Получение и антигенная характеристика рекомбинантных нуклеокапсидных белков вирусов Ласса и Марбург

Тип работы:
Реферат
Предмет:
Медицина


Узнать стоимость

Детальная информация о работе

Выдержка из работы

ЛИТЕРАТУРА
1. Михеева И. В., Лыткина И. Н. Эпидемиология и вакцинопрофилактика эпидемического паротита // Вакцинация. — 2003. -№ 1. — С. 5−6.
2. ОтрашевскаяЕ. В., БукинЕ. К., КрасильниковИ. В., Игнатьев Г. М. Состояние специфического гуморального иммунитета после однократной иммунизации паротитной вакциной: данные трехлетнего наблюдения // Вопр. вирусол. — 2011. — № 3. — С. 22−25.
3. AllwinnR., ZeidlerB., SteinhagenK. E. et al. Assessment of mumps virus-specific antibodies by different serological assays: which test correlates best with mumps immunity // Eur. J. Clin. Microbiol. Infect. Dis. — 2011. — Vol. 30. — N 10. — P. 1223−1228.
4. Atrasheuskaya A. V., Neverov A. A., Rubin A. V, Ignatyev G. M. Horizontal transmission of the L-3 live attenuated mumps vaccine virus // Vaccine. — 2006. — Vol. 24. — P. 1530−1536.
5. Atrasheuskaya A. V., Blatun E. M., Kulak M. V. et al. Investigation of mumps vaccine failures in Minsk, Belarus // Vaccine. — 2007. — Vol. 25. — P. 4651−4658.
6. Atrasheuskaya A. V., Kulak M. V., Rubin S., Ignatyev G. M. Mumps vaccine failure investigation in Novosibirsk, Russia, 2002−2004 // Clin. Microbiol. Infect. — 2007. — Vol. 7. — P. 670−676.
7. Backhouse J. L., Gidding H. F., McIntyre P. B., Gilbert G. L. Evaluation of two enzyme immunoassays for detection of immunoglobulin G antibodies to mumps virus // Clin. Vaccine Immunol. — 2006. -Vol. 13. — P. 764−767.
8. Cristenson B., Bottiger M. Methods for screening the naturally acquired and vaccine-induced immunity to the mumps virus // Biogi-cals. — 1990. — Vol. 18. — P. 213−219.
9. Dayan G. H. Rubin S. Mumps outbreaks in vaccinated populations-
are available mumps vaccine effective enough to prevent outbreaks? // Clin. Infect. Dis. — 2008. — Vol. 47. — P. 1458−1467.
10. Hanna-WakimaR., YasukawaL. L., SungP. et al. Immune responses to mumps vaccine in adults who were vaccinated in child-hood // J. Infect. Dis. — 2008. N 12. — P. 1669−1675.
11. Mossong J., PutzL., SchneiderF Seroprevalence of measles, mumps and rubella antibodies in Luxemburg: results from a national crosssectional study // Epidemiol. Infect. — 2003. — Vol. 132. — P. 11−18.
12. MunsenKh., Aboudy Y., MendelsonE., GreenM. S. CohenD. Prevalence of mumps antibodies in the Israeli population in relation to mumps vaccination policy and incidence of disease // Epidemiol. Infect. — 2008. — Vol. 136. — P. 688−693.
13. Norman G. R., StreinerD. L. Biostatistics. The bare essentials. — 2nd Ed. — London, 2000.
14. Pipkin P. A., AfzalM. A., Heath A. B. et al. Assay of humoral immunity to mumps virus // J. Virol. Meth. — 1999. — Vol. 79. — P. 219−225.
15. Rubin S., Mauldin J., Chumakov K. et al. Serological and phylogenetic evidence of monotypic immune responses to different mumps virus strains // Vaccine. — 2006. — Vol. 24. — P. 2662−2668.
16. RubinS.A., QiL., AudetS.A. et al. Antibody induced by immunization with the Jeryl Lynn mumps vaccine strain effectively neutralizes a heterologous wild-type mumps virus assiciated with a large outbreak // J. Infect. Dis. — 2008. — Vol. 198. — N 4. — P. 508−515.
17. Tisher A., AndrewsN., Kafatos G. et al. Standardization of measles, mumps and rubella assays to enable comparisons of seroprevalence data across 21 European countries and Australia // Epidemiol. Infect.
