Получение новой секретируемой рибонуклеазы Bacillus sp. На основе рекомбинантного штамма Bacillus megaterium

Тип работы:
Реферат
Предмет:
Медицина


Узнать стоимость

Детальная информация о работе

Выдержка из работы

УДК 577. 152. 314
Е. В. Дудкина, В. В. Ульянова, Р. Шах Махмуд, А. К. Гальцова, Е. В. Никитина, В. И. Вершинина, О. Н. Ильинская
ПОЛУЧЕНИЕ НОВОЙ СЕКРЕТИРУЕМОЙ РИБОНУКЛЕАЗЫ BACILLUS SP. НА ОСНОВЕ
РЕКОМБИНАНТНОГО ШТАММА BACILLUS MEGATERIUM
Ключевые слова: биназа, рибонуклеаза Bacillus sp., Bacillus megaterium PV370.
Сконструирована новая экспрессионная система на основе штамма B. megaterium PV370. Ген новой рибонук-леазы Bacillus sp. (RBT) клонирован под контроль сильного Pspac промотора, транскрипция которого индуцируется изопропил-в-D-1-тиогалактопиранозидом (ИПТГ). Полученная векторная система позволит сократить время синтеза фермента и увеличить его выход в несколько раз в сравнении с природным продуцентом. Результаты проведенной работы могут служить основой для последующего выделения и очистки рекомби-нантного белка RBT в препаративных количествах с целью исследования его биологических свойств.
Keywords: binase, ribonuclease from Bacillus sp., Bacillus megaterium PV370.
The new expression system based on the strain B. megaterium PV370 was constructed. The gene of new RNAse from Bacillus sp. (RBT) was cloned under the control of strong Pspac promoter, transcription of the gene was induced by isopropyl fi-D-1-thiogalactopyranoside (IPTG). The new plasmid system allows us to reduce the time of synthesis of the enzyme and to increase the yield of enzyme production by several times in comparison with the natural producer. The results of this work may provide a basis for the subsequent isolation and purification of the recombinant protein RBT in preparative quantities to study its biological properties.
Введение
Рибонуклеазы — ферменты класса гидролаз, играющие ключевую роль в метаболизме РНК [1]. РНКазы осуществляют гидролиз мРНК, участвуют в превращении предшественников РНК в зрелые формы, а также обеспечивают продукцию малых регу-ляторных РНК [2]. Помимо своей основной функции, рибонуклеазы участвуют в контроле экспрессии генов, росте и дифференцировке клеток, иммунной защите и индукции апоптоза [3]. Особое внимание уделяется биологическим эффектам РНКаз, таким, как: контроль роста кровеносных сосудов, противовирусная и противоопухолевая активность.
Одной из задач медицины является разработка щадящих методов лечения онкологических заболеваний, поскольку современные противоопухолевые агенты зачастую малоэффективны вследствие недостаточного избирательного действия по отношению к раковым клеткам [4]. Поскольку для ряда РНКаз показана селективная цитотоксичность, их рассматривают в качестве перспективных терапевтических средств в лечении злокачественных новообразований. На сегодняшний день наиболее известным ферментом для противоопухолевой терапии является РНКаза лягушки Rana pipiens — онко-наза, которая проходит III стадию клинических испытаний против мезотелиомы легких [5].
Среди терапевтически значимых РНКаз у РНКаз животного происхождения отсутствуют нежелательные иммунных реакции, однако, их активность блокируется действием специфического цитозольного ингибитора, предохраняющего животные клетки от токсического действия собственных РНКаз [6]. В связи с этим перспективными в лечении опухолевых заболеваний являются РНКазы, филогенетически отдаленные от своих аналогов у млекопитающих, такие, как
РНКазы амфибий, грибов и микроорганизмов, нечувствительные к действию ингибитора [7]. В частности, РНКаза Bacillus intermedius 7Р — биназа (12 кДа, 109 аминокислотных остатков, pI 9,5) селективно ингибирует рост клеток аденокарциномы легких А549 [8] и лейкоза Касуми [9].
