Ассоциации полиморфизмов генов GSTM1 (del) , GSTP1 (Ile105Val) и курения в семье c врожденными пороками развития

Тип работы:
Реферат
Предмет:
Медицина


Узнать стоимость

Детальная информация о работе

Выдержка из работы


экологическая генетика человека
© и. В. Шаталина1, ю. В. Гареева 2,
Л. А. Гордеева1, Е. Н. Воронина3, И. М. Сутулина4, М. Л. Филипенко 3
1 ФГБУН Институт экологии человека СО РАН, Кемерово-
2 МБУЗ ГКБ № 3 им. М. А. Под-горбунского, Родильный дом № 1, Кемерово-
3 ФГБУН Институт химической биологии и фундаментальной медицины СО РАН, Новосибирск-
4 ГБОУ ВПО КемГМА МЗ РФ, Кемерово
Изучали ассоциации полиморфизмов генов GSTM1 (del), GSTP1 (Ile105Val) и курения в семье c врожденными пороками развития (ВПР) у новорожденного ребенка. Выявили, что сами полиморфизмы генов GSTM1 (del) и GSTP1 (Ile105Val) не ассоциированы с риском ВПР у новорожденного. Однако курение в семье может повышать рисковую значимость генотипов GSTP1 (Ile105Val) в формировании ВПР у ребенка.
C Ключевые слова: врожденный порок развития- гены детоксикации ксенобиотиков- GSTM1- GSTP1.
УДК 575. 174. 015. 3, 616−007−053. 1
ассоциации полиморфизмов генов
GSTM1 (DEL), GSTP1 (ile105val) и курения в семье c врожденными пороками развития
ВВЕДЕНИЕ
Известно, что более половины врожденных пороков развития (ВПР) возникают вследствие воздействия внешне-средовых и эндогенных факторов. Широкая распространенность курения среди населения, особенно среди женщин детородного возраста, не только отрицательно отражается на качестве собственного здоровья, но и на здоровье своего потомства.
В организме человека продукты табачного дыма метаболизируются с помощью ферментной системы детоксикации ксенобиотиков, функциональная недостаточность которой способствует накоплению не выведенных из организма токсичных веществ, определяющих, в свою очередь, канцеро- или тератогенный эффект (Obolenskaya et al., 2004). Во время беременности ферментная система детоксикации ксенобиотиков приобретает трехуровневый характер, функционируя в материнско-плацентарно-плодовом компартмен-те. Наиболее «слабым звеном» является плод из-за отсутствия или низкой экспрессии у него большинства ферментов детоксикации (Сокова, 2008).
Семейство ферментов глутатион^-трансфераз (GST) отвечает за деток-сикацию реактивных электрофильных метаболитов мутагенов и канцерогенов, образующихся в результате процессов окисления микросомальными ферментами цитохрома P450, и выведении этих комплексов из организма (Гуляева с соавт., 2000). Установлено, что в неонатальном периоде (начиная с 8-й недели гестации) из всех ферментов GST экспрессируются только ферменты GSTA, GSTM и GSTP1 (Сокова, 2008). Функциональная активность ферментов GST контролируется генами, для которых характерен генетический полиморфизм.
У людей отсутствие функциональной активности ферментов GSTM1 связано с обширной делецией в соответствующем гене (генотип «0/0») (Hayesetal., 2005). Ген GSTP1 имеет несколько вариантов, но более функционально значимой является нуклеотидная замена A & gt- G в 5-м экзоне гена, которая приводит к замене аминокислоты изолейцина на валин в 105-м кодоне (105 Ile Val). Эта мутация значительно снижает активность фермента GSTP1 (Ступко с соавт., 2011). Ассоциации полиморфизмов генов GSTM1 (del) и GSTP1 (Ile105Val) c ВПР активно изучаются, но обнаруженные результаты далеко неоднозначны. В связи с этим целью настоящего исследования стало изучение ассоциаций полиморфизмов генов GSTM1 (del), GSTP1 (Ile105Val) и курения в семье c ВПР у новорожденного ребенка.
МАТЕРИАЛЫ И МЕТОДЫ
Выборки. Обследованы образцы ДНК 219 детей, родившихся при сроке гестации 35 недель и более (доношенные и недоношенные I степени), с массой тела более 2000 г. Все обследуемые дети принадлежали к русской этнической группе.
