Использование ДНК маркеров в селекции свиней

Тип работы:
Реферат
Предмет:
Сельскохозяйственные науки


Узнать стоимость

Детальная информация о работе

Выдержка из работы

вскрытия в обоих случаях установлена 100%-ная эффективность и при сифациозе, и при аспикулюриозе. На основании полученных результатов можно считать оптимальным для мелких лабораторных грызунов 0,05%-ный раствор ивермектина, а терапевтической дозой его для мышей — 0,1 мл/особь (по ДВ примерно 2,0 мг/кг). Поскольку уменьшение концентрации ДВ в растворе, а также объема инъецируемой жидкости было практически неосуществимо, испытание ивермектина в более низких дозах на лабораторных животных не представлялось возможным.
На крысах был апробирован только 0,05%-ный раствор, который в дозе 0,2 мл/100 г массы животного (по ДВ примерно 1 мг/кг) вводили подкожно в область спины. В результате вскрытия установлена 100%-ная эффективность препарата при обоих оксиуратозах.
Заключение
При проведении поиска эффективных антгельминтных средств для лечения оксиуратозов лабораторных мышей и крыс мы учитывали не только безвредность препаратов (отсутствие токсического, эмбриотропного и мутагенного свойств), но и своеобразие применения лекарственных препаратов таким высокочувствительным к запаху и вкусу животным, как крысы и мыши. В связи с этим при разработке оптимальных схем лечения гельминтозов мышей и крыс мы, не прибегая к увеличению разовых доз того или иного препарата, делали ставку на удлинение курса дегельминтизаций. Проведенные эксперименты полностью оправдали наше
предположение: при более длительном курсе лечения грызуны свободно поедали корм с антгельминтиками.
На основании проведенных нами испытаний в качестве средств дегельминтизации при оксиуратозах мышей и крыс мы рекомендуем к применению: фебантел и фенбендазол в дозах соответственно 10,0 и 12,5 мг ДВ/кг в течение 5 дней подряд с кормом групповым способом- а также 0,05%-ный раствор ивермектина подкожно в дозе 2,0 мг/кг для мышей и в дозе 1,0 мг/кг для крыс (соответственно 0,1 мл/25 г массы мышам и 0,2 мл/100г массы крысам) однократно.
Литература
1. Астафьев, Б. А. Экспериментальные модели паразитозов в биологии и медицине [Текст]/ Б. А. Астафьев, Л. С Яроцкий, М. Н Лебедева. — М.: Наука, 1989. — 279 с.
2. Малахова, Н. А. Гельминты лабораторных животных в условиях питомников и вивариев [Текст]/ Н. А. Малахова // Тез. конф. «Лаб. животные для медико-биологических и биотехнологических исследований». — М., 1990. — С. 74.
3. Подопригора, Г. И. Концепция стандартизации лабораторных животных и роль новых биотехнологий в ее практическом осуществлении [Текст]/ Г. И. Подопригора // Тез. Всес. конф. «Актуальные вопросы стандартизации лаб. животных для медико-биологических исследований». — М., 1988. — 4.1. -С. 33−35.
4. Требования к качеству конвенциональных лабораторных мышей: Отраслевые методические указания /временные/ [Текст]. — М., 19 877. — 82 с.
УДК: 636. 4:577. 2
В. И. Крюков, доктор биологических наук A.B. Пикунова, младший научный сотрудник Н. Г. Друшляк, кандидат биологических наук ФГОУ ВПО Орел ГАУ
ИСПОЛЬЗОВАНИЕ ДНК МАРКЕРОВ В СЕЛЕКЦИИ СВИНЕЙ
Описаны методы выявления ДНК маркеров хозяйственно ценных признаков свиней: MC4R, ESR, RYR-1, H-FABP, освоенные в ИНИИЦ ОГАУ. Показаны возможности их использования в селекции.
Ключевые слова: свиньи, ДНК-диагностика, ДНК-маркеры, MC4R, ESR, RYR-1, H-FABP.