— 2007. — Vol. 135. — P. 787−797.
18. WHO-recommended standards for surveillance of selected vaccine-preventable diseases // Vaccines and Biologicals. — 2003. — Vol. 1.
— P. 18−21.
Поступила 11. 11. 11
© КОЛЛЕКТИВ АВТОРОВ, 2012 УДК 578. 833. 2/. 3:578. 1]. 083. 2
А. С. Владыко, Е. П. Счесленок, Е. Г. Фомина, П. А. Семижон, Г. М. Игнатьев, Т. В. Школина, А. Г. Красько,
С. Ф. Семенов, Н. В. Винокурова
Получение и антигенная характеристика рекомбинантных нуклеокапсидных белков вирусов Ласса и Марбург
Г У Республиканский научно-практический центр эпидемиологии и микробиологии, Минск
Созданы векторные конструкции, позволяющие экспрессировать рекомбинантные полипептиды вирусов Ласса и Марбург в прокариотических клетках Е. ooli, штамм BL21(DE3). Полученные рекомбинантные полипептиды способны связывать специфические антитела, что позволяет использовать их в качестве антигенных компонентов иммуноферментных диагностических тест-систем.
Ключевые слова: геморрагические лихорадки, вирус Ласса, вирус Марбург, рекомбинантные полипептиды
Detection and Antigenic Characteristics of the Recombinant Nucleocapsid Proteins
of Lassa and Marburg Viruses
A. S. Vladyko, E. P. Scheslenok, E. G. Fomina, P. A. Semizhon, G. M. Ignatyev, T. V. Shkolina,
A. G. Krasko, S. F. Semenov, and N. V. Vinokurova
Republican Research and Practical Center for Epidemiology and Microbiology, Minsk, Belarus
Two plasmid vectors, which allow the recombinant polypeptides of Lassa and Marburg viruses to be expressed in prokaryotic cells E. coli strain BL21 (DE3), were produced. The two recombinant polypeptides are able to bind specific antibodies. This provides an opportunity to use them as antigenic components of immunoassay diagnostic test kits.
Key words: hemorrhagic fever, Lassa virus, Marburg virus, recombinant polypeptides
Вирус Марбург относится к семейству филовирусов и вызывает у людей в эндемичных регионах опасную одноименную геморрагическую лихорадку с летальностью 23−90% [7]. До настоящего времени природные очаги и резервуар лихорадки Марбург окончательно не выяснены. Ежегодные вспышки этой лихорадки отмечены в странах
Центральной Африки. Вирус Ласса является представителем особо опасной группы из семейства аренавирусов. Вызывает летальность в природных очагах, локализованных в странах центральной части Западной Африки, в пределах 5−20% [3, 5, 6]. В других странах практически ежегодно отмечаются случаи заноса этих инфекций. По-
Контактная инфорация:
Владыко Александр Станиславович, д-р мед. наук, проф., рук. лаб.- e-mail: vladyko@belriem. by
41
скольку методы специфического лечения и профилактики данных геморрагических лихорадок не разработаны, единственными действенными средствами являются своевременная диагностика, изоляция больного и симптоматическое лечение.
Цель настоящих исследований — получить рекомбинантные диагностически значимые белки данных возбудителей и оценить их антигенные свойства.
Материалы и методы
Сыворотки крови, использованные в работе, получены от реконвалесцентов, перенесших геморрагические лихорадки Марбург, Ласса, денге, Крымскую-Конго геморрагическую лихорадку (ККГЛ), геморрагическую лихорадку с почечным синдромом (ГЛПС). Клинический диагноз указанных заболеваний был подтвержден лабораторно с использованием молекулярно-биологических и серологических методов. Сыворотки реконвалесцентов (4 сыворотки), содержащие антитела к вирусу Ласса, получены от д-ра G. van der Groen (Институт тропической медицины, Бельгия), сыворотки реконвалесцентов (также 4), содержащие антитела к вирусу Марбург, получены от д-ра T Fredeking («Antibody Systems Incorporated Ltd», Техас, США), сыворотки реконвалесцентов (6), содержащие антитела к вирусу денге, получены от д-ра M. Teixeira (Университет Белуоризонти, Бразилия), сыворотки, содержащие антитела к вирусу ККГЛ (4), получены от д-ра А. М. Бутенко (Институт вирусологии им. Д. И. Ивановского, Россия), сыворотки, содержащие антитела к вирусу ГЛПС (6), получены из Республиканского центра гигиены, эпидемиологии и общественного здоровья, Минск. В качестве отрицательного контроля (К-) использовали нормальную сыворотку человека.