Естественный аналог биназы — секретируе-мая РНКаза Bacillus thuringiensis var. subtoxicus B388 (RBT) — была впервые описана в начале 90-х годов, установлена ее аминокислотная последовательность и охарактеризованы каталитические свойства [10]. RBT отличается от биназы только заменой аминокислоты аланина (Ala106) на треонин (Thr106) [11]. Сравнительный анализ двух природных РНКаз внесет вклад в понимание роли определенных аминокислот, а именно неполярного гидрофобного ала-нина молекулы биназы в механизм ее противоопухолевой активности и позволит в дальнейшем сопоставить ее с предполагаемым противоопухолевым действием гомологичной РНКазы RBT, где Ala106 заменен на полярный незаряженный треонин. В связи с этим целью настоящей работы стало выделение RBT для последующего исследования ее молекулярных и биологических свойств.
Материалы и методы исследования
Штаммы, плазмиды и условия роста. В
работе использовали штаммы бактерий Escherichia coli DH5a, Bacillus megaterium PV370, Bacillus subti-lis 168 (BGSC, The Ohio State University, США) и Bacillus thuringiensis var. subtoxicus B388 (Центр Биоинженерии РАН, Москва). Ген РНКазы B. thu-ringiensis var. subtoxicus B388 (RBT) был получен из коллекции Центра Биоинженерии РАН (Москва) на плазмиде pLS1, несущей также ген ингибитора РНКазы — барстара. Для клонирования этого гена был выбран коммерческий вектор pDG148 с индуцируемым промотором Pspac. Транскрипция клони-
рованного гена активируется добавлением в среду изопропил-P-D-i -тиогалактопиранозида (ИПТГ). Культивирование бактерий проводили на жидком или агаризованном L-бульоне в шейкере-инкубаторе с интенсивностью качания 200 об/мин при температуре 37 °C. При выращивании рекомбинантных штаммов в питательную среду добавляли антибиотики: для Escherichia coli DH5a — ампициллин (100 мкг/мл), время инкубации составляло 14−16 ч., для рекомбинантного штамма Bacillus megaterium PV370 — канамицин (10 мкг/мл), бактерии выращивали 18−24 ч.
Генетические конструкции
Для создания плазмидной конструкции, содержащей RBT и барстар под контролем индуцируемого промотора Pspac, клонируемый фрагмент встроили в вектор pDG148. Исходный ген RBT с барстаром вначале амплифицировали с плазмиды pLS1, а затем с pMZ58, полученной на кафедре микробиологии КФУ [12] и модифицированной нами. ПЦР проводили с использованием в качестве прай-меров следующих олигонуклеотидов, содержащих сайты узнавания эндонуклеаз рестрикции HindIII и SphI:
F-Hind: GGAAGTCAAGCTTCCTTAA-TAGGAGGATGAAGATG R-Sph:
TAGTCGGCATGCGTTTCCATATTGTTCATCTCC
Условия реакции: 94 °C — 2 мин., 94 °C — 1 мин., 53 °C — 1 мин., 72 °C — 1 мин., всего — 30 циклов, с заключительным синтезом при 72 °C в течение 5 мин. Реакцию проводили с использованием тер-моциклера «MJ MINI» производства фирмы «Bio Rad». ПЦР-продукт, содержащий сайты рестрикции Hind III и Sph I, и ДНК вектор pDG148 гидролизова-ли рестриктазами HindIII и SphI фирмы «Сибэнзим» (Россия). Рестрикцию плазмидной ДНК проводили при температуре 370С в течение 3 часов, амплифи-цированный фрагмент рестрицировали 1 час. Количество ДНК вектора в реакции составляло 4−6 мкг, ПЦР-продукта — 500 нг. Рестриктазы инактивирова-ли при температуре 800С в течение 20 минут.
С целью очистки рестрицированного вектора и ПЦР-фрагмента от гидролизованных олигонук-леотидов и различных примесей, которые могут препятствовать работе Т4-лигазы, плазмидную ДНК наносили на агарозный гель и выделяли из геля с использованием набора «Gel Extraction kit» «Fermentas» (Литва). ПЦР продукт очищали при помощи «GeneJet PCR Purification Kit» «Fermentas» (Литва) в соответствии с инструкцией производителя. Продукт амплификации лигировали с вектором pDG148 с использованием Т4 — лигазы «Fermantas» (Литва). Лигирование проводили при температуре 220С в течение 12−14 ч. Лигазной смесью трансформировали компетентные клетки E. coli DH 5 a.
