Интроны в гене 18S рРНК зоохлорелл, симбионтов Paramecium bursaria, и перспективы их использования в систематике

Тип работы:
Реферат
Предмет:
Биология


Узнать стоимость

Детальная информация о работе

Выдержка из работы

УДК 576. 858 Вестник СПбГУ. Сер. 3, 2006, вып. 4
К. В. Воробьев, А. В. Мигунова, Е. П. Чижевская, Е. Е. Андронов, К. В, Квитко
ИНТРОНЫ В ГЕНЕ 18S РРНК ЗООХЛОРЕЛЛ, СИМБИОНТОВ PARAMECIUM BURSARIA, И ПЕРСПЕКТИВЫ ИХ ИСПОЛЬЗОВАНИЯ В СИСТЕМАТИКЕ*
Интроны, не кодирующие, но способные к самовырезанию (сплайсингу после считывания РНК), вставки в гены эукариот, вначале рассматривали как «эгоистичную ДНК», как хлам, накопленный во времени существования таксона. Затем было показано, что эти генетические мобильные элементы осуществляют, по меньшей мере, 6 функций [15]: могут быть источниками некодирующей РНК, носителями регуляционных элементов транскрипции, усилителями рекомбинации внутри гена, отвечать за осуществление альтернативного и транс-сплайсинга, быть пространством для перетасовки экзонов, сигналами для экспорта мРНК из ядра в цитоплазму. Интроны можно рассматривать с позиций двух теорий. Одна из них — «Intron early» — исходит из того, что интроны существовали изначально, но были утрачены, например, у прокариот. Другая -- «Intron late theory» — исходит из предположения, что интроны приобретены в эволюции позднее как вставки в гены эукариот [14].
Объектом нашего научного интереса является тройная симбиотическая система Paramecium bursaria — Chlorella — вирус PBCV-1 [3−8, И, 24]. По ряду физиологических, биохимических и других признаков было выявлено необычное единообразие в группах зоохлорелл [21, 22, 25]. В 1996—1999 гг. мы разработали экологическую классификацию этих водорослей [23, 24, 27, 28]. Предложено разделить вирусочувствительных симбионтов и их хозяев Р. bursaria на два экотипа — северный и южный [8−10, 23]. Нами было показано, что зоохлореллы, принадлежащие к различным экотипам, различаются по количеству и локализации интронов в гене 18S рРНК, что является предпосылкой для разработки методов идентификации симбиотических хлорелл [1−3, 16].
Изучение разнообразия структуры гена 7#5рРНК у водорослей р. Chlorella имеет большое значение. Это связано с тем, что у большинства высших организмов, как правило, интронно-экзонная структура генов весьма консервативна даже в пределах рода. Напротив, у хлорелл количество, локализация и нуклеотидная последовательность интронов в гене 18S рРНК широко варьирует. Это создает предпосылку исследования, посвященного эволюции интронно-экзонной структуры генов, разрешению таких принципиальных вопросов, как происхождение интронов и механизмов их распространения в популяциях хлорелл.
Настоящая работа посвящена изучению нуклеотидных последовательностей гена 18S рРНК в р. Chlorella, анализу возможности горизонтального переноса интронов между различными видами хлорелл, а также обоснованию и разработке прямой идентификации симбиотических хлорелл без выделения их в чистую культуру из парамеций.
Материалы и методы исследования. Штаммы и условия культивирования. Были использованы два типовых вирусочувствительных штамма симбиотических хлорелл, северного (241−80) и южного (NC64A) экотипов, изолированных из их хозяев, и две культуры инфузорий
* Работа выполнена при поддержке РФФИ (гранты № 05−04−49 274а, 06−04−49 785-а) и С1ШР ВЯНЕ 4056
© К. В. Воробьев, А. В. Мигунова, Е. П. Чижевская, Е. Е. Андронов, К. В. Квитко, 2006
Paramecium bursaria северного (KVK-B1) и южного экотипов (KZI-III) (табл. 1). Коллекцию клонов инфузорий содержали в отваре сухих листьев салата с бактериальной суспензией Aerobacter aerogenes (3−10 и 50 мл) (0,45 г/л воды) при освещении люминесцентными лампами 0,5−2 тыс. лк при температуре 15−18 & quot-С. Клетки Chlorella выращивали на плотной среде, ¼ стандартной BBL (исходно имевшей — желатина 5 г, мясного экстракта 3 г, агар-агара 15 г на 1 л воды, с добавлением до 1,5% порошкового агара) при освещении 2−4 тыс. лк, при 15−18 °С.
Таблица 1. Шифр и место изоляции штаммов
Штамм
Год и место изоляции, кем выделен, характеристика штамма
NC64A 241−80
KVK-B1 KZ1-III
Штаммы зоохлорелл южного и северного экотипов
1963 г., изолят КагаказЫап 8.)., получен от Дж. Ван-Эттена, США. Южный экотип зоохлорелл.