В соответствии с Доктриной продовольственной безопасности Российской Федерации, Указ об утверждении которой был подписан президентом России в феврале 2010 года, Россия должна перейти на самообеспечение сельскохозяйственной продукцией к 2020 году
(http: //www. kremlin. ru/news/6752). Одним из условий реализации этой Доктрины должна стать интенсификация производства свинины. В Орловской области развитию этой отрасли животноводства уделяется большое внимание. Стабильное производство свинины требует активного использования современных достижений генетики и селекции [1].
В настоящее время в селекции свиней используют около 100 ДНК маркеров хозяйственно ценных 36
Methods of revealing of DNA of markers of economic valuable signs of pigs are described: MC4R, ESR, RYR-1, H-FABP, mastered in INIIC OGAU. Possibilities of their use in selection are shown.
Key words: pigs, DNA-diagnostics, DNA-markers, MC4R, ESR, RYR-1, H-FABP.
признаков. [2]. Целый ряд анализов доступен для коммерческого использования в России и за рубежом. В свиноводстве используют маркеры, связанные с качеством мяса (HAL1843 (CRC1), RN, CAST), размером приплода/плодовитостью (ESR, PRLR, RBP4), окраской (KIT, MC1R), параметрами роста и содержанием жира (MC4R, AFABP, HFABP, IGF2), устойчивостью к болезням (FUT1) и др. [2]. Большой вклад в развитие ДНК диагностики хозяйственно ценных признаков у свиней сделан в нашей стране специалистами Центра биотехнологии и молекулярной диагностики Всероссийского ГНИИ животноводства академиком РАСХН Л. К. Эрнстом, Н. А. Зиновьвой, Е. А. Гладырь [3, 4].
Для оказания помощи свиноводческим предприятиям Орловской области лаборатория
генетики Инновационного научно-
исследовательского испытательного центра ОрёлГАУ освоила методы выявления полиморфизма четырех генетических систем: гена рецептора меланокортина 4 (MC4R), гена эстроген рецептора (ESR), гена рианодин рецепторного белка (RYR-1) и гена белка, связывающего жирные кислоты (H-FABP). При освоении методов в нашей лаборатории ряд из них был оптимизирован с учётом новых научных данных и рекомендаций.
Цель данной публикации — ознакомить специалистов с протоколами методик, оптимизированных в нашей лаборатории, и показать практикам возможности интенсификации
селекционного процесса по хозяйственно ценным признакам в их хозяйствах.
Материалы и методы исследований
Материалом для исследования служили свиньи породы крупная белая, любезно предоставленные ГНУ Тульский НИИСХ РАСХН.
Генотипирование проводили методом ПЦР-ПДРФ-анализа (табл. 1). ДНК выделяли из крови животных, используя набор DIAtom DNAPrep (Биоком, Россия).
Амплификация была выполнена с помощью набора GenPak PCR Core (Биоком, Россия) на приборе MyCycler (BioRad, США).
Оптимизация методик заключалась в подборе параметров проведения амплификации, в частности -температуры отжига праймеров, подборе параметров проведения рестрикции и визуализации продуктов в геле.
Результаты и обсуждение
Рецепторы эстрогена играют важную роль в метаболизме млекопитающих. В связи с этим гены, кодирующие рецепторы эстрогена рассматриваются как потенциальные маркеры репродуктивных и функциональных признаков [5]. По литературным данным, Pvu II полиморфизм гена эстроген рецептора (ESR) достоверно ассоциирован с размером приплода [6,7]. Эффект варьирует от 1,15 свиней на приплод у китайской породы Мейшан (Meishan synthetics) до 0,42 свиней на приплод у крупной белой породы. Кроме того, увеличение среднего размера приплода наблюдается у пород, произошедших от крупной белой и Мейшан [8]. Kaminski и Wojtasik [9] выявили положительную взаимосвязь между ESR/Ava I полиморфизмом и мясистостью.