Трансформация и анализ рекомбинант-ной плазмидной ДНК. Компетентные клетки E. coli DH 5 a готовили с использованием CaCl2 [13]. Ночную культуру E. coli DH 5a пересевали на свежую среду LB и выращивали до оптической плотности 0. 5−0.8. Клетки центрифугировали, осадок промывали ледяным стерильным 0. 1 М MgCl2 и инкубирова-
ли на льду в течение 10 мин. Далее бактериальную культуру снова центрифугировали, осадок ресус-пендировали в ледяном стерильном 0.1 М CaCl2. Процедуру повторяли дважды. Лигазной смесью трансформировали компетентные клетки E. coli DH5a. К 100 мкл химически компетентных клеток добавляли ½ объема лигазной смеси. Клетки подвергали температурному шоку, выдерживая во льду в течение 30 мин, затем при 42оС — 90 сек., и снова во льду в течение 2 мин. К клеткам добавляли 800 мкл среды SOC, инкубировали в течение 1 ч при 37оС, высевали на чашки с L — агаром и ампициллином, инкубировали при 37оС 14−16 часов.
Для подтверждения встраивания клонируемого фрагмента в состав вектора pDG148, плазмиды выделяли из рекомбинантных клонов E. coli DH 5a методом щелочного лизиса [14] и анализировали с помощью ПЦР и рестрикционного анализа, условия экспериментов описаны выше.
Для выделения плазмид клетки 16-ти часовой культуры E. coli DH5a осаждали. Осадок ресус-пензировали в 350 мкл буфера 1 (100 мг/мл РНКазы
A, 10 мМ ЭДТА, 50 мМ трис-HCl, pH 8. 0). Затем добавляли 350 мкл буфера 2 (200 мМ NaOH и 1% SDS), осторожно перемешивали и инкубировали на льду в течение 5 мин. Далее добавляли 350 мкл буфера 3 (3M CH3COOK, pH 5. 5) и перемешивали. Смесь центрифугировали, супернатант переносили в новую пробирку, добавляли 660 мкл изопропанола и инкубировали 10 мин при комнатной температуре. Затем осадок промывали 400 мкл 70% этанола. Этанол полностью удаляли, осадок высушивали в течение 10 — 15 мин и затем ресуспендировали в 30 мкл ультрачистой воды (MilliQ). После подтверждения успешно проведенного клонирования, рекомби-нантной конструкцией трансформировали штамм
B. megaterium PV370 [15]. Культуру B. megaterium PV370 инкубировали на вибростенде 12−14 часов в 3 мл компетентной среды Спицайзена (солевая основа- 10 мл, 20% глюкоза — 0. 25 мл, триптофан (2 мг/мл) — 0.1 мл, 1 М MgSO4 — 0. 06 мл, 20% казами-новая кислота — 0. 01 мл) при 37 °C, 200 об/ мин. Солевая основа была получена путем разведения минимальных солей Спицайзена в 5 раз (г/л) -(NH4)2SO4 — 1. 0- K2HPO4 — 7. 0- KH2PO4 — 3- цитрат Na — 0. 5- MgSO4*7H2O — 0. 1- рН — 7. 4). 0.3 мл ночной культуры пересевали в 3 мл свежей среды ММ, выращивали 3 часа. Затем добавляли 3.3 мл теплой голодной среды (SZ — 10 мл, 20% глюкоза — 0. 25 мл, 1 М MgSO4 — 0. 06 мл) и инкубировали 2 часа. К 300 мкл компетентных клеток добавляли 10 мкл ДНК, инкубировали 1 час. Трансформированные клетки высевали на чашки с агаризованной средой (L-агар) и канамицином (10 мкг/ мл), инкубировали при 37оС в течение 24 часов. О результатах клонирования судили по наличию у клонов РНКазной активности, индуцируемой добавлением 0.5 мМ ИПТГ.