1974 г., Геттинген, Германия, пруд Ботанического сада. Выделен В. Кохом. Северный экотип зоохлорелл
Инфузории северного и южного экотипов
2004 г., Россия, Карелия, Кандалакшское побережье Белого моря, пресноводное озеро на о-ве Малый Горелый, р-н МБС СПбГУ. Северный экотип.
1989 г., Япония. Выделен I. М1уа. Южный экотип.
Выделение и манипуляции с ДНК. Выделение ДНК осуществлялось с использованием набора для выделения растительной и грибной ДНК «Nucleon PhytoPure» в соответствии с инструкциями производителя. Фрагменты гена 18S рРНК были амплифицированы при помощи ПЦР-амплификатора Mvcyler (BioRad) при стандартных температурах. При клонировании фрагмента гена 18S рРНК (штамм 241−80), содержащего интрон, были использованы праймеры: 3 °F 54AACTGCGAATGCCTCATTAAA, 4R 5VGGTTGCCTTGTCAGGTTGAT. Для секвенирова-ния, амплифицированные фрагменты были клонированы в плазмиду pTZ57R/T, «Ins Т/А clone ТМ PCR Products Cloning Kit» (Fermentas). Клонированные фрагменты были секвенированы с использованием ABI-310 ДНК-секвенатора в соответствии с указаниями производителя. Для амплификации последовательностей трех интронов штамма NC64A были использованы сконструированные нами праймеры: Intl-F 5& quot- AGTCCACCCAGCACCAAA- Intl-R 54CCTCCACGATCTCAAACG- Int2-F 5& quot- ATGTGGGTGGGCTTGACT- Int2-R 5'-GAGGCTTTCACCATCGAGTA- Int3-F 5XATTGCCATGCGGATAAA- Int3-R 5XCAGACTGGAGGCTTGAT, разработанные нами на основе сиквенса интронов японских штаммов зоохлорелл (АВ162 912-АВ162 917).
Анализ последовательностей. Для изучения различий в структуре гена 18S рРНК (количества и локализации интронов) из GeneBank были отобраны последовательности этого гена, размер которых превышал 1800 пн. Наличие и локализация интронов в этих последовательностях были подтверждены при выравнивании в программе ClustalW [34]. В табл. 2 представлены отобранные для анализа штаммы, указаны количество и локализация интронов (в соответствии с позициями нуклеотидов гена 7S5pPHK штамма С. kessleri SAG 211-llg (Х56 105)).
Коэффициент нуклеотидного полиморфизма Р. интронных и экзонных последовательностей [30] вычисляли с помощью программы DnaSP [32]. Для филогенетических построений была использована программа MEGA 2 [27] Генетическое расстояние между двумя последовательностями определялось как число различающихся нуклеотидных позиций. Для кластеризации был использован метод Neighbor-joining. Для оценки достоверности кластеризации использовали bootstrap ресэмплинг (500). Для статистического сравнения филогений был использован метод Мантеля [28], позволяющий вычислять коэффициент корреляций между матрицами расстояний. Для поиска последовательностей, гомологичных интронным, использовали программу BLAST [38], доступную на сервере NCBI (http: //ncbi. nlm. nih. gov/blast).
Таблица 2. Использованные в исследовании сиквенсы генов 18S рРНК штаммов Chlorella
№ Идентификационный # Организм Штамм Интрон 1 Интрон II Интрон III
Локализация no Ch. kessler Размер Локализация по Ch. kessleri Размер Локализация по Ch. kessler Размер
1 AY197631 С/7. SP. MDL4−3 98 433 — - - -
2 АВ6 048 Ch. trebouxioides. 150 368 1169 213 — -
3 Х73 993 Ch. sorokiniana SAG 211−40a 395 465 1268 428 — -
4 AF357146 Ch. sp. 2A3 562 341 — - - -
5 AF516675 Ch. sp. BC4-VF9 562 366 — - - -
6 Х73 998 Ch. luteoviridis SAG 211−2a 564 348 1273 421 — -
7 Х73 997 Ch. luteoviridis SAG 211−2a 564 350 — - -
8 АВ240 151 Ch. pyrenoidosa 564 365 — - - -
9 АВ58 310 Ch. saccharophila MBIC10092 564 377 — - - -
10 АВ183 634 Ch. saccharophila MBIC10744 564 377 — - -
11 AY195964 Ch. sp. AN 1−3 757 332 — - - -
12 АВ206 547 unculturedC/). ** PB-SW1 758 324 — - -
13 АВ206 548 unculturedC/?. ** CCAP 1660/11 758 324 -. -
14 АВ162 912 Ch. sp.* OK1-ZK 1169 327 1604 648 1778 496
15 АВ162 913 Ch. sp.* So13-ZK 1169 327 1604 648 1778 496
16 АВ162 914 Ch. sp.* F36-ZK 1169 327 1604 648 1778 496
17 АВ162 915 Ch. sp.* KM2-ZK 1169 327 1604 648 1778 496
