистки РНК на силикагеле, разработанных в нашей лаборатории, применили коммерческий набор фирмы «BioLine». Сыворотки, выбранные в анализ в этом эксперименте, имели самый высокий титр анти-ВГЕ IgM. Как показано на рис. 3, контрольная матрица и внутренние контроли были успешно амплифицированы, тогда как в исследуемых образцах и в этой постановке РНК ВГЕ не обнаружена.
Рис. 3. Электрофореграмма продуктов амплификации кДНК образцов и контрольной матрицы с праймерами набора Hepatitis E
Virus («Genesig», Великобритания). 1 — маркер (100 п.о. +1,5+3 т.п.о.) — 2−4 — сыворотки ВГЕ Ig положительные «условно здоровых» пациентов, 5 — отрицательный образец, 6 — контрольная матрица 10e+2, 7 — контрольная матрица 10e+4. Амплификация с праймерами к внутреннему контролю GAFD: 8−9 — сыворотка ВГЕ Ig положительная «условно здорового» пациента (8 — выделение РНК набором RNA-Extra-Phen, 9 — набором BioLine).
Поскольку в нашем арсенале были праймеры как для ORF3, так и для ORF2 ВГЕ, мы предприняли попытку в их сочетании амплифицировать фрагмент размером 1230 п.н., используя в качестве матрицы кДНК из сыворотки свиней, максимально увеличив циклы амплификации. Полученный продукт размером около 1000 п.н. был секвенирован. Результаты анализа полученной последовательности показали, что амплифици-рован неспецифический продукт — фрагмент мРНК Bacteroides fragilis. Таким образом, изменение условий постановки ПЦР повышает риск амплификации неспецифического продукта и регистрации ложноположительного результата.
По последним данным, полученным в экспериментальном заражении ВГЕ макак резусов, детектируемое в ОТ-ПЦР количество вируса в фекальных массах наблюдали до 16-й недели после заражения животных, а в крови — только до 5-й [12]. Исходя их этих сведений, у пациентов, в крови которых были обнаружены анти-ВГЕ IgG и анти-ВГЕ IgM, были взяты образцы фекальных масс для выделения РНК. Проверка РНК в ОТ-ПЦР показала, что вирусная РНК в этих образцах отсутствует.
Таким образом, все пациенты из Калуги и только 24% пациентов из Московского региона, перенесших трансплантацию почки, контактировали с ВГЕ. О давности контакта свидетельствует тот факт, что РНК ВГЕ не выявлена ни в одном из образцов.
Следует отметить, что сыворотки 24% пациентов, перенесших трансплантацию почки, были положительными только по анти-ВГЕ IgM. Ранее обнаружение анти-ВГЕ IgM в сыворотке было принято трактовать как маркер недавней инфекции, вызванной ВГЕ. Однако в настоящее время при отсутствии других симптомов заболевания такой результат скорее воспринимают как ложноположительный и проводят повторное тестирование через некоторое время, когда достоверно должны выработаться анти-ВГЕ IgG при истинном инфицировании вирусом.
Как показали недавние исследования O.D. Rode и соавт., при тестировании сывороток пациентов с подтвержденным диагнозом гепатита на анти-ВГЕ IgM ложноположительные результаты чаще встречаются у пациентов, у которых выявлены также анти-ВГА Ig, и у носителей HBsAg [25]. Следует отметить, что в этой работе так же, как и в нашем исследовании, отмечены пограничные результаты при выявлении анти-ВГЕ Ig с помощью ИФА. Уточнение таких данных O.D. Rode и соавт. проводили с помощью LIA (line-immunoassays), позволяющего расширить спектр антигенов, используемых для выявления антител.