Фрагменты, полученные нами при ПЦР-ПДРФ анализе полиморфизма ESR гена, соответствуют описанным Kaminski и Wojtasik [9]. Наличие мутантной аллели (М), приводящей к образованию дополнительного сайта рестрикции рестриктазы AvaI, можно распознать по присутствию трёх фрагментов -76, 62, 47 пн, а в случае отсутствия мутации (аллель W) рестриктаза режет фрагмент на две части — 109 пн и 76 пн. Гетерозиготный носитель мутации (MW) характеризуется присутствием четырёх фрагментов: 109, 76, 62 и 47 пн.
При анализе полиморфизма гена ESR обнаружены 3 особи гомозиготные по W аллели, 2 особи гомозиготные по М аллели и гетерозигота (генотип WM, 1 особь) (рис. 1).
Рисунок 1 -Электрофореграмма ПЦР-ПДРФ генотипирования ESR у свиней (справа указаны размеры фрагментов, пн-
^ внизу: М — маркер 62 молекулярного веса, W 1 и 2 — генотипы WW, 3 — генотип ММ).
М 1 з
Полиморфизм гена белка, связывающего жирные кислоты (H-FABP), связан с содержанием внутримышечного жира у породы Дюрок [10]. При сравнении гомозиготных классов обнаружена разница около 15% от среднего значения содержания внутримышечного жира [11]. Улучшение содержания внутримышечного жира связано не только с предпочтением покупателей мраморного мяса, но и с влиянием на органолептические свойства, такие как внешний вид, нежность и сочность [12].
Фрагменты, полученные в нашей лаборатории при ПЦР-ПДРФ анализе полиморфизма H-FABP гена, соответствуют описанным Li с соавторами [13]. Для, А аллели характерно присутствие двух фрагментов: 683 и 117 пн. У аллели В присутствуют три фрагмента -405, 278 и 117 пн. У гетерозиготных животных АВ присутствуют все 4 фрагмента (683, 405, 278 117пн., рис. 2). Данные, А и В аллели видимо соответствуют D и d аллелям описанным у Gerbens c соавторами (1999) [14].
При анализе полиморфизма гена H-FABP обнаружены гомозиготные по В аллели (3 особи) и гетерозиготные (генотип АВ, 3 особи) генотипы (рис. 2). Аллель В (d) ассоциирована с повышенным содержанием внутримышечного жира [14].
RYR1 — ген рианодин рецепторного белка. Мутантная аллель данного гена (n) связана со стрессочувствительностью и влияет на некоторые параметры качества мяса и продуктивность. Появление такой мутации является одной из причин наследственного заболевания свиней
стрессочувствительности. Ее крайнее проявление -злокачественный гипертермический синдром, а также плохое качество мяса. Все вместе эти признаки называются синдромом свиного стресса [15,16].
Исследования молодняка крупной белой породы показали, что лучшей энергией роста по откормочным качествам обладал срессоустойчивый молодняк, имеющий генотип NN по гену RYR1. Особи с таким генотипом на 22 дня раньше достигали живой массы 100 кг, среднесуточные приросты живой массы были выше на 77 г. В то же время, гетерозиготы (Nn), носители стрессочувствительного гена, отличались от сверстников с генотипом NN пониженной толщиной шпика, большей площадью «мышечного глазка» и большим содержанием мышечной ткани (Черекаевой Е.А., 2007).
Рисунок 2 —
Электрофореграмма ПЦР-ПДРФ генотипирования H-FABP у свиней (мм -маркер молекулярного веса, АВ — генотип образца, цифрами указаны размеры фрагментов, пн)
ММ АВ
Фрагменты, полученные при ПЦР-ПДРФ анализе полиморфизма RYR1 гена, соответствуют описанным КатШЫ и Wojtasik [9]. Мутация С11 843Т приводит к исчезновению сайта рестрикции рестриктазы Нт61, поэтому присутствие мутантной аллели (и) можно распознать по фрагменту 272 пн, а в случае
отсутствия мутации (аллель N рестриктаза режет фрагмент на две части — 149пн и 123 пн. У гетерозиготного образца (Ми), носителя мутации на геле присутствуют три фрагмента: 272пн, 149 и 123 пн.