В основную группу были включены образцы ДНК 94 новорожденных детей с диагнозом врожденный порок развития (группа ВПР). Постановка Поступила в редакцию 08. 10. 2014 клинического диагноза проводилась врачами-неонатологами в соответствии
Принята к публикации 21. 11. 2014 с МКБ-10 ^0099) (Международная классификация болезней…).
Таблица 1
распределение детей по подгруппам в зависимости от врожденного порка развития
№ Подгруппа N (%) Врожденная аномалия
1 ССС 28 (29,8) Дефект межжелудочковой и/или предсердной перегородки, аномалии магистральных сосудов, тетрада Фалло
2 МВПР 20 (21,3) Сочетание 2, 3 видов врожденных аномалий
3 МВС 17 (18,1) Врожденный гидронефроз, дисплазия почек (одно/двух сторонняя) пиело-эктазия, поликистоз почек
4 КМС 10 (10,6) Полидактилия, укорочение трубчатых костей, нарушение развития передней брюшной стенки
5 ПС 8 (8,5) Атрезия пищевода, гастрошизис и др. аномалии развития желудочно-кишечного тракта
6 ЦНС 5 (5,3) Гипоплазия мозолистого тела, мозжечка, микроцефалия
7 ВПР губы и/или неба 4 (4,2) Расщелина неба, расщелина верхней губы, расщелина губы и неба ^3537)
8 ПО 2 (2,1) Кистозная аномалия развития яичника, гипоспадия
Здесь и далее N — количество обследованных в группах- ССС — сердечнососудистая система (Q20-Q28) — МВПР — множественные врожденные пороки развития- МВС — мочевыделительная система ^6064) — КМС — костно-мышечная система (Q65-Q79) — ПС — пищеварительная система (Q38-Q45) — ЦНС — центральная нервная система (Q00-Q07) — ПО — врожденные аномалии развития половых органов ^50−56)
Структура ВПР представлена в таблице 1. Критерием исключения являлись пороки, ассоциированные с хромосомными аномалиями (синдром Дауна и др.), установленными во время беременности.
В группу сравнения (контроль) вошли образцы ДНК 125 новорожденных детей без ВПР.
Одновременно проведено анкетирование матерей детей из обеих групп, анализ историй родов и историй развития новорожденных. Влияние фактора курения анализировали на основании имеющейся информации о курении в семье, которое оценивали как курение одного из родителей или обоих родителей. В группе ВПР курение в семье отмечалось в 63,8% случаев, а в контрольной группе — 52,9% случаев.
Работу проводили с соблюдением принципов добровольности и конфиденциальности в соответствии с требованиями 9 федерального закона от 27. 07. 06 г. «О персональных данных» № 152−53.
Генотипирование. Выделение ДНК из лимфоцитов пуповинной крови проводили с помощью метода фенол-хлороформной экстракции с последующим осаждением этанолом, образцы ДНК хранили при -20 °C.
Типирование генов GSTM1 (del) проводили методом Real-timePCR с интеркалирующим флуоресцентным красителем SYBRGreenI и анализом кривых плавления. Каждый образец амплифицировали с использованием пары специфических праймеров для GSTM1: 5 '-GGTCAAGGACATCATAGACGAGAA3'- (прямой) и 5CTCAGGAGAAACTGAAGCCAAA3'- (обратный) и внутреннего положительного контроля, в качестве которого использовали легкоплавкий A/T-богатый некодирующий фрагмент генома, условно обозначаемый как LTM (low temperature melting): 5'-TGGGTGCTAGAGGTATAATCG3'-
(прямой) и 5TTAGAGGAAGCTGGGTAAGAG3'- (обратный). Размеры амплифицируемых фрагментов GSTM1 — 229 пар оснований, LTM — 127 пар оснований, расчетная температура отжига всех праймеров составляла 64−66 °C, ожидаемая температура плавления продуктов амплификации — GSTM1 — 86,5 °C, LTM — 78,5 °C. Общий объем реакционной смеси составлял 25 мкл, смесь содержала: 40−100 нг ДНК- 65 mM Tris-HCl (pH8,9) — 0,05% Tween 20- 16 mM (NH4)2SO4- 2,4 mM MgCl2- 0,2 mM dNTP, 0,3 mkM растворы оли-гонуклеотидных праймеров- 0,8XSYBRGreenI- 0,5 ед. ак. термостабильной Taq-полимеразы. Отсутствие флуоресцентного сигнала указывало на гомозиготность индивидуума по делеции гена («0/0»), наличие — на носительство «положительного» генотипа («+ «), несущего функциональный аллель в гомо- или гетерозиготном состоянии.