Однако анализ РНК ВГЕ у пациентов с острым или хроническим заболеванием печени, но не острым ГЕ, проведенный C.C. Lin и соавт. у 160 человек, не выявил ни одного случая наличия РНК ВГЕ в сыворотке. Только у 1,9% пациентов были детектированы анти-ВГЕ IgM [26]. При остром ГЕ, напротив, в первую неделю заболевания РНК ВГЕ была выделена из крови у 93%, а из фекалий — у 70% пациентов, по данным E.T. Clayson и соавт. [27]. В то же время P. Va-sickova и соавт. обнаружили наличие РНК ВГЕ в фекалиях только 60% пациентов с острой формой ГЕ [14].
Следует отметить, что Е. В. Чаусов и соавт. только при моноинфекции, вызванной ВГЕ, а не в случае смешанной инфекции (ВГЕ и ВГА) выделили РНК ВГЕ из сыворотки крови двух из трех пациентов с моноинфекцией (по данным тестирования анти-ВГЕ IgG и анти-ВГЕ IgM). Только один из этих случаев можно интерпретировать как аутохтонный ГЕ. В сыворотках 10 пациентов со смешанной инфекцией РНК ВГЕ не обнаружена [28].
Анализ данных литературы по частоте выявления РНК ВГЕ в биологических образцах, положительных по анти-ВГЕ IgG и анти-ВГЕ IgM, показал, что в образцах донорской крови этот показатель низкий даже в Китае при ВГЕ серопревалентности населения более 40% и составляет 7,14% [29]. Таким образом, выявление РНК в сыворотках российских пациентов, не имеющих диагноза острого ГЕ, при серопревалентности 9,7% в Европейской части России [13] вероятно только при анализе выборки в десятки тысяч человек.
Отсутствие РНК ВГЕ в печени свиней в возрасте 180−240 дней согласуется с данными литературы. Так Y. Kanai и соавт. показали, что если в возрасте 30−100 дней у всех домашних свиней выборки была обнаружена РНК ВГЕ в фекалиях, то в возрасте 200 дней только у 3 из 13 свиней выделена РНК ВГЕ из внутренних органов [30]. Таким образом, только поросята раннего возраста могут способствовать распространению ау-тохтонного ВГЕ среди домашних животных и человека.
Полученные результаты свидетельствуют о возможности контакта населения с аутохтонным ВГЕ, но не подтверждают вирусоносительства у обследованных пациентов, диких и домашних животных.
Благодарности
Авторы выражают благодарность за предоставленные биологические образцы руководителю отдела лабораторной диагностики НИИСП им. Н.В. Скли-фосовского М. А. Годкову, заведующему лабораторией клинической иммунологии А.И. Баженову- зам. гл. врача ГКБ им. С. П. Боткина Г. Ю. Никитиной и д.м.н., проф. М. Л. Зубкину.
Сведения об авторах:
ФГБУ НИИЭМ им. Н. Ф. Гамалеи Минздрава России, Москва
Воронина Ольга Львовна — канд. биол. наук, доц., вед. науч. сотр., зав. лаб.- e-mail: kirolg3@newmail. ru-
Кунда Марина Сергеевна — канд. биол. наук, ст. науч. сотр. -
Гудов Владимир Петрович — канд. хим. наук, ст. науч. сотр. -
Аксенова Екатерина Ивановна — канд. биол. наук, науч. сотр. -
Шилова Виолетта Сергеевна — аспирант-
Ярош Людмила Владимировна — науч. сотр. -
Эльгорт Дина Абрамовна — канд. биол. наук, ст. науч. сотр. -
Лунин Владимир Глебович — д-р биол. наук, вед. науч. сотр., зав. лаб. -
Семененко Татьяна Анатольевна — д-р мед. наук, проф., рук. отдела эпидемиологии.
ЛИТЕРАТУРА
1. Balayan M.S., Andjaparidze A.G., Savinskaya S.S., Ketiladze E.S., Bra-ginsky D.M. et al. Evidence for a Virus in Non-A, Non-B Hepatitis Transmitted via the Fecal-Oral Route. Intervirology. 1983- 20: 23−31.
2. Кузин С. Н., Алаторцева Г. И., Буриев А. Я., Умиров С. Е., Хасанов А. Х., Гольцов В. А. и др. Распространение вируса гепатита Е в эндемичных и неэндемичных регионах. Вопросы вирусологии. 2002- 47(2): 18−21.