При анализе полиморфизма гена ЯУЮ обнаружены гомозиготные по N аллели (4 особи) и гетерозиготные N4 (1 особь) генотипы (рис. 3).
В результате оценки полиморфизма гена МС4Я нами получены фрагменты, характеризующие полиморфизм гена, аналогичные описанным и с соавторами [13]. Для, А аллели характерно отсутствие сайта узнавания рестриктазы TaqI поэтому фрагмент, полученный при ПЦР остаётся неизменным (226 пн). У аллели В сайт узнавания есть — рестриктаза режет ПЦР фрагмент на две части — 156 пн и 70 пн. Поэтому у гомозигот ВВ в геле два фрагмента — 156 и 70 пн, а гомозигот АА один фрагмент — 226 пн, (см. рис. 4, образец № 6) и у гетерозиготных животных (АВ) в геле обнаруживаются три фрагмента: 226, 156 и 70 пн, (см. образец № 5).
Таблица 1 — ПЦР-ПДРФ генотипирование ESR, RYR-1, H-FABP, MC4R генов свиней
Ген Праймеры ч5-ч3 Рестриктаза* Литература
ESR эстроген рецептор F: CCCTCTATGACCTGCTGCTG Aval (Ama87 I) [9, 17, 18]
R: TCAGATTGTGGTGGGGAAGTTC
RYR-1 рианодин рецептор F: CTGGGACATCATCCTTCTGG HspAI (Hin6I) [9]
R: GGGTTCTAAGCTCTGGGGTC
H-FABP белок, связывающий жирные кислоты F: ATTGCTTCGGTGTGTTTGAG HaeIII [13,19]
R: TCAGGAATGGGAGTTATTGG
MC4R-рецептор меланокортина 4 F: TACCCTGACCATCTTGATTG TaqI [13, 20, 21]
R: ATAGCAACAGATGATCTCTTTG
*- рестриктазы фирмы Сибэнзим, Россия
маркер образец образец
молекулярного № 3 № 4
веса
Рисунок 3 — Электрофореграмма ПЦР-ПДРФ генотипирования RYR1 у свиней (генотип образца № 3 — NN, генотип образца № 4 — Nn)
Данная методика впервые описана Kim c соавторами (2000). Аллель, А в данной работе именуется — аллель № 2, а аллель В — аллель № 1. 38
В гене рецептора меланокортина 4 (МС4Я) обнаружена мутация, обусловливающая поглощение свиньями большего (^ на 10%) количества корма, более быстрый рост (6−8%) и массу (6−10%) [20]. Контроль данной мутации при селекции может использоваться в селекции направленной как на снижение жира, так и на увеличение [8].
При анализе полиморфизма гена МС4Я обнаружены 4 особи, гомозиготные по, А аллели и 1 гетерозиготная особь (генотип АВ).
Использование полиморфизма НРЛБР гена для маркер-вспомогательной селекции позволяет увеличить содержание внутримышечного жира без влияния на толщину сала [22, 12].
Кат^Ы и Wojtasik 2002 [9] обнаружили связь между? SR-AvaI полиморфизмом и мясистостью у крупной белой породы. Наибольшее значение данного параметра обнаружено у боровов с WM и ММ генотипами.
При генотипировании гена RYR 1 в условиях производства в промышленных хозяйствах, в отличие от племенных, целесообразно использовать животных не только с генотипом NN (стрессоустойчивых), но и с генотипом N4 (стрессоустойчивые носители дефектного гена), что будет способствовать получению качественных показателей мяса и его органолептического состава [23].
m 5 6
Рисунок 4 — Электрофореграмма ПЦР-ПДРФ генотипирования MC4R у свиней (м — маркер молекулярного веса, генотип образца 5 — АВ, генотип образца 6 — АА).