Типирование нуклеотидной замены 1404A & gt- G (Ile105Val) гена GSTP1 (rs1695) проводили методом Real-time ПЦР с использованием технологии конкурирующих TaqMan-зондов. Каждый образец амплифициро-вался с использованием пары специфических праймеров и двух зондов, (5'--GATGCTCACATAGTTGGTGTAG-3'- (прямой) и 5'-- GGTGGACATGGTGAATGAC-3'- (обратный) — 5'--FAM-CTGCAAATACATCTCCCTCAT-BHQ — 3'- и 5'--R6G-CGCAAATACGTCTCCCTCAT-BHQ-3'-). Общий объем реакционной смеси составлял 25 мкл, смесь содержала 40−100 нг ДНК- 300 нМ каждого праймера- по 100 — 200 нМ Taqman-зондов, коньюгированных с FAM или R6G- 200 мкМ-ные dNTP, амплификацион-ный буфер, термостабильную Taq-полимеразу — 0,5 ед. акт. /реакц.
Реакции амплификации проводили с помощью амп-лификатораCFX-96 (Bio-Rad, США).
Таблица 2
Распределение частот аллелей и генотипов полиморфных вариантов генов GSTM1 (del) и GSTP1 (Ile105Val) у детей с ВПР и в контрольной группе
Генотип Группа X2- P-value
GSTM1 Контроль N = 126 ВПР N = 94
«+ «65 (51,6%) 43 (45,8%) 0,52- df = 1- 0,47
«0/0» 61 (44,8%) 51 (54,2%)
GSTP1 N = 125 N = 94
Val/Val 14 (11,2%) 12 (12,8%) 1,52- df = 2- 0,46
Ile/Val 42 (33,6%) 38 (40,4%)
Ile/Ile 72 (55,2%) 44 (46,8%)
Аллели N = 250 N = 188 1,03- df=1- 0,29
Val 70 (28,0%) 62 (33,0%)
Ile 180 (72,0%) 126 (67,0%)
Статистическая обработка данных. Соответствие частот генотипов гена GSTP1 (Ile105Val)paBHOBe-сию Харди-Вайнберга проверяли по критерию х2. Вычисление проводили с помощью программы De Finetti на сайте Института генетики человека (Tests for deviation…) В этом случае и при использовании других критериев нулевую гипотезу отвергали при P & lt- 0,05.
Попарное сравнение частот аллелей и генотипов GSTM1 (del) и GSTP1 (Ile105Val) проводили с помощью двустороннего точного теста Фишера и критерия х2. Результаты обсуждали при наличии тенденции отличий между выборками при 0,05 & lt- P & lt- 0,1.
Силу ассоциации анализируемых признаков определяли с помощью величины отношения шансов (OR). Для OR рассчитывали доверительный интервал (CI) при 95%-м уровне значимости. OR, рассчитанные сопоставлением частот генотипов GST в курящих семьях с ВПР у ребенка и в семьях с условно здоровым ребенком, или, наоборот, рассчитанные только, для некурящих семей с ВПР у ребенка и семей с условно здоровым ребенком, показывают влияние генотипа (ORg) на риск возникновения ВПР у ребенка, но в разных условиях окружающей среды. OR, рассчитанные путем сопоставления частот генотипов GSTв курящих семьях с ВПР у ребенка и в некурящих семьях с условно здоровым ребенком, учитывают взаимодействие генетического признака и внешнего фактора (ORg + f). Если влияние этих факторов однонаправлено, то величина ORg + f будет выше, чем ORg для некурящих. Если же влияние этих факторов разнонаправлено, то ORg + f будет ниже (Вавилин с со-авт., 2000).
РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ
При изучении распределения частот генотипов GSTM1 (del) у детей с ВПР и детей контрольной группы было обнаружено, что гомозиготный по делеции генотип «0/0» гена GSTM1 равновероятно встречался в обеих группах
(51 и 53% соответственно, P = 0,47). Данные представлены в таблице 2. Частота этого генотипа была сопоставима с таковой у их матерей (Gordeeva et al., 2013) и с данными литературы относительно его распределения у лиц европеоидного происхождения (Garte et al., 2001).
Ранее выявлены ассоциации генотипа «0/0» гена GSTM1 с атрезией пищевода (Filonzi et al., 2010), с расщелиной неба (Shaw et al., 2003) и врожденными аномалиями ЦНС (Morales et al., 2009) у детей. Расхождение наших данных с данными литературы можно объяснить особенностями частот этих видов ВПР в нашей выборке детей, где лидировали такие виды, как ВПР ССС, МВПР и ВПР МВС, тогда как вышеуказанные пороки являлись относительно редкими (n & lt- 10) и это обстоятельство не позволило нам провести сравнение.
Изучение распределения частот аллелей и генотипов GSTP1 (Ile105Val) в исследуемых группах показало отсутствие отличий между наблюдаемыми и ожидаемыми частотами при равновесии Харди-Вайнберга (данные не показаны, P & gt- 0,05).
Сравнение частот аллелей и генотипов GSTP1 (Ile105Val) в группах детей с ВПР и условно здоровыми детьми (табл. 2) не выявило статистически значимых отличий между этими группами (P = 0,29 для аллелей и P = 0,46 для генотипов). В то же время их характер распределения был сопоставим с таковым у их матерей (Gordeeva et al., 2013) и c данными итальянских исследователей (Cresci et al., 2011), но отличался от результатов американских исследователей (Ramirez et al., 2007), что можно объяснить особенностями распределения частот генотипов гена GSTP1 (Ile105Val) у разных этносов. Кроме того, наши результаты согласуются с результатами других авторов, где также не подтверждены ассоциации полиморфизма GSTP1 (Ile105Val) с ВПР ССС и расщелиной губы и/или неба у детей (Cresci et al., 2013- Ramirez et al., 2007).
Ранее выявлено, что курение в семье (одного или обоих родителей) может быть ассоциировано с аллергическими реакциями органов дыхания у детей — но-
Таблица 3
Ассоциации генотипов GST (локусов М1 и P1) и курения в семье с ВПР у ребенка
Генотип ребенка Курение в семье (+) Отсутствие курения в семье (-) ORg (+) (CI: 95%) °rg (-) (CI: 95%) OR (g+f) (CI: 95%)
GSTM1 Контроль N = 68 ВПР N = 71 Контроль N = 34 ВПР N=17
«+ «32 (47,0%) 35 (49,0%) 19 (55,9%) 7 (41,2%)
«0/0» 36 (53,0%) 36 (51,0%) 15 (44,1%) 10 (58,8%) 0,91 (0,46−1,77) 1,8 (0,55−5,88) 1,3 (0,57−2,96)
X2- P-value 0,07- df = 1- 0,86 0,98- df = 1- 0,38 ВПР (+) /контроль (-): 0,40- df = 1- 0,54
GSTP1 N = 67 N = 71 N = 33 N = 17 ORg (+) (CI: 95%) Or () g (-) (CI: 95%) OR (g+f) (CI: 95%)
Val/Val 12 (15,6%) 7 (9,8%) 1 (3,0%) 3 (17,6%) 0,50 (0,18−1,36) 6,85 (0,65−71,81) 3,5 (0,41−29,68)
Ile/Val 21 (27,3%) 35 (49,3%) 9 (27,3%) 1 (5,9%) 2,12 (1,06−4,26) 0,16 (0,02−1,44) 2,59 (1,05−6,35)
Ile/Ile 34 (57,1%) 29 (40,9%) 23 (69,7%) 13 (75,5%) 0,67 (0,34−1,31) 1,41 (0,36−5,41) 0,30 (0,12−0,72)
X2- P-value 5,10- df = 2- 0,07 5,63- df = 2- 0,05 ВПР (+) /контроль (-): 7,69- df = 2- 0,02
сителей делеционных генотипов GSTM1 и GSTT1 (Ва-вилин с соавт., 2000). Также обнаружено, что у детей с сочетанием «0/0» генотипов GSTM1 и GSTT1 риск развития ВПР ССС был значительно выше, когда оба родителя подвергались токсическому воздействию факторов окружающей среды (Cresci et al., 2011). В связи с этим мы предположили, что курение в семье и полиморфизмы генов GST локусов M1 и P1 могут быть ассоциированы с риском ВПР.