Выделение вирусной РНК. В качестве исходного материала для выделения РНК были использованы лиофиль-но высушенные вирус Марбург, штамм Voege с исходным титром вируса 5,4 lg и вирус Ласса, штамм Josiach с исходным титром вируса 6 lg. Указанные штаммы вирусов были взяты из специализированной коллекции вирусов и бактерий, патогенных для человека, Республиканского научно-практического центра эпидемиологии и микробиологии. Выделение РНК осуществляли из восстановленной в 0,2 мл H2O вирусной суспензии с помощью коммерческого набора реагентов NucleoSpin RNA (MACHERY-Nagel) согласно прилагаемой инструкции.
Получение фрагментов ДНК, кодирующих антигенозначимые аминокислотные последовательности вирусов Марбург и Ласса. Для получения комплементарной ДНК (кДНК) вирусов Марбург и Ласса осуществляли постановку обратной транскрипции, составы реакционных смесей вкючали: для вируса Марбург — 10 мкл вирусной РНК, 20 пмоль праймера PrDINC Marburg: 5'- - CGCGAAGCTTATTGAGCACGAATCT — 3'-, 20 ед. ингибитора рибонуклеаз, 2 мкл 5х ОТ-буфера для обратной транскриптазы- для вируса Ласса — 10 мкл вирусной РНК, 20 пмоль праймера LVJ_F: 5'- -
AAGCTTGAAGAGCTCTCCTGAAT — 3'-, 20 ед. ингибитора рибонуклеаз, 2 мкл 5х ОТ-буфера для обратной транскриптазы. Реакционные смеси инкубировали 5 мин при 90 оС с последующим охлаждением до 42оС, далее вносили по 1 мкл смеси дезоксинуклеотидтрифосфа-тов (дНТФ), содержащей по 10 мМ дАТФ, дЦТФ, дГтФ и дТТФ, по 2 мкл 5х ОТ-буфера для обратной транскриптазы, по 100 ед. обратной транскриптазы и деионизированную воду до конечных объемов 20 мкл, после чего смеси инкубировали еще 1 ч при 42оС. Для амплификации фрагмента ДНК, кодирующего антигенозначимую аминокислотную последовательность вируса Марбург, к 10 мкл соответствующей кДНК добавляли 15 пмоль праймера PrD1NC Mar-
burg, 15 пмоль праймера PrR1NC Marburg: 5'- - GCGCG-GATCCTCCTGGTTGGTCGAT — 3'-, 10 мМ каждого дНТФ, 2,5 ед. Taq-полимеразы, деионизированную воду до конечного объема 50 мкл. Режим амплификации: 94оС -- 2 мин- 94оС -- 15 с, 50оС--45 с, 72оС -- 45 с, количество циклов -- 30. Для амплификации фрагмента ДНК, кодирующего антигенозначимую аминокислотную последовательность вируса Ласса, к 10 мкл соответствующей кДНК добавляли 25 пмоль праймера LVJ_F, 25 пмоль праймера LVJ_R: 5'- - GGATCCGAACGACTCTAGGTGTC — 3'-, 10 мМ каждого дНТФ, 2,5 ед. Taq-полимеразы, деионизированную воду до конечного объема 50 мкл. Режим амплификации: 94оС — 2 мин- 94оС — 15 с, 55оС — 45 с, 72оС — 45 с, количество циклов — 30.
Анализ фрагментов ДНК, синтезированных в ПЦР, проводили с помощью электрофореза в 1,5% агарозном геле. Продукты рестрикционного анализа гибридных плазмид анализировали в 0,9% агарозном геле. Электрофорез вели при напряжении тока 10 В/см геля в трис-ацетатном буфере, рН 8,0, в течение 25−35 мин. Визуализацию ДНК осуществляли посредством окрашивания геля бромистым этидием с последующим просмотром в УФ.
Лигирование фрагментов ДНК выполняли в объеме 20 мкл при 22 °C в течение 1 ч. В качестве лигирующего фермента использовали T4 DNA Ligase с концентрацией 5 ед/ мкл («Fermentas», Литва).
Подготовку и трансформацию плазмидной ДНК компетентной клеточной культуры проводили по методике, описанной ранее [1].