18 АВ162 916 Ch. sp.* Dd1-ZK 1169 327 1604 648 1778 496
19 АВ162 917 Ch. sp.* Bnd1-ZK 1169 327 1604 648 1778 496
20 АВ206 546 uncultured Ch. * - 1169 327 1604 648 1778 496
21 АВ206 549 Ch. sp.* NC 64 A 1169 327 1604 648 1778 496
22 АВ206 550 Ch. sp.* АТСС 30 562 1169 327 1604 648 1778 496
23 АВ219 527 Ch. sp* MRBG1 1169 327 1604 648 1778 496
24 АВ58 300 Ch. saccharophila MBIC10038 1169 400
25 АВ58 301 Ch. saccharophila MBIC10039 1169 400 _ -
2& amp- АВ183 575 Ch. saccharophila MBIC10037 1169 400 _
27 АВ183 576 Ch. saccharophila MBIC10040 1169 400 _
28 АВ183 577 Ch. saccharophila MBIC10041 1169 400 _
29 АВ183 578 Ch. saccharophila MBIC10042 1169 400 _
30 АВ183 579 Ch. saccharophila MBIC10043 1169 400 —
31 АВ183 635 Ch. sp. MBIC10747 1169 400 _ _ _ _
32 AY195982 coccoid qreen alqa JL 4−10 1169 715 _
33 Х74 000 Ch. mirabilis Andreveva 748- 1769 488 _ _
34 X63520 Ch. ellipsoidea SAG 211−1 a 1798 412 _
39 D13324 Ch. ellipsoidea IAM C-87 1798 414 — - - -
* Зоохлореллы южного экотипа.
** Зоохлореллы северного экотипа.
Результаты исследований. Клонирование и секвенирование интронной последовательности штамма 241−80. Нами был клонирован и секвенирован фрагмент гена 18S рРНК, содержащего интрон, штамма 241−80, относящегося к северному экотипу зоохлорелл. После определения границы интрона с помощью выравнивания в программе ClustalW, его последовательность была использована в качестве запроса в программу BLAST на сервере NCBI, в результате чего были найдены два штамма хлорелл (АВ206 547, АВ206 548) [20], с последовательностью, полностью идентичной запросу. Найденные штаммы являются некультивируемыми симбиотическими хлореллами парамеций немецкого и британского происхождения соответственно. Ген 18S рРНК этих штаммов содержит единственный интрон, размером 324 пн, локализованный между 758−759 нук-леотидами.
Таким образом, можно предположить, что штаммы симбионтов Paramecium bursaria, из английской и немецкой популяций, являются ближайшими родственниками штамма 241−80.
Доказательство наличия трех интронов в штаммах зоохлорелл южного эко-типа. При использовании праймеров Intl, Int2, Int3 в реакции ПЦР было показано, что штамм NC64A содержит все три интрона, характерные для японских штаммов зоохлорелл (АВ162 912-АВ162 917) (рис. 1) [19]. При этом штаммы северного экотипа не содержат ни один из интронов, свойственных указанным штаммам южного экотипа.
Разнообразие в количестве, локализации, размере и нуклеотидной последовательности интронов в гене 18SрРНК у p. Chlorella. В табл. 2 приведены штаммы хлорелл, ген 18S рРНК которых содержит интрон. Указаны идентификационные номера, количество интронов, их размер и локализация. Всего штаммов интронсодержащих хлорелл — 35, обнаружено интронов — 48, большая часть которых расположена около 564-й и 1169-й позиции гена 7#5рРНК. Также в таблице представлены 3 штамма с двумя и 10 штаммов с тремя интронами. Более 60% хлорелл содержат одну вставку в исследуемый ген.
Таким образом, при изучении локализации интронов, было выявлено три основные группы интронов в соответствии с местом их инсерции: а) — район 564-го (7 штаммов), б) -757-го (3 штамма), в) — 1169-го (6 штаммов) нуклеотидов.
Для анализа родства нуклеотидных последовательностей интронов было произведено их выравнивание, на основе которого была сконструирована дендрограмма родства (рис. 2).
На ней четко выделяются два обособленных кластера, А и Б. Интересно отметить, что в кластере, А представлены редкие типы инсерции (по месту локализации), тогда как в кластере Б собраны интроны, локализованные в наиболее типичных для хлорелл районах. Как очевидно из дендрограммы, существует несомненная связь между местом вставки интрона и

Рис. 1. Амплификация интронных участков, характерных для зоохлорелл
южного экотипа. М — Ladder lOObp. Были использованы праймеры Intl (дорожка 1 и 2), Int2 (дорожка 3 и 4), Int3 (дорожка 5 и 6). Полоса в дорожке 3 — неиспользованные праймеры.