Наше исследование показало, что совместно курение в семье и полиморфизм гена GSTM1 (del) у ребенка не ассоциированы с риском ВПР. Для генотипа GSTM1"0/0» величины ORg в группах курящих и некурящих семей значимо не отличались (табл. 3). Иная ситуация была найдена в отношении курения и полиморфизма GSTP1 (Ile105Val) у детей.
В группе курящих семей частоты генотипов GSTP1 (Ile105Val) у детей с ВПР и условно здоровых детей статистически значимо не отличались друг от друга (P = 0,07). Однако у детей гетерозиготный генотип Ile/Val был ассоциирован с двукратным риском ВПР (ORg = 2,12- 95%CI: 1,06−4,26).
В группе некурящих семей частоты генотипов GSTP1 (Ile105Val) у детей с ВПР и условно здоровых детей были сопоставимыми (P = 0,05). Ассоциации этих генотипов с риском ВПР также отсутствовали.
При сравнении частот генотипов гена GSTP1 (Ile105Val) у детей с ВПР в курящих семьях с таковыми у условно здоровых детей в некурящих семьях были выявлены статистически значимые различия между ними (P = 0,02). При этом генотип Ile/Val у детей был ассоциирован с риском ВПР (ORg+f = 2,59- 95%CI: 1,05−6,35), тогда как гомозиготный генотип Ile/Ile у де-
тей был ассоциирован с протективным эффектом к ВПР (ORg+f = 0,30- 95%CI: 0,12−0,72). Возможно, что курение в семье может модифицировать рисковую значимость генотипов гена GSTP1 (Ile105Val) в формировании ВПР у ребенка.
Ранее установлено, что из всех изоформ ферментов GST только ферменты GSTP1 имели функциональную активность в тканях эмбриона и плода (Raijmakers et al., 2001), поэтому выявленные ассоциации полиморфизма гена GSTP1 (Ile105Val) и курения в семье представляют особый интерес. Совместный эффект курения в семье и гетерозиготного генотипа Ile/Val гена GSTP1 (Ile105Val) на риск ВПР у ребенка мало понятен. Возможно, выявленная ассоциация может быть обусловлена небольшим количеством обследованных детей, в результате чего ассоциации гомозиготного генотипа Val/Val не достигали статистической значимости.
Известно, что полиморфизм гена GSTP1 (Ile105Val) имеет неравновесие по сцеплению с другим полиморфизмом — GSTP1 (Ala114Val). В связи с этим описано 4 алле-ля гена GSTP1: А — Ile105/Ala114, B — Val105/Ala114, C — Val105/Val114 и D — Ile105/Val114. Аллель, А считается нормальным, а мутантные В, С и D кодируют функционально менее активные формы фермента (активность снижена в 3−4 раза) (Ступко с соавт., 2011). Возможно, дополнительное типирование полиморфизма GSTP1 (Ala114Val) с подсчетом гаплотипов позволит сделать более обоснованные выводы относительно совместного эффекта курения в семье и полиморфных вариантов гена GSTP1 на риск возникновения ВПР у ребенка.
Таким образом, наше исследование показало, что сами полиморфизмы генов GSTM1 (del) и GSTP1 (Ile105Val) не ассоциированы с риском ВПР у новорож-
денного. Однако курение в семье может увеличивать рисковую значимость генотипов полиморфизма гена GSTP1 (Ile105Val) в формировании ВПР у ребенка. Для более полного понимания выявленных ассоциаций генотипов GSTP1 (Ile105Val) и курения в семье требуется продолжение исследования.
ЛИТЕРАТУРА
1. Вавилин В. А., Часовникова О. Б, Ляхович В. В. с соавт. (2000) Генетический полиморфизм глутати-он^-трансферазыМ1 и T1 у детей, больных бронхиальной астмой. Вопросы медицинской химии. № 4: C. 388−397.