2. Kuzin S.N., Alatortseva G.I., Buriev A. Ia., Umirov S.E., Khasanov A. Kh., Gol'-tsov V.A. et al. Propagation of hepatitis E virus in an endemic and nonendemic regions. Voprosy virusologii. 2002- 47(2): 1821 (in Russian).
3. Полянина А. В., Быстрова Т. Н. Сравнительная эпидемиологическая характеристика гепатита. 2011- 4(17): 29−31.
3. Polyanina A.V., Bystrova T.N. Comparative epidemiological characteristics of hepatitis A and hepatitis E infection in the temperate climate. Meditsinsky almanakh. 2011- 4(17): 29−31 (in Russian).
4. Ибрагим Е-М. И., Попова О. В., Бурков А. Н., Михайлов М. И. Гепатит E среди беременных Египта и России: Частота выявления анти-ВГЕ // Информационный бюллетень: Вирусные гепатиты. Достижения и перспективы. 2003- 3(18): 15−16.
4. Ibragim E-M. I., Popova O.V., Burkov A.N., Mikhailov M.I. Hepatitis E in pregnant from Egypt and Russia: The frequency of anti-HEV // Inform. byulleten'-. Virusnye gepatity. Dostizheniya i perspektivy. 2003- 3(18): 15−16 (in Russian).
5. Эсауленко Е. В., Малинникова Е. Ю., Перадзе Х. Д., Яковлев А. А. ,
Михайлов М. И. Спорадические и групповые завозные случаи гепатита Е в Санкт-Петербурге. Журнал микробиологии 2013- (1): 38−41.
5. Esaulenko E.V., Malinnikova E. Iu., Peradze Kh.D., Iakovlev A.A., Mikhailov M.I. Sporadic and group imported cases of hepatitis E in St. Petersburg. Zhurnal mikrobiol, epidemiologii Immunobiologii. 2013- (1): 38−41 (in Russian).
6. Lu L., Li C., Hagedorn C.H. Phylogenetic analysis of global hepatitis E virus sequences: genetic diversity, subtypes and zoonosis. Rev. Med. Virol. 2006- 16(1): 5−36.
7. Garkavenko O., Obriadina A., Meng J., Anderson D.A., Benard H.J., Schroeder B.A. et al. Detection and characterisation of swine hepatitis E virus in New Zealand. J. Med. Virol. 2001- 65(3): 525−9.
8. Arankalle V.A., Chobe L.P., Joshi M.V., Chadha M.S., Kundu B., Walimbe A.M. Human and swine hepatitis E viruses from Western India belong to different genotypes. J. Hepatol. 2002- 36(3): 417−25.
9. Hakze-van der Honing R.W., van Coillie E., Antonis A.F., van der Poel W.H. First isolation of Hepatitis E virus genotype 4 in Europe through swine surveillance in the Netherlands and Belgium. PLoS One 2011- 6: e22673.
10. Балаян М. С. Вирус гепатита Е у животных. Мир вирусных гепатитов. 2000- 1: 3−4.
10. Balayan M.S. Hepatitis E virus in animals. Mir virusnykh gepatitov. 2000- 1: 3−4 (in Russian).
11. Purdy A.M., Khudyakov Yu.E. Evolutionary history and population dynamics of hepatitis E virus. PLoS ONE. 2010- 5(12): e14376.
12. Zhang J., Li S.W., Wu T., Zhao Q., Ng M.H., Xia N.S. Hepatitis E virus: neutralizing sites, diagnosis, and protective immunity. // Rev. Med. Virol. 2012- 22(5): 339−49. doi: 10. 1002/rmv. 1719
13. Семененко Т. А., Борисова В. Н., Зубкин М. Л., Шилова В. С., Никитина Г. Ю., Кудрявцева Е. Н. и др. Оценка интенсивности циркуляции вируса гепатита Е на территории России. Эпидемиология и вакци-нопрофилактика. 2013- 1: 15−22.