г
35_
15
-100
62
1ПП
2- С. t? bauxloktes И 50 Un -1 23-С. зр. MR В G1 1604 in2
20-un cultured Ch. 1604 in2 14-C. sp. OK1-ZK 1604 in2 22-С. sp. ATCC 30 562 1604 in2
21-C. sp. NC64A 1604 in2 23-C. sp. MRBG1 1778 in3
14-C. sp. OK1-ZK1778in3
20-uncultured Ch. 1778 in3
22-C. sp. ATCC 30 562 1778 in3
21-C. sp. NC64A 1778 in3
л
J
¦ 3 C. somkiniarta SAG211−40a 1268
Ж.
34
85
С
80
e-C. luteoviridis iridis (В) SAG 211−11 a 1273 31-C. sp. MBIC1G747 1169 24 C. saccharcphua MB 1С 138 1163 — 2- C. fretoi/Xiuitfes 1169 i n2 -32-cocooid green alga JL4−10 1169

3-е. sotohiniana SAG 211−40a 395 In1
33- C. mirabilis Andreyev a 743−1 1769 35-С ellipsoidea IAMC-87M798 ЭФС ellipsoidea SAG211−1a 1798
-Ш-
•1- C. sp. MDL4−3 98
100
100
-34-
22-C. sp. ATCC 30 582 1169 in1 14-C. sp. 0K1-ZK 1169 У. in1 21-C. sp. NC84A 1169 in1
23-C. sp. MRBG1 1169in1 20-uncultured Ch. 1169 in1 -11-C.o. AN 1−3W57
-4UO-
100
54

42
13-uncultured Ch. CCAP 1660/11 7B8 112-uncultured Ch. PB-SW1 758
-4-C. sp. 2P3 SS2
10-C. sacohamphUa MBIC10744564 & amp--C. saccbampbila MBIC192 564 -8- C. py? nokiosB 564

V
(branch length)

¦5-C. sp. BC4VF9562
— 7- C. luteoviridis SAG 211−2 a 564 ¦ 6- C. kiteo viridis (В) SAG 211−2 a 564
-с7& quot-
l- e-C h
J
Pue. 2. Дендрограмма родства нуклеотидных последовательностей интронов. Номера штаммов соответствуют порядковым номерам, приведенным в табл. 2. Указаны названия вида и его штамма, место локализации интрона (выделено жирным шрифтом). Если интронов несколько, указан номер интрона (inl, in2, in3). Места локализации отмечены в соответствии с позициями нуклеотидов гена 18S рРНК штамма С. kessleri SAG 211−1 lg (Х56 105). * - штаммы южного экотипа зоохлорелл, ** - штаммы северного экотипа. Штаммы № 14 и 24 объединяют в себе штаммы № 15−19 и 20−24 соответственно, в виду их 99%-ного сходства. Цифры — коэффициенты bootstrap.
его нуклеотидной последовательностью. Так, все интроны группы а) формируют на древе четко обособленный кластер (коэффициент bootstrap 99), то же самое справедливо в отношении интронов групп б) и в). Зоохлореллы по первому интрону в этой родословной образуют две близкорасположенные ветви в кластере В, а по 2-му и 3-му интрону для южных зоохлорелл существует две группы в кластере А.
Для сравнения степени вариабельности интронных и экзонных последовательностей были вычислены коэффициенты нуклеотидного полиморфизма Р. и их стандартное отклонение. Для анализа была выбрана группа наиболее близкородственных интронов, относящихся к кластеру Б, и группа соответствующих им экзонных последовательностей. Коэффициент Р. для интронов составил 0,353±0,029, а для экзонов — 0,055±0,029. При этом единообразие северных и южных зоохлорелл отличает их от свободноживущих форм.
Таким образом, интронные последовательности гена 755рРНК гораздо более вариабельны, чем экзонные, даже в группе, объединяющей наиболее близкородственные интроны у свободноживущих форм.
Проверка гипотезы горизонтального переноса интронов между различными штаммами и видами хлорелл. Для проверки этой гипотезы была исследована корреляция между филогениями, построенными на основании экзонных и интронных последовательностей гена 18S рРНК Chlorella sp. С этой целью были сформированы группа интронов, объединяющая 11 интронов гена /55рРНК хлорелл, содержащего единственный интрон, и первый интрон, характерный для южного экотипа водорослей. Для сравнения в пару к каждой группе интронов были сформированы группы экзонных последовательностей гена 18S рРНК.
Таким образом, была построена пара дендрограмм, представленная на рис. 3. В каждой паре проводилось визуатьное сравнение топологий древ. Было показано, что дендрограммы, построенные на основании интронных и экзонных последовательностей, имеют различную топологию, что подтвердилось и расчетами, проведенными с использованием теста Мантеля.
Поиск последовательностей, гомологичных интронам гена 18SрРНК, в вирусных базах данных GeneBank. Для проверки гипотезы об опосредованном вирусами переносе интронных последовательностей была использована программа BLAST. Запросы содержали последовательности интронов гена 18S рРНК хлорелл. Максимально протяженные гомологичные участки не превосходили 25−30 пн. Интересно отметить, что в списках вирусов, содержащих данные короткие гомологичные участки, неизменно обнаруживались вирусы хлорелл.