2. Гуляева Л. Ф., Вавилин В. А., Ляхович В. В. (2000) Ферменты биотрансформации ксенобиотиков в химическом канцерогенезе. Новосибирск: серия «Экология». 85 с.
3. МКБ 10 — Международная классификация болезней 10-го пересмотра UIRL: http: //mkb-10. com/.
4. Сокова Е. А. (2008) Особенности системы биотрансформации лекарственных средств в фетоплацентар-ном комплексе. Биомедицина. № 1: С. 14−25.
5. Ступко Е. Е., Шенин В. А., Колесникова Л. И. с соавт. (2011) Роль полиморфизмов генов детоксика-ции ксенобиотиков в развитии миомы матки и эн-дометриоза. Сибирский медицинский журнал. № 5: С. 5−8.
6. Cresci M., Foffa I., Ait-Ali L. et al. (2011) Maternaland Paternal Environmental Risk Factors, Metabolizing GSTM1 and GSTT1 Polymorphisms, and Congenital Heart Disease. Am. J. Cardiol. V. 108: P. 1625−1631.
7. Cresci M., Foffa I., Ait-Ali L. et al. (2013) Maternal and Paternal Environmental Risk Factors, Metabolizing GSTM1 and GSTT1 Polymorphisms, and Congenital Heart Disease. Pediatr. Cardiol. V. 34 (2). P. 281−285.
8. Filonzi L., Magnani C., de'- Angelis G. L. et al. (2010) Evidence That Polymorphic Deletion of the Glutathione S-Transferase Gene, GSTM1, is Associated with Esophageal Atresia. Birth Defects Research (Part A). V. 88: P. 743−747.
9. Garte S., Gaspari L., Alexandrie A. -K. et al. (2001) Metabolic Gene Polymorphism Frequencies in Control Populations. Cancer Epidemiol. Biomarkers, Prev. V. 10: P. 1239−1248.
10. Gordeeva L. A., Voronina E. N., Sokolova E. A. et al. (2013) Association GSTT1, GSTM1 and GSTP1 (Il-e105Val) genetic polymorphisms in mothers with risk of congenital malformations in their children in Western Siberia: a case-control study. Prenatal Diagnosis. V. 33 (11): P. 1095−101.
11. Hayes J. D., Flanagan J. U., Jowsey I. R. (2005) Glutathione Transferases. Ann. Rev. Pharmacol. Toxicol. V. 45: P. 51−88.
12. Morales E., Sunyer J., Julvez J. et al. (2009) GSTM1 polymorphisms modify the effect of maternal smoking during pregnancy on cognitive functioning in preschoolers. Int. J. Epidemiol. V. 38 (3): P. 690−697.
13. Obolenskaya M., Teplyuk N., Sasonova L. et al. (2004) Glutathionetransferase activity and PAH-DNA ad-ducts in human placenta as a risk factor for newborn in radioactively contaminated regions. International Journal of Radiation Medicine. V. 6 (1−4): P. 154−166.
14. Raijmakers M. T., Steegers E. A., Peters W H. (2001). Glutathione S-transferases and thiol concentrations in embryonic and early fetal tissues. Hum Rep. V 16: P 2445−2450.
15. Ramirez D., Lammer E. J., Iovannisci D. M. et al. (2007) Maternal Smoking During Early Pregnancy, GSTP1 and EPHX1 Variants, and Risk of Isolated Orofacial Clefts. Cleft Palate-Craniofacial Journal. V. 44 (4): P 366−373.
16. Shaw G. M., Nelson V, Iovannisci D. M. et al. (2003) Maternal Occupational Chemical Exposures and Biotransformation Genotypes as Risk Factors for Selected Congenital Anomalies. Am. J. Epidemiol. V 157: P 475−484.
17. Tests for deviation from Hardy-Weinberg equilibrium and tests for association. Cited 08. 09. 2014. URL: http: //ihg. gsf. de/cgi-bin/hw/hwa1. pl.
ASSOCIATION OF GSTM1 (DEL), GSTP1 (ILE105VAL) GENETIC POLYMORPHISMS AND SMOKING IN THE FAMILY WITH CONGENITAL MALFORMATIONS
Shatalina I. V., Gareeva Yu. V., Gordeeva L. A., Voronina E. N, Sutulina I. M., Filipenko M. L.