Аллель № 1 (В) гена MC4R ассоциирована с меньшим дневным привесом, употреблением корма и толщиной сала, чем аллель № 2 (А). При отборе животных полиморфизм MC4R гена можно использовать для селекции по вышеперечисленным признакам.
Использование ДНК диагностики интересующих аллелей в селекции и производстве свиней позволяет анализировать генотип особи на ранних этапах развития, ускорить селекционный процесс, улучшить качество получаемой продукции.
Литература
1. Характеристика линейной и внутрилинейной структуры нового типа свиней — «ачинской» с использованием ДНК-микросателлитов [Текст]/ Н. А. Зиновьева, П. В. Ларионова, К. М. Шавырина, В. Г. Мантикова, О. Е. Карелина //Промышленной и племенное свиноводство. — 2006. — № 3. — С. 30−32
2. Steen van der H. A. M. Application of genomics to the pork industry [ТехЦ/ Steen van der H. A. M., G. F. W. Prall, G. S. Plastow // J. Anim. Sci. 2005. 83: E1−8.
3. Зиновьева, Н. А. Оценка животных по генетическим маркерам (использование в свиноводстве) [Текст]/ Н. А. Зиновьева //Промышленное и племенное свиноводство. — 2005. -№ 2. — С. 18−20.
4. Генодиагностика комплексного порока позвоночника (CVM) [Текст]/ Л. К. Эрнст, Н. А. Зиновьева, Е. А. Гладырь, О. В. Костюнина // Современные достижения и проблумы биотехнологии сельскохозяйственных животных. ВИЖ. -Дубровицы, 2006.
5. Szreder Tomasz Estrogen receptors and their genespotential markersof functional and production traits of farm animals [ТехЦ/ Tomasz Szreder, Lech Zwierzchowski. // Mol. Biol. Rep. (2007) V/ 34. P. 207−211.
6. The Estrogen receptor locus is associated with a major gene influencing litter size in pigs. [ТехЦ/ Rothschild, M.F., Jacobson, C., Vaske, D.A., Tuggle,
C.K., Wang, L., Short, T., Erchardt, G., Sasaki, S., Vincent, A., McLaren, D.G., Southwood, O., van der Steen, H., Mileham, A., and Plastow, G. (1996) //Proc. National Acad. Sci. V. 93/ P 201−205.
7. Effect of the Estrogen receptor locus on reproduction and production traits in four commercial pig lines. [ТехЦ/ Short, T. H., Rothschild, M.F., Southwood, O.I., McLaren, D.G., DeVries, A., van der Steen, H., Eckardt, G. R., Tuggle, C.K., Helm, J., Vaske, D.A., Mileham, A.J. and Plastow, G. S (1997) //J. Anim. Sci. V. 75 P. 3138−3142
8. Rothschild Max F. Advances in pig molecular genetics, gene mapping and genomics. //http://www. pdf-finder. com [ТехЦ/ Max F. Rothschild /Advances-in-pig-molecular-genetics,-gene-mapping-and-genomics. html
9. Kaminski, S. Simultaneous identification of ryanodine receptor 1 (RYR1) and estrogen receptor (ESR) genotypes with the multiplex PCR-RFLP method in Polish Large White and Polish Landrace pigs. [ТехЦ/ S. Kaminski, A. Ruoe, K. Wojtasik 2002. // J. Appl. Genet. Vol. 43. N.3. P. 331−335.
10. The adipocyte fatty acid-binding protein locus: characterization and association with intramuscular fat content in pigs. [ТехЦ/ F. Gerbens, A. Jansen, Van Erp A.J.M., F. Harders, T.H.E. Meuwissen, G. Rettenberger, J.H. Veerkamp, Te Pas M.F.W. (1998) //Mammalian Genome V.9. P. 1022−1026.
11. Influence of genetics on pork quality. [ТехЦ/ De Vries, A.G., Timm, H.H., Wilson, E.R., Evans, G., Keller, V., and Plastow, G.S. 999. //In EAAP Proc. Wageningen Pers, Wageningen.