Амплификация участков гена 18SрРНК хлорелл при использовании в качестве матрицы тотальной ДНК, выделенной из парамеций, с целью разработки метода прямой идентификации зоохлорелл без выделения их в чистую культуру с использованием стандартных методов. Количество и качество выделенной ДНК было достаточным для использования ее в качестве матрицы в реакции ПЦР. Действительно, использование праймеров 6 °F (5VATGGCCGTTCTTAGTTGGTG) и HR (54GGAGAAGTCGTAACAAG), предложенных в работе [21] позволило амплифициро-вать последовательности, специфичные для гена /55рРНК хлорелл (рис. 4)
Также была продемонстрирована возможность рестрикционного анализа амп-лификатов, позволяющая проводить более тонкую генотипическую характеристику штаммов.
г L
28-C. Saccharophila МВ1С141И169
28-AB183577 -i
31-C. sp. MBIC10747 1169
— 1-C. sp. MDL4−3 98
100 J34-C. ellipsoidea SAG 211−1a1798 35-C. ellipsoidea IAM C-87 1798 — 33-C. mirabilis Andreyevs 748−1 1769 & quot- 32-coccoid green alga JL4−10 1169
'- 5-C. sp. BC4-VF9 562 -8-C. pyrenoidosa 564
100 | 9-C. saccharophila MBIC192 564
'- 10-C. saccharophila МБ1С10 744 564 -4-C. Sp. 2A3 562
& quot- 7-C. luteoviridis SAG 211−2a 564
100 | 12-uncuit Ch PB-SWH 758
13-uncult Ch. CCAP 1660/11 758
•11-C. sp. AN1−3 757 — 14-C. sp. OK1-ZK1169in1
10-AB1836341 9-AB058310 I
5-AF516675-
35-D13324 -| 1Q0 34-X63520 33-X74000 —
1-AY197631 Г®4
4-AF357146-
31-АВ162 912 — 100
13-АВ206 548 ь 96
12-АВ206 547 Г
8-АВ240 151 44
11-AY195964 -I [ 40
Рис. 3. Дендрограммы родства интронных (слева) и экзонных (справа) последовательностей штаммов хлорелл,
содержащих единственный интрон.
Цифры — коэффициенты bootstrap- * - штамм южного экотипа зоохлорелл.
Рис. 4. Электрофоретическое разделение рестрикционных полос фрагмента гена 18S рРНК, содержащего интрон у северных зоохлорелл (1, 4−8) и двух симбионтов карельских штаммов
инфузорий (2, 3).
Рестрикционные паттерны зоохлорелл из инфузорий имеют отличия по легким фрагментам
от паттернов коллекционных культур.
Обсуждение результатов исследования. Задача представленной работы состоит в анализе разнообразия экзонно-интронной структуры гена 18S рРНК у р. Chlorella и выработке подходов для идентификации зоохлорелл. Ранее нами были клонированы и секвенированы фрагменты гена 755рРНК южного экотипа зоохлорелл [16]. Было установлено, что штаммы данного экотипа зоохлорелл, поддерживаемые в коллекции Би-НИИ, по крайней мере, в проанализированном фрагменте гена 18S рРНК, полностью идентичны японским штаммам симбиотических зоохлорелл, содержащих три интрона [19]. С помощью ПЦР было доказано, что штаммы южного экотипа из коллекции Би-НИИ содержат все интроны, характерные для японских штаммов зоохлорелл.
В настоящей работе также был проклонирован и просеквенирован участок гена 18S рРНК, содержащий интрон, характерный для штамма 241−80, относящегося к северному экотипу зоохлорелл. Анализ нуклеотидной последовательности показал ближайшее родство данного штамма и штаммов зоохлорелл, выделенных из немецких и британских клонов инфузорий (АВ206 547, АВ206 548) [20].
Таким образом, ближайшими родственниками штаммов зоохлорелл южного и северного экотипа из коллекции БиНИИ являются штаммы (АВ162 912-АВ162 917 и АВ206 547, АВ206 548 соответственно), что позволяет нам использовать их в дальнейшем нуклеотидном анализе.
Вторая часть работы была посвящена анализу природного разнообразия структуры 18S рРНК у хлорелл. Характерной особенностью этой структуры является исключительный полиморфизм. Нами было выявлено, по крайней мере, 35 мест инсерции инт-ронных последовательностей в данном гене. Кроме того, количество интронов варьировало от одного до трех. Статистический анализ показал чрезвычайно высокий уровень нуклеотидного разнообразия интронных областей, по сравнению с экзонными. Все это вместе взятое контрастирует с исключительной консервативностью интронно-экзонной структурой генов у высших организмов и дает основание полагать, что р. Chlorella является исключительно интересным объектом для исследователей эволюционной истории интронов.