Активность РНКаз. РНКазную активность определяли по методу Джеффриса, клоны выращивали на чашках Петри со средой БФС (г/л) (трис оксиметиламинометан — 6. 05- хлорид калия — 5. 0- хлорид натрия — 1. 0- сульфат аммония — 2. 0- цитрат натрия — 1. 0- сульфат магния — 0. 2, глюкоза — 5. 0, рН
среды 8. 5), содержащей дрожжевую РНК (5 мг/мл) и канамицин (10 мкг/мл). Для индукции экспрессии гена рибонуклеазы в среду добавляли 0.5 мМ ИПТГ. О наличии РНКазной активности судили по зонам деполимеризации РНК вокруг колоний, выявляемые добавлением 1 N раствора соляной кислоты [16]. Хроматография Очистка белка на колонке Клетки Bacillus sp. выращивали 24 ч, куль-туральную жидкость отделяли центрифугированием при 4000 об/мин. в течение 30 мин. Надосадочную жидкость подкисляли до рН 2.8 и разбавляли в два раза водой. Белок наносили на колонку диаметром 15 мм, высотой 230 мм, уравновешенной 20 мМ натрий-ацетатным буфером, рН 5. 2, колонку с фосфо-целлюлозой Р-11 промывали тем же буфером до А280 = 0. 05. Затем колонку уравновешивали 20 мМ натрий-фосфатным буфером, рН 7.2 до полного уравновешивания сорбента. Элюцию белка проводили 200 мМ натрий-фосфатным буфером, рН 7.2. Скорость элюции составляла 60 мл/час. Жидкостная хроматография Жидкостную хроматографию быстрого разрешения проводили на колонке Mono S/1 (BioRad, США) с использованием системы FPLC BioLogic DuoFlow фирмы (BioRad, США). Белки хромато-графировали в линейном градиенте концентрации NaCl от 0 до 1,0 М в 20 мМ натрий-фосфатном буфере, рН 7.2. Скорость элюции составила 1 мл/мин.
Результаты и обсуждение
В 1992 году Дементьевым с соавторами была выделена и предварительно охарактеризована внеклеточная щелочная рибонуклеаза, синтезируемая штаммом Bacillus thuringiensis var. subtoxicus B388 [17]. Важнейшими характеристиками цитоток-сичности РНКаз являются каталитическая активность и катионность фермента [1]. Последнее свойство позволяет РНКазам связываться с поверхностью опухолевых клеток, имеющих более высокий отрицательный заряд по сравнению с нормальными [1]. Высокая степень сходства первичной последовательности RBT с биназой предполагает наличие у RBT схожих цитотоксических свойств, которые на сегодняшний день не изучены.
Нами был проведен биоинформационный анализ, который выявил, что геном бактерий вида Bacillus thuringiensis не имеет в своем составе генов, гомологичных генам рибонуклеаз
(http: //blast. ncbi. nlm. nih. gov/Blast. cgi), хотя Bacillus thuringiensis var. subtoxicus B388 был выбран Дементьевым [17] в ходе внутривидового скрининга штаммов B. thuringiensis как штамм с максимальным уровнем секреции рибонуклеазы. По всей видимости, видовое название бактерии не соответствует современной классификации микроорганизмов, в связи с чем мы обозначаем данный микроорганизм как Bacillus sp.
Для исследования биологических свойств новой рибонуклеазы фермент был выделен и очищен с использованием жидкостной хроматографии быстрого разрешения. В ходе разработки оптимального метода выделения исследуемого белка мы ис-
ключили ряд малоэффективных и трудоемких стадий препаративной очистки, описанные ранее в работах Чепурновой и Дементьева [17]. Белок сорбировали «в объеме» с использованием фосфоцеллю-лозы Р-11 при кислых значениях рН. Элюцию проводили 200 мМ натрий-фосфатным буфером, рН 7. 2, выход РНКазы по активности составил 75% (табл. 1). На заключительном этапе выделения исследуемого белка РНКазу очищали с использованием жидкостной хроматографии быстрого разрешения в линейном градиенте NaCl от 0 до 1 М. Выход фермента по активности на этой стадии составил 27%. РНКаза элюировалась при концентрации NaCl в 20 мМ натрий-фосфатном буфере около 0.3 М (рис. 1).
Выделение и очистка новой рибонуклеазы показали неэффективность использования нативно-го штамма Bacillus sp. в качестве продуцента исследуемого фермента, поскольку время роста штамма, необходимое для синтеза RBT, было длительным (более 20 ч), а выход и активность фермента были низкими (табл. 1). С целью получения рекомбинант-ного штамма с повышенным уровнем RBT, где синтез фермента находится под контролем индуцируемого промотора, была создана новая экспрессионная система на основе штамма B. megaterium PV370. Ген RBT был встроен в вектор pDG148 под контроль сильного индуцируемого промотора Pspac.