Выделение плазмидной ДНК. Выделение плазмидной ДНК осуществляли с использованием набора реагентов QIAprep Spin Miniprep Kit («Qiagen») согласно прилагаемой инструкции.
Аффинная металлохелатная хроматография. Постановку металлохелатной хроматографии осуществляли по методике, описанной ранее [1].
Электрофоретический анализ полученных рекомбинантных полипептидов в полиакриламидном геле проводили по общепринятой методике [4].
Для иммуноферментного анализа полученные рекомбинантные полипептиды сорбировали в лунки 96-луночных панелей в концентрации 0,1 мкг на лунку. Сорбцию проводили в объеме 100 мкл при 4 °C в течение 18 ч в фосфатносолевом буферном растворе (ФСБ), рН 7,4. После удаления несвязавшегося антигена вносили по 100 мкл на лунку референс-сыворотки К+ и К- и сыворотки крови больных в разведении 1: 100. Все разведения сывороток и конъюгата проводили на ФСБ с 0,05% твина-20 (ФСБ-Т). Сыворотки инкубировали при 37 °C в течение 1 ч. В качестве конъюгата использовали антитела, диагностические к иммуноглобулину G, меченные пероксидазой хрена («Sigma», США), в разведении 1: 2000. Инкубацию с конъюгатом проводили в течение 1 ч при 37 °C. После каждого этапа панели промывали 5 раз ФСБ-Т. После отмывки панелей связанную пероксидазу выявляли внесением в лунки 100 мкл субстратного буфера. Реакцию останавливали внесением в лунки 50 мкл 0,9 М раствора серной кислоты. Результаты оценивали на ELISA-процессоре по уровню поглощения при длине волны 492 нм.
Результаты и обсуждение
Для получения фрагментов ДНК, кодирующих антигенозначимые аминокислотные последовательности вирусов Марбург и Ласса, были искусственно синтезированы 2 пары олигонуклеотидных последовательностей, включающие сайты специфических рестриктаз для последующего клонирования в экспрессирующий вектор. В результате постановки обратной транскрипции на соответствующих
42
матрицах и последующей ПЦР были получены необходимые фрагменты ДНК, специфичность которых была подтверждена методом рестрикционного анализа (рис. 1) и последующего прямого секвенирования.
Таким образом, фрагмент ДНК размером 1306 пар нуклеотидных оснований (п.о.) для вируса Ласса, соответствующий 6/8 аминокислотной последовательности нуклеокапсидного белка, является специфичным, о чем свидетельствуют фрагменты его рестрикции размерами 194, 238 и 874 п.о., получаемые при обработке рестрик-тазой Bfu I, и что согласуется с данными теоретических расчетов (см. рис. 1, а). Фрагмент ДНК размером 341 п.о., полученный на матрице вируса Марбург и кодирующий антигенозначимый участок с 442-го по 549-й аминокислотный остаток (а.о.) транслируемой последовательности нуклеокапсидного белка, также является специфичным, что подтверждается получением ДНК-фрагментов 90 п.о. и 251 п.о. при его обработке рестрикционной эндонуклеа-
зой EcoR V (см. рис. 1, б). Далее полученные специфичные фрагменты ДНК вирусов Марбург и Ласса были очищены, обработаны рестриктазами BamH I и Hind III и лигированы в полилинкер экспрессирующего вектора pJC40, широко используемого для транскрипции генов в бактериальных клетках под контролем Т7-промотора. Особенностью данного вектора является наличие дополнительного ДНК-фрагмента, кодирующего 10 остатков гистидина, которые при трансляции локализуются в N-концевой части рекомбинантного полипептида, что позволяет очистить получаемые рекомбинантные полипептиды с помощью аффинной металлохелатной хроматографии [2].
Полученными в реакции лигирования смесями были трансформированы компетентные клетки Exoli, штамм DH5a. Трансформанты выращивали на питательной среде, содержащей ампициллин в концентрации 50 мкг/мл. В результате селекции клонов и последующего выделения ДНК были получены 2 гибридные плазмиды: pJC40/6/8 NP Lassa, кодирующая антигенозначимый фрагмент 6/8 нуклеокапсидного белка вируса Ласса, и pJC40 NP Marburg, кодирующая антигенозначи-
мый участок нуклеокапсидного белка вируса Марбург с 442-го по 549-й а.о. Рестрикционный анализ полученных рекомбинантных плазмид представлен на рис. 2. Из рисунка видно, что полученные рекомбинантные плазмиды pJc4o/6/8 NP Lassa (3, а) и pJc40 NP Marburg (3, б) содержат специфические вставки клонированных фрагментов, кодирующие антигенозначимые аминокислотные последовательности нуклеокапсидных белков вирусов Ласса и Марбург.