Интересной особенностью интронных последовательностей в гене 18S рРНК является показанная в настоящей работе корреляция между местом инсерции интрона и
его нуклеотидной последовательностью. Это очевидно из дендрограммы родства нуклео-тидных последовательностей интронов, на которой интроны со сходной локализацией в гене образуют, как правило, отдельные кластеры. По всей видимости, указанная корреляция объясняется таким взаимодействием последовательностей интрона и экзона, которое обеспечивает эффективный сплайсинг вставки [33].
Одна из гипотез, пытающихся объяснить полиморфизм интронно-экзонной структуры гена 18S рРНК у хлорелл, предполагает существование горизонтального переноса интронов, опосредованного вирусами [31, 36, 37]. Сначала была проанализирована гипотеза о том, что горизонтальный перенос интронов имел место в эволюционной истории р. Chlorella без анализа механизма этого переноса. Одним из традиционных способов проверки гипотез горизонтального переноса генов является сравнение топологий филогенетических древес, построенных на основании последовательностей различных генов или их участков [34]. Анализ, проведенный в нашей работе, показал отсутствие сколь либо заметных корреляций между интронными и экзонными филогениями для свободноживущих хлорелл. Исключением является специализированная группа штаммов С. saccharophila миксотрофного вида хлорелл (№ 9−10, 24−30, см. табл. 2), а также двух групп зоохлорелл — северных (№ 12, 13) и южных (№ 14−23). Это указывает на принципиальную возможность переноса интронов между штаммами хлорелл, однако, не указывает на какие-либо рекомбинационные механизмы.
Для проверки гипотезы о горизонтальном переносе, опосредованном вирусами, был проведен поиск гомологов интронных последовательностей гена 18S рРНК хлорелл в вирусных базах GeneBank. Не было обнаружено протяженных последовательностей, гомологичных интронным последовательностям хлорелл, максимальная длина выявленных гомологов составила 25−30 пн, что не является достаточным для обоснования вирусной гипотезы горизонтального переноса интронов. Однако неожиданным является тот факт, что среди вирусов, содержащих короткие последовательности, гомологичные интронам хлорелл, частота встречаемости различных штаммов вирусов хлорелл {Chlorella virus, ген URF14. 2- PCVB-1) необычайно высока и не может быть объяснена случайностью. Это несомненно представляет собой исключительный научный интерес. По-видимому мы наблюдаем в данном случае явление передачи интронов между хлореллами через вирусы, у который наличие интронов I группы также описано [31, 36, 37].
Проведенные в данной работе исследования позволили не только дать обзор разнообразия интронно-экзонной структуры гена 18S рРНК у р. Chlorella, но и обосновать возможность использования интронов этого гена для идентификации зоохлорелл. Высокий полиморфизм интронных последовательностей и их уникальность для видов зоохлорелл делает их хорошими кандидатами на роль таксономических маркеров. Такое толкование наблюдаемой изменчивости близко позиции группы Debashish Bhattacharya [17, 18], показавшей совпадение изменений в интронах I группы рРНК генов с ходом эволюции Ascomycetes, отделившихся от Basidiomycetes 600 млн лет тому назад. В пределах аскомицетов группы, разошедшиеся 400 млн лет, четко различались по своим интронам. Остается только добавить, что по С. И. Фокину [12], возраст таксона Paramecium bursaria около 50 млн лет, а это на порядок меньше времени, в течение которого сохранялось наследование интронов в генах рРНК аскомицетов.
В настоящей работе была продемонстрирована принципиальная возможность использования тотальной ДНК, выделенной из парамеций, содержащих симбиотические водоросли, в качестве матрицы для ПЦР с хлорелла-специфичными праймерами, для
амплификации фрагментов гена 18S рРНК, специфичных для различных экотипов хлорелл и их рестрикционного анализа. Возможность проведения такой ПЦР имеет очень большое значение из-за трудностей в выделении многих зоохлорелл в чистую культуру. Все это вместе взятое определяет пути создания экспресс-идентификации хлорелл и зоохлорелл как непосредственно в парамециях, так и в окружающей среде.
Таким образом, полученные нами факты склоняют нас к принятию в качестве исходной гипотезы теории «Intron early», предполагающей изначальное существование интронов в гене 18S рРНК у экотипов зоохлорелл и не последовательный, а независимый путь эволюции [1, 2, 16]. Поэтому возможен статус видовых различий для северных и южных экотипов. Конечно, это потребует более обширного изучения интронов в рибосомном кластере у двух групп зоохлорелл и у родственных им штаммов свободно-живущих Chlorella vulgaris, Ch. lobophora, Ch. sorokiniana. В связи с тем, что интроны как генетические мобильные элементы могут передаваться другим организмам при тесных контактах в симбиотических системах, не исключено, что возможна передача интронов в ценозах при участии вирусов зоохлорелл.