13. Semenenko T.A., Borisova V.N., Zubkin M.L., Shilova V.S., Nikitina G. Yu., Kudryavtseva E.N. et al. Seroprevalence of Hepatitis E virus in Russia (Serum bank case study). Epidemiologiia i vaktsinoprofilaktika. 2013- 1: 15−22 (in Russian).
14. Vasickova P., Slany M., Chalupa P., Holub M., Svoboda R., Pavlik I. Detection and phylogenetic characterization of human hepatitis E virus strains, Czech Republic. Emerg Infect Dis. 2011- 17(5): 917−9. doi: 10. 3201/eid1705. 101 205.
15. Jothikumar N., Cromeans T.L., Robertson B.H., Meng X.J., Hill V.R. A broadly reactive one-step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus. J. Virol. Methods. 2006- 131: 65−71.
16. Mansuy J.M., Peron J.M., Abravanel F., Poirson H., Dubois M., Mie-douge M. et al. Hepatitis E in the south west of France in individuals who have never visited an endemic area. J. Med. Virol. 2004- 74(3): 419−24.
17. Enouf V., Dos Reis G., Guthmann J.P., Guerin P. J., Caron M., Marechal V., Nicand E. Validation of single real-time TaqMan PCR assay for the detection and quantitation of four major genotypes of hepatitis E virus in clinical specimens. J. Med. Virol. 2006- 78(8): 1076−82.
18. Gyarmati P., Mohammed N., Norder H., Blomberg J., Belak S., Widen F. Universal detection of hepatitis E virus by two real-time PCR assays: TaqMan and Primer-Probe Energy Transfer. J. Virol Methods. 2007- 146(1−2): 226−35.
19. Quantification of Hepatitis E virus (HEV) genomes. genesig Standard kit handbook HB10. 02. 04.
20. The Main Site EMBL-EBI, European Bioinformatics Institute (URL: www. ebi. ac. uk 18−05−2013).
21. Cao D., Meng XJ. Molecular biology and replication of hepatitis E virus. Emerging. Microb. Infect. (EMI). 2012- 1, e17- doi: 10. 1038/emi. 2012. 7
22. Cremer N.E., Devlin V.L., Riggs J.L., Hagens S.J. Anomalous antibody responses in viral infection: specific stimulation or polyclonal activation. J. Clin. Microbiol. 1984- 20(3): 468−72.
23. Triger D.R., MacCallum F.O., Kurtz J.B., Wright R. Raised antibody titres to measles and rubella viruses in chronic active hepatitis. Lancet. 1972- i: 665−7.
24. Takahashi M., Kusakai S., Mizuo H., Suzuki K., Fujimura K., Masuko K. et. al. Simultaneous detection of immunoglobulin A (IgA) and IgM antibodies against hepatitis E virus (HEV) is highly specific for diagnosis of acute HEV infection. J. Clin. Microbiol. 2005- 43(1): 49−56.
25. Rode O.D., Mikulic R., Vince A., Begovac J. Serological study on hepatitis E virus infection in patients with liver damage and absence of acute viral hepatitis A, B or C from Croatia. In: 23rd ECCMID. Berlin, Germany, 27−30 April 2013.
26. Lin C.C., Wu J.C., Chang T.T., Chang W.Y., Yu M.L., Tam A.W., Wang S.C., Huang Y.H., Chang F.Y., Lee S.D. Diagnostic value of immuno-globulin G (IgG) and IgM anti-hepatitis E virus (HEV) tests based on HEV RNA in an area where hepatitis E is not endemic. // J. Clin. Micro-biol. 2000- 38(11): 3915−8.
27. Clayson E.T., Myint K.S., Snitbhan R., Vaughn D.W., Innis B.L., Chan L., Cheung P., Shrestha M.P. Viremia, fecal shedding, and IgM and IgG responses in patients with hepatitis E. J. Infect. Dis. 1995- 172(4): 927−33.