C SUMMARY: Background. The association of GSTM1 (del) and GSTP1 (Ile105Val) polymorphisms with congenital malformations (CMs) actively studied. However, the results of various studies are conflicting. This study aims to investigate the association of GSTM1 (del), GSTP1 (Ile105Val) genetic polymorphisms and smoking in the family with congenital malformations in the newborn. Method. We studied 94 newborn with CMs and 125 healthy newborn. Null genotype of GSTM1 was identified through multiplex real-time PCR, and GSTP1 gene (Ile105Val) polymorphism was determined through TaqMan-real-time PCR. Results. The study showed that polymorphic loci of GSTM1 (del) and GSTP1 (Ile105Val) genes were not associated with the risk of congenital malformations in the newborn (P = 0,46 and P = 0,47). When comparing the frequencies of genotypes the GSTP1 (Ile105Val) gene in newborn with CMs in the families of smokers with those of healthy newborn in non-smoking families statistically significant differences between them were found (P = 0,02). The genotype Ile/Val in children was associated with CMs (ORg + f = 2,59- 95% CI: 1,05−6,35), while the homozygous genotype Ile/Ile in newborn was associated with a protective effect to CMs (ORg + f = 0,30- 95% CI: 0,120,72). Possibly, the association of the homozygous genotype Val/Val did not reach statistical significance due to a small number of children surveyed. Conclusion. The smoking in the family increases the risk of CMs in the newborn with genotypes of GSTP1 gene (Ile105Val) polymorphism.
C KEY WORDS: congenital malformation- genes of xenobiotics detoxi-cation- GSTM1- GSTP1.
C REFERENCES (TRANSLITERATED)
1. Cresci M., Foffa I., Ait-Ali L. et al. (2011) Am. J. Cardiol. V. 108: P. 1625−1631.
2. Cresci M., Foffa I., Ait-Ali L. et al. (2013) Pediatr. Cardiol. V. 34 (2): P. 281−285.
3. Filonzi L., Magnani C., de'-Angelis G. L. et al. (2010) Birth Defects Research (Part A). V. 88: P. 743−747.
4. Garte S., Gaspari L., Alexandrie A. -K. et al. (2001) Cancer Epidemiol. Biomarkers, Prev. V. 10: P. 1239−1248.
5. Gordeeva L. A., Voronina E. N., Sokolova E. A. et al. (2013) Prenatal Diagnosis. V. 33 (11): P. 1095−101
6. Gulyaeva L. F., Vavilin V. A., Lyakhovich V. V. (2000). Fermenty biotransformatsii ksenobiotikov v khimi-cheskom kantserogeneze [Xenobiotic biotransformation enzymes in chemical cancerogenesis]. Novosibirsk: series & quot-Ecology"-, 85 p.
7. Hayes J. D., Flanagan J. U., Jowsey I. R. (2005) Ann. Rev. Pharmacol. Toxicol. V. 45: P. 51−88.
8. MKB 10 — Mezhdunarodnaya klassifikatsiya bolezney 10-go peresmotra [International classification of diseases 10th revision] UIRL: http: //mkb-10. com/.
9. Morales E., Sunyer J., Julvez J. et al. (2009) Int. J. Epidemiol. V. 38 (3). P. 690−697.
10. Obolenskaya M., Teplyuk N., Sasonova L. et al. (2004) International Journal of Radiation Medicine. V. 6 (1−4). P. 154−166.
11. Raijmakers M. T., Steegers E. A., Peters W H. (2001) Hum Reprod. V. 16. P. 2445−2450.
12. Ramirez D., Lammer E. J., Iovannisci D. M. et al. (2007) Cleft Palate-Craniofacial J. V 44 (4). P. 366−373.
13. Shaw G. M., Nelson V., Iovannisci D. M., et al. (2003) Am. J. Epidemiol. V. 157. P. 475−484.
14. Sokova E. A. (2008) Osobennosti sistemy biotransformatsii lekarstvennykh sredstv v fetoplatsentarnom komplekse [Particularities of human grud-metabolizing system in fetoplacental complex]. Biomedicine. N 1. P. 14−25.