Таблица 1 — Схема выделения RBT из культу-ральной жидкости нативного штамма Bacillus sp.
Стадия очистки Объем (V), мл Общая акт-ть белков, А280 РНКазная акт-ть, A, ед./ мл Выход по акт-ти, %
Фильтрат культуральной жидкости 50 83 25 600 100
Культуральная жидкость после обработки кислотой 100 17,9 12 500 49
Элюция 200 мМ натрий-фосфатным буфером, рН 7.0 32 2 15 000 75
После рехро-матографии на фосфоцел. в линейном градиенте №С1 2 1 4 800 27
Рис. 1 — Рехроматография RBT на FPLC: 1 — А280, 2 — градиент NaCl (от 0 — 1.0 М) в 20 мМ натрий-фосфатном буфере, 3 — элюция RBT
Транскрипция гена запускалась добавлением в среду ИПТГ. Клонирование гена РНКазы проводили в штамме E. coli Top 10, в качестве штамма -продуцента RBT был выбран B. megaterium PV370. Схема получения векторной конструкции представлена на рисунке 2. B. megaterium широко используется в промышленности, на его основе создано огромное количество коммерческих экспрессионных систем, обеспечивающих высокий уровень продукции рекомбинантных белков. Данный микроорганизм имеет ряд преимуществ, обуславливающих его использование в биотехнологии. Клеточная стенка B. megaterium не содержит эндотоксинов, микроорганизм не синтезирует в среду щелочных протеаз, трансформированные плазмиды высокостабильны и не элиминируются [18]. Перечисленные свойства облегчают выделение и очистку рекомбинантного белка, а также обеспечивают высокий уровень синтеза белкового продукта. Для получения рекомби-нантного микроорганизма, синтезирующего RBT, штамм B. megaterium PV370 трансформировали векторной конструкцией, содержащей клонированный ген. Клоны анализировали по наличию индукции РНКазной активности на среде с ИПТГ. Положительным контролем служил исходный штамм Bacillus sp., отрицательным — бесплазмидный штамм B. megaterium PV370. Анализ клонов выявил наличие трансформантов B. megaterium PV370, у которых добавление ИПТГ в 3−4 раза увеличивало РНКазную активность относительно контроля, что говорит об успешно проведенном клонировании.
Hind III
Рис. 2 — Схема клонирования гена КЕТ и барста-ра в вектор рБС148. А — Ами. инфицированный ген КЕТ и барстара, а также вектор рБС148, рестрицировали по сайтам Нш^П и 8рЫ- Б -Продукты рестрикции лигировали, ген КЕТ и барстара клонировали в вектор рБС148 по сайтам Нш^П и 8рЫ
Кроме того, индуцированный ИПТГ лизис РНК трансформантами начинался на 8ч культивирования- диаметр зон лизиса составил 15−18 мм, тогда как у нативного штамма к этому времени фермент вызывал образование лишь незначительных (4−5 мм) зон лизиса субстрата (рис. 3).
А В
Рис. 3 — РНКазная активность клонов B. megaterium 7а35, трансформированных векторной конструкцией, на твердой среде БФС без ИПТГ Левая чашка: 1 — бесплазмидный штамм B. megaterium PV370- 2,3 — трансформанты рекомбинант-ного штамма B. megaterium PV370- (Правая чашка) — на среде с добавлением 0,5 мМ ИПТГ
Создание экспрессионной системы на основе B. megaterium PV370, где ген РНКазы находится под контролем Pspac-промотора, индуцируемого ИПТГ, позволит нам сократить время синтеза фермента при последующем его выделении из жидкой среды и в несколько раз увеличить выход в сравнении с природным продуцентом. Таким образом, результаты проведенной работы могут служить основой для последующего выделения и очистки рекомбинант-ного белка RBT в препаративных количествах с целью исследования его биологических свойств.
Работа выполнена при финансовой поддержке ФЦП & quot-Научные и научно-педагогические кадры инновационной России& quot- на 2009 — 2013 годы (ГК№ 16. 740. 11. 0611 от 31. 05. 2011).
Литература
1. Ильинская О. Н., Макаров А. А. Почему рибонуклеазы вызывают гибель раковых клеток // Молекулярная биология. 2005. Т. 39. № 1. С. 3 — 13.