Summary
Vorobyev К. P., Migunova А. V., Chizhevskaya Е. P., Andronov Е. Е., Kvitko К. V. Introns in gene for 18S rRNA of zoochlorella, symbionts of Paramecium bursaria, and prospects of their use in systematization.
The analysis of a variety of intron-exon structures of gene 18S rRNA in Chlorella strains, including symbionts of P. bursaria. is made. In particular the correlation between intron site insertion and its sequence is revealed. The analysis of an opportunity of horizontal transfer of introns and development of approaches for identification of zoochlorellas without isolation in pure culture is also carried out, using the presence of this ecotype-specific intron insertions in SSU rRNA.
Литература
1. Воробьев К. П., Андронов Е. Е., Мигучова А. В., Квитко К. В. Разработка метода прямой идентификации экотипов зоохлорелл в Paramecium bursaria по интронам в гене 18S рРНК // Тезисы докладов VII научной сессии МБС СПбГУ. 2006. С. 86. 2. Воробьев К. П., Гапонова И. Н., Андронов Е. Е. Различие двух экотипов зоохлорелл по набору интронов в гене 18S рРНК // Тезисы всероссийской молодежной школы-конференции «Актуальные проблемы современной микробиологии». 2005. С. 69−70.3. Гапонова И. Н. Сравнительная характеристика чувствительных к вирусу симбиотических Chlorella sp, северного и южного экотипов: Магистерская диссертация. (Каф. микробиологии СПбГУ). СПб., 2004. 70 с. 4. Гапонова И. Н., Мшунова А. В., Квитко К. В. Исследование секреции Сахаров «северными» зоохлореллами — симбионтами Paramecium bursaria в условиях in vivo и in vitro // Вестн. С. -Петерб. ун-та. Сер. 3. 2004. Вып. 4. С. 76−80.5. Квитко К. В., Андронов Е. Е., Воробьев К. П., Гапонова И. Н., Мигунова А. Интроны в гене 18S рРНК как таксономический признак свободноживущих и симбиотических Chlorella sp. // Тезисы докладов VII научной сессии МБС СПбГУ. 2006. С. 88−89.6. Квитко К. В., Войцеховский Е. В., Мигунова А. В., Пиох Д., Линц Б. Симбиотический индекс, как оценка состояния водных экосистем на примере водоемов полигона Красный Бор и его окружения // Вопросы экологии и охраны природы. Вып. 4. СПб., 1994. С. 47−57. 7. Квитко К. В., Громов Б. В. Новые находки титруемого инфекционного вируса хлореллы //Докл. АН СССР. 1984. Т. 279. № 4. С. 998−999.8. Квитко К. В., Мигунова А. В., Гапонова И. Н., Воробьев К. П., Фирсов М. А., Раутиан М. С., Карелов Д. В., Андронов Е. Е. Популяционная изменчивость тройственной симбиотической системы: Paramecium bursaria, зоохлорелла, поражающие ее вирусы // Экол. генет. 2004. Т. 2. № 4. С. 29−39. 9. Мигунова А. В. Исследование водорослей в симбиотической системе: Paramecium bursaria — Chlorella sp.- вирус PBCV (сем. Phycodnaviridae): Канд. дис. СПб., 2002. 123 с. 10. Мигунова А. В., Квитко К. В. ,
Прокошева М. Ю., Литвинов Д. Б. Влияние температуры на размножение Paramecium bursaria, Chlorella и PBCV-вирусов в системе тройного симбиоза // Вестн. С. -Петерб. ун-та. Сер. 3. 2000. Вып. 1 (№ 3). С. 63−73. 11. МигуноваА. В., Квитко К. В., Скобло И. И., Прокошева М. Ю. Экология симбиотической системы: Paramecium bursaria — Chlorella — virus // Вестн. С. -Петерб. ун-та. Сер. 3. 1999. Вып. 3 (№ 17). С. 80−84. 12. Фокин С. И. Ревизия рода Paramecium О. F. Muller, 1773: сравнительно-биологический анализ, систематика и филогенетические связи: Автореф. докт, дис.