15. Stupko E. E., Shenin V. A., Kolesnikova L. I., LabyginaA. V., Suturina L. V. (2011) Rol'- polimorfiz-mov genov detoksikatsii ksenobiotikov v razvitii miomy matki i ehndometrioza [The role of polymorphisms genes of detoxification of xenobiotics in the development of endometriosis and hysteromyoma in women]. Siberian Journal of Medical. 2011. V. 104 (5). P. 5−8.
16. Tests for deviation from Hardy-Weinberg equilibrium and tests for association. Cited 08. 09. 2014. URL: http: //ihg. gsf. de/cgi-bin/hw/hwa1. pl.
17. Vavilin V. A., Chasovnikova O. B, Lyakhovich V. V., Govalov S. M., Ryabova O. A. (2000) Geneticheskij polimorfizm glutation-S-transferazy M1 i T1 u detej, bol'-nyh bronhial'-noj astmoj [Genetic polymorphisms of glutathione S-transferase M1 and T1 in asthmatic childrens]. Issues of Medical Chemistry. V. 46 (4). P. 388−397.
C Информация об авторах
Шаталина Ирина Викторовна — инженер-биолог. Лаборатория иммуногенетики. Институт Экологии человека СО РАН. 650 002, Кемерово, Ленинградский пр-т, д. 10. E-mail: irina_ve@mail. ru.
Гареева Юлия Валериевна — врач неонатолог. МБУЗ ГКБ № 3 им. М. А. Подгорбунского. 650 099, Кемерово, ул. Н. Островского, д. 22. E-mail: gareeva. j@bk. ru.
Гордеева Людмила Александровна — к. б. н., зав. лабораторией иммуногенетики. Институт Экологии человека СО РАН. 650 002, Кемерово, Ленинградский пр-т, д. 10. E-mail: gorsib@rambler. ru.
Воронина Елена Николаевна — к. б. н., м. н. с. Лаборатория фарма-когеномики. Институт химической биологии и фундаментальной медицины СО РАН. 630 090, Новосибирск, пр-т Академика М. А. Лаврентьева, д. 8. E-mail: voronina_l@inbox. ru. Сутулина Ирина Михайловна — к. м. н. Кафедра факультетской педиатрии. ГБОУ ВПО КемГМА МЗ РФ. 650 056, Кемерово, ул. Ворошилова, д. 22а. E-mail: sutulinaim@rambler. ru.
Филипенко Максим Леонидович — к. б. н. Заведующий лабораторией фармакогеномики. Институт химической биологии и фундаментальной медицины СО РАН. 630 090, Новосибирск, пр-т Академика М. А. Лаврентьева, д. 8. E-mail: max@niboch. nsc. ru.
Shatalina Irina Viktorovna — biological engineer. Lab. of immunoge-netics. Institute of Human Ecology of the Siberian Branch of the RAS. 650 002, Kemerovo, Leningradskiy prospekt, 10. E-mail: irina_ve@mail. ru.
Gareeva Yuliya Valerievna — neonatologist. M. A. Podgorbunskiy municipal clinical hospital N 3. 650 099, Kemerovo, N. Ostrovskogo St., 22. E-mail: gareeva. j@bk. ru.
Gordeeva Lyudmila Aleksandrovna — candidate of biological sciences. Head of Laboratory immunogenetics. Institute of Human Ecology of the Siberian Branch of the RAS. 650 002, Kemerovo, Leningradskiy prospekt, 10. E-mail: gorsib@rambler. ru.
Voronina Elena Nikolaevna — candidate of biological sciences, jounior researcher. Laboratory of pharmacogenomics. Institute of Chemical Biology and Fundamental Medicine SB RAS. 630 090, Novosibirsk, prospekt Akademika M. A. Lavrent'-yeva, 10. E-mail: voronina_l@inbox. ru. Sutulina Irina Mikhaylovna — candidate of medical sciences. Dept. of Faculty Pediatrics. Kemerover State Medical Academy (KemSMA). 650 056, Kemerovo, Voroshilova St., 22a. E-mail: sutulinaim@rambler. ru.
Filipenko Maksim Leonidovich — candidate of biological sciences, Head of Laboratory pharmacogenomics. Institute of Chemical Biology and Fundamental Medicine SB RAS. 630 090, Novosibirsk, prospekt Akademika M. A. Lavrent'-yeva, 10. E-mail: max@niboch. nsc. ru.

ПоказатьСвернуть
Заполнить форму текущей работой