2. Deutscher M.P., Li Z. Exoribonucleases and their multiple roles in RNA metabolism // Prog. Nucleic Acid Res. Mol. Biol. 2001. V. 66. P. 67 — 105.
3. Ulyanova V.V., Vershinina, V.I., Ilinskaya O.N. Barnase and binase: twins with distinct fates // FEBS J. 2011. V. 278. P. 3633 — 3643.
4. Эдельвейс Э. Ф. Иммунобарназные конъюгаты для диагностики и терапии рака // Институт биоорганической химии. Москва. 2010. 196 л.
5. Mikulski S.M. et. al. Phase II trial of a single weekly intravenous dose of rapirnase in patient with unresectable malignant mesothelioma // J. Clin. Oncol. 2000. V. 20. P. 274 -281.
6. Leland P., Raines R. Cancer chemotherapy — ribonucleas-es to the rescue // Chemistry and Biology. 2001. V.8. № 5. P. 405 — 413.
7. Sevcik J., Urbanikova L., Leland P.A., Raines R.T. X-Ray structure of two crystalline forms of a Streptomycete ribo-nuclease with cytotoxic activity // J. Biol. Chem. 2002. V. 277. № 49. P. 47 325 — 47 330.
8. Cabrera-Fuentes H.A. et. al. Internalization of Bacillus intermedius ribonuclease (binase) induces human alveolar adenocarcinoma cell death // Toxicon. 013. Mitkevich V.A. et. al. Sensitivity of acute myeloid leukemia Kasumi-1 cells to binase toxic action
9. depends on the expression of KIT and AML1-ETO oncogenes // Cell Cycle. 2011. V. 10. P. 4090 — 4097.
10. Деменьтьев А. А., Орлов В. М., Шляпников В. М. Полная первичная структура рибонуклеазы бактерии Bacillus thuringiensis // Биоорганическая химия. 1993. Т. 19. С. 853 — 861.
11. Шульга А. А. и др. Рибонуклеаза из Bacillus thuringiensis var. subtoxicus // Биоорганическая химия. 2000. Т. 9. С. 673 — 679.
12. Морозова О. В., Регуляция биосинтеза внеклеточных гуанилспецифичных рибонуклеаз Bacillus circulans и
Bacillus thuringiensis: автореф. дис. канд. биол. наук: 03. 00. 07. Казань. 2000. C. 23.
13. Sarkar S., Choudhuri S., Basu T. Curr. Sci. 2002. Р. 1376 — 1380.
14. Sambrook J., Rusell D. W. Molecular Cloning. 3rd ed. Cold Spring Harbor Laboratory Press: New York. 2001. V. 1. Р. 1 — 59
15. Anagnostopoulos С., Spizizen J. Requirements for transformation in Bacillus subtilis // J. Bacteriol. 1961. V. 81. P. 741 — 746.
16. Jeffris G.D., Holtman W.F., Guse D. Rapid method for determining the activity of microorganisms on nucleic acids // J. Bacteriol. 1957. V. 73. P. 61 — 79.
17. Деменьтьев А. А. и др. Внеклеточная щелочная рибонуклеаза Bacillus thuringiensis var. subtoxicus // Молекулярная биология. 1992. Т. 26. Вып. 6. С. 1338 — 1349.
18. Vary P. S. et. al. Bacillus megaterium-from simple soil bacterium to industrial protein production host // Applied Microbiology and Biotechnology. 2007. V. 76. P. 957 — 967
© Е. В. Дудкина — асп. каф. микробиологии К (П)ФУ- В. В. Ульянова — канд. биол. наук, н.с. той же кафедры, u1yanova_vera@mai1. ru- Р. Шах Махмуд — канд. биол. наук, м.н.с. той же кафедры, raihan. shah@gmai1. com- А. К. Гальцова -студ. К (П)ФУ- Е. В. Никитина — канд. биол. наук, доц. каф. технологии пищевых производств КНИТУ, e1enik@mai1. ru- В. И. Вершинина — канд. биол. наук, доц. микробиологии К (П)ФУ, Va1entina. Vershinina@ksu. ru- О. Н. Ильинская — д-р биол. наук, проф., зав. каф. микробиологии К (П)ФУ, o1ga. i1inskaya@ksu. ru.

ПоказатьСвернуть
Заполнить форму текущей работой