2002. СПб., 32 с. 13. Copyright © by Bonnot Е. 2001. 14. De RoosA. D. G. Origins of introns based on the definition of exon modules and their conserved interfaces // Bioinformatics. 2004. Vol. 21 (N 1). P. 2−9. 15. FedorovA., Fedorova L. Introns in gene evolution // Genetica. 2003. Vol. 118. P. 123−131. 16. Gapo-nova I. N., Andronov E. E., Migunova A. V., Vorobyev K. P., Chizhevskaja E. P, Kvitko K.V. Genomic dactyloscopy of Chlorella sp., symbionts of Paramecium bursaria // Protistology. 2006. Vol. 6 (N 4). В печати. 17. Haugen P., Runge H.J., Bhattacharya D. Long-term evolution of the S788 fungal nuclear small subunit rRNA group I introns // RNA. 2004. Vol. 10 (N 7). P. 1084−1096. 18. Haugen P., Simon D. M., Bhattacharya D. The natural history of group I introns // Trends Genet. 2005. Vol. 21 (N 2). P. 111−119. 19. Hoshina R., Kamako S., Imamura N. Phylogenetic Position of Endosymbiotic Green Algae in Paramecium bursaria Ehrenberg from Japan // Plant Biol. 2004. Vol. 6. P. 447−453. 20. Hoshina R., Kato Y., Kamako S., Imamura N. Genetic Evidence of «American» and «European» Type Symbiotic Algae of Paramecium bursaria Ehrenberg// Annu. Rev. Plant Physiol. Plant Mol. Biol. 2005. Vol. 7. (N 5). P. 526−532. 21. Huss V.A. R., Frank C" Hartmann E. C., HirmerM., KloboucekA., Seidel В. M" Wenzeler P., Kessler E. Biochemical taxonomy and molecular phylogeny of the genus Chlorella sensu lato (Chlorophyta) //]. Phycol. 1999. Vol. 35. P. 587−598. 22. Kessler E., Huss V. A. R. Comparative physiology and biochemistry and taxonomic assignment of the Chlorella (Chlorophyceae) strains of the Culture Collection of the University of Texas at Austin //J. Phycol. 1992. Vol. 28. P. 550−553. 23. Kvitko К. V., Zelennikova O., Migunova A. V., Voitsekhovsky E., Litvinov D., Safonova E. Th. Ecological and climatic rules for PBCV-virus circulation // Abstracts of X-th International Congres of Virology. Jerusalem. Israel. 1996. 24. Kvitko К. V., Migunova A. V, Gaponova I. N., Zelennicova O. A., Rautian M. S. Symbiosis system: Paramecium bursaria, Chlorella, PBCViruses in southern and northern populations // Schedule and Abstracts of 4-th International Symbiosis Congress Halifax. Nova Scotia. Canada. Aug. 17−23. 2003. P. 143−139. 25. Kvitko К. V., Migunova A. V., Karelov D. V., Prokosheva M. Ju. Molecular taxonomy of virus-sensitive Chlorella sp. — symbionts of Paramecium bursaria // Protistology. 2001. Vol. 2 (N 2). P. 96−104. 26. Kumar S., К. Tamura M. Nei. MEGA: Molecular Evolutionary Genetics Analysis Software // Bioinformatics. 2001. Vol. 17 (N 12). P. 1244−1245. 27. Linz В., Linz A., Migunova A. V., Kvitko К. V. Correlation between virus-sensitivity and isoenzyme spectrum in symbiotic Chlorella-Wke algae // Protistology. 1999. Vol. 1. P. 76−81. 28. Mantel N. Valand R. S. A technique of nonparametric multivariate analysis // Biometrics. 1970. Vol. 26. P. 547−558. 29. Migunova A. V., Scoblo L., Kraeva E. Zoochlorella viruses carrier status of P. bursaria // Abstracts of X-th International Congress of Virology. Aug. 11−16. Jerusalem. Israel. 1996. P. 251. 30. Nei M. Molecular Evolutionary Genetics. New York, 1987. 31. Nishida K., Suzuki S., Kimura Y., Nomura N., Fujie M., Yamada T. Group I introns found in Chlorella virus: biological implications // Virology. 1998. Vol. 242. P. 319−326. 32. RozasJ., Sanchez-DelBarrio JC., Messegyer X., Rozas R. DnaSP, DNA polymorphism analyses by the coalescent and other methods // Bioinformatics. 2003. Vol. 19. P. 2496−2497. 33. Saldanha R" Beifort M., Lambowitz A. M., Mohr G. Group I and group II introns // Faseb J. 1993. Vol. 7. P. 15−24. 34. ThompsonJ. D., Gibson T.J., Plewniak F., Jeanmougin F., HigginsD. G. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools // Nucleic Acids Research. 1997. Vol. 24. P. 4876−4882. 35. Van Berkum P., Terefework Z., Paulin L., Suomalainen S., Lindstrom К., Bertrand D. E. Discordant Phylogenies within the rrn Loci of Rhizobia // J. bacteriology.
2003. Vol. 185 (N 10). P. 2988−2998. 36. Yamada Т., Songsri P., Tamura K. Horizontal transmission of group-I ribozymes: viruses as a carrier of the introns // Nucleic Acids Symp. 1995. Vol. 34. P. 119−120. 37. Yamada Т., Tamura K., Aimi Т., Songri I. Self-splicing group I introns in eucariotic viruses // Nucleic Acids Research. 1994. Vol. 22. P. 2532−2537. 38. Zhang Z" Schwartz S" Wagner L., Miller W. A greedy algorithm for aligning DNA sequences //J. Comput. Biol. 2000. Vol. 7 (N 1−2). P. 203−214.
Статья поступила в редакцию 6 апреля 2006 г.

ПоказатьСвернуть
Заполнить форму текущей работой