28. Чаусов Е. В., Терновой В. А., Кочнева Г. В., Святченко В. А., Сиволо-бова Г. Ф., Гражданцева А. А., Киселев Н. Н., Сахарова Е. Г., Нетесов С. В. Выявление вируса гепатита E при остром гепатите в Сибири.
Молекулярная генетика, микробиология, вирусология. 2007- (3): 36−40.
28. Chausov E.V., Ternovoi V.A., Kochneva G.V., Sviatchenko V.A., Sivo-lobova G.F., Grazhdantseva A.A., Kiselev N.N., Sakharova E.G., Netesov S.V. Detection of Hepatitis E virus in Acute Hepatitis in Siberia. Moleku-lyarnaya genetika, mikrobiologiya i virusologiya. 2007- (3): 131−6. (in Russian)
29. Guo Q.S., Yan Q., Xiong J.H., Ge S.X., Shih J.W., Ng M.H., Zhang J., Xia N.S. Prevalence of hepatitis E virus in Chinese blood donors. J. Clin. Microbiol. 2010- 48(1): 317−8. doi: 10. 1128/JCM. 1 466−09.
30. Kanai Y., Tsujikawa M., Yunoki M., Nishiyama S., Ikuta K., Hagiwara K. Long-term shedding of hepatitis E virus in the feces of pigs infected naturally, born to sows with and without maternal antibodi-es. J. Med. Virol. 2010- 82(1): 69−76.
Поступила 01. 09. 13
SEARCH FOR RNA OF THE HEPATITIS E VIRUS AUTOCHTHONOUS FOR RUSSIA IN THE MOST LIKELY INFECTION SOURCES
Voronina O. L, KundaM. S, Gudov V. P., Aksenova E. I., Shilova V. S, YaroshL. V., Elgort D. A, LuninV. G, Semenenko T. A.
Gamaleya Scientific Research Institute of Epidemiology and Microbiology, Ministry of Health of the Russian Federation, Moscow, Russia
The research carried out for 30 years from the moment of hepatitis E virus (HEV) discovery has proved the presence of the autochthonous HEV in non-endemic areas: Europe and Russia. Monitoring of the HEV antibodies (anti-HEV) among the Russian population has revealed regions with increased seroprevalence that testifies to high probability of local HEV infection in these areas. Contact with HEV can represent special danger for patients of the risk groups. In this work, the blood sera testing was carried out in order to assess the anti-HEV presence among these contingents (groups). Seropositive sera from the patients from the regions with high anti-HEV seroprevalence, risk groups patients, samples with high probability of HEV occurrence including the animals as possible reservoir, have been used for RNA extraction. The developed system of HEV RNA detection both in real-time RT-PCR and in a nested PCR variant has confirmed its sensitivity to the synthetic reference templates and positive control samples in commercial test system (Genesig, Great Britain).
HEV RNA was absent in all tested samples. This indicates a low frequency of the autochthonous HEV carriage occurrence. Sampling enlargement to tens of thousands persons is necessary for significant HEV RNA detection.
Key words: hepatitis E virus- anti-HEV IgG- anti-HEV IgM- HEVRNA
© КОЛЛЕКТИВ АВТОРОВ, 2014 УДК 578. 832. 1:578. 53]:615. 37
Киселева И. В., Ларионова Н. В., Баженова Е. А., Федорова Е. А., Дубровина И. А. ,
Исакова-Сивак И.Н., Руденко Л. Г.