Для экспрессии рекомбинантных полипептидов вирусов Ласса и Марбург осуществляли трансформацию компетентных пер-миссивных клеток Exoli, штамм BL21(DE3), гибридными плазмидами pJC40/6/8 NP Lassa и pJC40 NP Marburg. Клетки инкубировали на жидкой селективной среде LB до момента достижения бактериальной культурой оптической плотности OD600=0,3, после чего проводили индукцию синтеза рекомбинантных полипептидов внесением в среду культивирования изопропилтиогалакто-пиранозида в конечной концентрации 0,4 мМ [2]. Очистку рекомбинантных полипептидов от клеточных белков осуществляли методом аффинной металлохелатной хроматографии с использованием HisBind колонки с иммобилизованными катионами Ni2+. Степень очистки полученных полипептидов от бактериальных белков оценивали методом электрофореза в полиакриламидном геле. На рис. 3 представлены результа-
874 п.о. -
238 п.о. 194 п.о. -
1 2 3 1 2 3
т III
ш
— - 1306 п.о. 34*1 по_ -
ттт --
-
-251 п.о.
— 90 п.о.
Рис. 1. Электрофореграмма амплифицированных фрагментов ДНК вирусов Ласса и Марбург,
оценка их специфичности.
Дорожки: а: 1 — продукты рестрикции после обработки фрагмента, кодирующего антигенозначимый участок нуклеокапсидного белка вируса Ласса, рестриктазой Bfu I- 2 — ДНК-маркер GeneRuler lkb DNA ladder (& quot-Fermentas"-) — 3 — фрагмент ДНК, кодирующий антигенозначимый участок нуклеокапсидного белка вируса Ласса- б: 1 -фрагмент ДНК, кодирующий антигенозначимый участок нуклеокапсидного белка вируса Марбург- 2 — ДНК-маркер 100bp Ladder (& quot-Axygen"-) — 3 — продукты рестрикции после обработки фрагмента, кодирующего антигенозначимый участок нуклеокапсидного белка вируса Марбург, рестриктазой EcoR V.
б
2322 п.о. -
*
s_. _. -3708 п.о.
. ----- - -2402 п.о.

— -1306 п.о. *ШШ0


500 п.о. -
*******
100 п.о. -
-2402 п.о.
-331 п.о.
Рис. 2. Рестрикционный анализ рекомбинантных плазмид pJC40/6/8 NP Lassa и pJC40 NP
Marburg.
Дорожки: а: 1 — Lambda DNA/HindIII Marker (& quot-Fermentas"-) — 2 — линейная форма рекомбинантной плазмиды pJC40/6/8 NP Lassa- 3 — фрагменты рестрикции, полученные в результате обработки плазмидной ДНК pJC40/6/8 NP Lassa рестриктазами BamH I и Hind III- б: 1 — ДНК-маркер 100bp Ladder (& quot-Axygen"-) — 2 — фрагменты рестрикции, полученные в результате обработки плазмидной ДНК pJC40 NP Marburg рестриктазами
BamH I и Hind III.
43
Рис. 3. Электрофоретический анализ рекомбинантных полипептидов вирусов Ласса и Марбург, очищенных методом аффинной
металлохелатной хроматографии.
Дорожки: а: 1 — лизат клеток, содержащий рекомбинантный полипептид вируса Ласса- 2 — лизат бактериальных клеток после обработки ультразвуком и центрифугирования- 3 — лизат клеток после нанесения на колонку- 4, 5 — фракции отмывки- 6, 8 — фракции элюции- 7 — маркер молекулярных масс (& quot-Fermentas"-) — б: 1 — лизат бактериальных клеток, содержащий рекомбинантный полипептид вируса Марбург, после обработки ультразвуком и центрифугирования- 2 — лизат клеток после нанесения на колонку- 3, 4 — фракции отмывки- 5, 6 — фракции элюции- 7 — маркер молекулярных масс (& quot-Fermentas"-).
Оценка антигенной специфичности рекомбинантных полипептидов вирусов Ласса и Марбург
Сыворотка крови, содержащая антитела к вирусу Показатель оптической плотности
рекомбинантный антиген вируса Ласса рекомбинантный антиген вируса Марбург
Марбург 0,134 ± 0,015 1,101 ± 0,0165
Ласса 1,018 ± 0,004 0,137 ± 0,0075
ККГЛ 0,173 ± 0,0065 0,154 ± 0,009
ГЛПС 0,162 ± 0,034 0,158 ± 0,011
Денге 0,119 ± 0,0015 0,12 ± 0,007
Контроль 0,049 ± 0,0015 0,074 ± 0,016
конъюгата
K- 0,15 ± 0,0105 0,175 ± 0,024
ты электрофоретического анализа очищенных рекомбинантных полипептидов. Из рисунка видно, что в результате хроматографии во фракциях элюции, дорожки 6, 8 (а), освобождается полипептид с молекулярной массой 48 кДа, соответствующей теоретически рассчитанной, включающий 6/8 аминокислотной последовательности нуклеокап-сидного белка вируса Ласса, а также рекомбинантный полипептид вируса Марбург с молекулярной массой 24 кДа, дорожки 5, 6 (б), включающий антигенозначимый участок нуклеокапсидного белка с 442-го по 549-й а.о.
Для оценки антигенной активности, а также возможности полученных рекомбинантных полипептидов перекрестно реагировать с антителами к другим возбудителям особо опасных геморрагических лихорадок осуществляли постановку ИФА с сыворотками, содержащими антитела к вирусам лихорадки денге, ККГЛ, ГЛПС, лихорадки Ласса, лихорадки Марбург. Результаты исследования представлены в таблице.
Из таблицы видно, что оба рекомбинантных полипептида способны связывать соответствующие специфические антитела, присутствующие в сыворотках крови, о чем свиде-
тельствуют полученные показатели оптической плотности 1,018 ± 0,004 (для рекомбинантного полипептида вируса Ласса) и 1,101 ± 0,0165 (для рекомбинантного полипептида вируса Марбург).
Таким образом, в результате исследований получены векторные конструкции pJC40/6/8 NP Lassa и pJC40 NP Marburg, позволяющие экспрессировать рекомбинантные полипептиды вирусов Ласса и Марбург в прокариотических клетках Exoli, штамм BL21(DE3). Полученные рекомбинантные полипептиды способны связывать соответствующие специфические антитела, что позволяет продолжить дальнейшее изучение их свойств, а также возможность использования их в качестве антигенных компонентов для создания иммуноферментных диагностических тест-систем.
ЛИТЕРАТУРА
1. Семижон П. А., Фомина Е. Г., Школина Т. В. и др. Антигенные свойства рекомбинантного полипептида, содержащего повторы антигенной детерминанты нуклеокапсидного белка вируса гепатита С // Здравоохранение. — 2006. — № 11. — С. 35--37.
2. Clos J., Brandau S. pJC20 and pJC40- two high-copy-number vectors for T7 RNA polymerase-dependent expression of recombinant genes in Escherichia coli // J. Protein expression and purification — 1994. — Vol. 5. — P. 133--137.
3. Ehichioya D. U., Hass M., Olschlager S. et al. Lassa fever, Nigeria, 2005−2008 // Emerg. Infect. Dis. 2010 Jun- Vol. 16. — N 6. — P. 1040−1041.
4. Laemmli U. K. Cleavage of structural proteins during the assembly of the bacteriophage T4 // Nature. -- 1970. -- Vol. 227, N 52. -- P. 680--685.
5. McCormick J. B., King I. J., Webb P. A. et al. A case- control study of the clinical diagnosis and course of Lassa fever // J. Infect. Dis. -1987. -- Vol. 155. P. 445−455.
6. McCormick J. B., Webb PA., Krebs J. W. et al. A prospective study of the epidemiology and ecology of Lassa fever // J. Infect Dis. — 1987. -- Vol. 155. -- P. 437--444.
7. Sanchez A., Geisbert T. W., FeldmannH. Filoviridae: Marburg and Ebola viruses // Fields virology. — 5th ed. — Philadelphia, 2006. — P. 1409.
Поступила 10. 05. 11
44

ПоказатьСвернуть
Заполнить форму текущей работой