роль нейраминидазы в формировании чувствительности вирусов гриппа к сывороточным ингибиторам и эффективности
РЕАССОРТАЦИИ
Отдел вирусологии ФГБУ НИИЭМ СЗО РАМН, 197 376, Санкт-Петербург, Россия
Живая гриппозная вакцина состоит из реассортантных вирусов гриппа, содержащих гемагглютинин (НА) и нейраминидазу (ЫА) от циркулирующего вируса, и 6 генов, кодирующих внутренние белки, от холодоадаптированного донора аттенюации (формула генома 6: 2). В данном исследовании описаны сложности, возникающие при получении вакцинных штаммов, в зависимости от фенотипических характеристик эпидемического вируса, использованного для реассортации. Анализ состава генома 849 реассортантных вирусов показал, что более 80% реассортантов, полученных на основе ингибитороустойчивых вирусов, унаследовали ЫА от & quot-дикого"- (эпидемического) родителя, тогда как среди реассор-тантов на основе ингибиторочувствительных вирусов их число не превышало 26%. При этом наибольший процент реассортантов с вакцинной формулой генома удавалось получить в случаях, когда & quot-дикий"- родитель был устойчив к неспецифическим ингибиторам нормальной сыворотки крови. Мы показали, что ЫА может играть роль в чувствительности вируса к неспецифическим сывороточным ингибиторам. Замена Ы А ингибиторочувствительного & quot-дикого"- вируса на ЫА ингибитороустойчивого донора аттенюации значительно снижала чувствительность полученных реассортантов к термостабильным сывороточным ингибиторам.
Ключевые слова: вирус гриппа- живая гриппозная вакцина- нейраминидаза- сывороточные ингибиторы- реассортация.
Живая гриппозная вакцина (ЖГВ) состоит из реассортантных вирусов, полученных при скрещивании «дикого» ^Т) вируса и холодоадаптированного (ХА) донора аттенюации и содержащих гемагглютинин (НА) и нейраминидазу (ЫА) от WT вируса гриппа, а остальные 6 сегментов генома — от ХА донора (формула генома 6: 2). Успех получения вакцинных реассортантов зависит от комплекса факторов, включающих фенотипические свойства WT родительского вируса. В настоящем исследовании мы проанализировали 849 реассортантов WT-вирусов с ХА-донорами аттенюации и описали некоторые аспекты сложностей подготовки кандидатов в ЖГВ, в частности проблемы при использовании
WT-вирусов гриппа, чувствительных к неспецифическим термостабильным ингибиторам сыворотки крови, и выявили возможную роль NA в формировании этого признака.
Материалы и методы
Вирусы. В работе использованы 42 вируса гриппа типа, А и В: 1) «дикие» вирусы гриппа, полученные из Центра по контролю за заболеваемостью (CDC, Atlanta, GA, USA) — 2) реассортантные вакцинные штаммы для парентерально вводимой инактивиро-ванной вакцины подтипа H5N1 (NIBRG-23, INDO/05, VN1203) на основе донора «высокой урожайности» A/PR/8/34 (H1N1) (PR8), полученные из CDC и Всемирной организации здравоохранения (ВОЗ). PR8-реассортанты были подготовлены методом обратной генетики с использованием в качестве источников антигенных детерминант H5N1 штаммов А/индюк/Турция/1/05, А/Индонезия/5/05, А/Вьетнам/1203/2004 соответственно. Для снижения патогенности сайтрасщепления НА0 предшественника гемагглютинина был при этом модифицирован путем удаления триплетов, кодирующих 4 основные аминокислоты- 3) ХА-доноры аттенюации, А/Ленинград/134/17/57 (H2N2) (Л17) и В/ СССР/60/69 (В60), используемые для подготовки отечественной ЖГВ и являющиеся собственностью ФГБУ НИИЭМ СЗО РАМН (Санкт-Петербург, Россия).
Вирусы поддерживали путем пассажей в 10−11-дневных развивающихся куриных эмбрионах при температуре 32−33°C.
Получение реассортантов осуществляли по стандартной методике [1] в присутствии поликлональной кроличьей или крысиной антисыворотки к донорам аттенюации.
Выделение РНК. РНК выделяли из вируссодержащей аллан-тоисной жидкости с использованием набора QIAamp Viral RNA minikit по инструкции производителя («Qiagen GmbH Hilden», Germany).
Анализ состава генома реассортантов. Происхождение сегментов РНК реассортантов определяли с использованием ре-стрикционного анализа (RFLP) [2], или методом микс-ПЦР [3]. Секвенирование осуществляли с использованием набора BigDye

ПоказатьСвернуть
Заполнить форму текущей работой