12. Li, Pan and Meng. 2006. Polymorphism of the H-FABP, MC4R and ADD1 genes in the Meishan and four other pig populations in China. //South African Journal of Animal Science, V. 36. N.1. P. 1−6.
13. Liu Yuefu and Pramod Mathur. Heart Fatty Acid Binding Prot. Gene for Improv. Meat Qual. //2003 р. 1−6 (https: //www. ccsi. ca/Reports/Reports 2003/HFABP2. pdf)
14. Effect of genetic variants of the heart fatty acid-binding protein gene on intramuscular fat and performance traits in pigs. [ТехЦ/ Gerbens F., A. J. van Erp, F. L. Harders, F. J. Verburg, T. H. Meuwissen, J. H. Veerkamp and M. F. te Pas. // J. Anim. Sci. 1999. 77: 846 852.
15. Identification of a Mutation in Porcine Ryanodine Receptor Associated with Malignant Hyperthermia [ТехЦ/ Fujii J., Kinya O., Francesco Zorzato, Stella De Leon. 1991. // SCIENCE, VOL. 253, p. 448−451.
16. Рыжова, Н. Ген RYR1 и продуктивность свиней мясных пород [Текст]/ Н. Рыжова, Л. Калашникова // Животноводство России. — 2003. -С. 46−47.
17. Drogemuller, C. An Ava I and a MspA1I polymorphism at the porcine estrogen receptor (ESR) gene. [ТехЦ/ C. Drogemuller, U. Thieven, B. Harlizius (1997). //Anim. Genet. 28: 59.
18. Terman Arkadiusz Estrogen receptor gene (ESR) and semen characteristics of boars [ТехЦ/ Terman Arkadiusz, Marek Kmiec and Daniel Polasik. // Arch. Tierz., Dummerstorf 49 (2006) 1, 71−76.
19. Characterization, chromosomal localization, and genetic variation of the porcine heart fatty acid-binding
protein gene [Text]/ F. Gerbens, G. Rettenberger, A. Johannes, J. Veerkamp, Marinus. 1997. // Mammalian Genome. V. 8. P. 328−332.
20. A missense variant of the porcine melanocortin-4 receptor (MC4R) gene is associated with fatness, growth, and feed intake traits. [Text]/ K. Kim, N. Larsen, N. Short, G. Plastow, M. Rothschild 2000. //Mammalian Genome. Vol. 11. P. 131−135.
21. Stefanon B., Floris R. et al. 2004. A new approach in association study of single nucleotide polymorphism of
genes for carcass and meat quality traits in commercial pigs. [Text]// Ital. J. Anim. Sci. Vol.3 P. 177−189.
22. Gerbens F, de Koning DJ, Harders FL, Meuwissen THE, Janss LLG et al. 2000. The effect of adipocyte and heart fatty acid-binding protein genes on intramuscular fat and backfat content in Meishan crossbred pigs. [Text]// J Anim Sci 78, 552−559.
23. Черекаева, Е. А. Откормочные и мясные качества молодняка свиней разных генотипов по гену RYR1 [Текст]/ Е. А. Черекаева //Промышленное и племенное свиноводство. — 2007. — № 2. — С. 30−31.
УДК: 619: 618. 2/7:636. 4
Д. О. Сеин, кандидат биологических наук ФГОУ ВПО «Курская госсельхозакадемия им. профессора И.И. Иванова» В. Н. Масалов, доктор биологических наук А. К. Ильючик ФГОУ ВПО Орел ГАУ
МОТОРИКА МАТКИ У СВИНЕЙ ПОСЛЕ СТИМУЛЯЦИИ ПОЛОВЫМИ ФЕРОМОНАМИ ХРЯКА
Приведены результаты исследований сократительной функции матки у свиней после стимуляции половыми феромонами хряка. Показано, что феромоны повышают амплитутду, частоту и продолжительность сокращений матки у свиней.
Ключевые слова: амплитуда сокращений, матка, моторика, половые феромоны, стимуляция, свиньи, частота сокращений.
В настоящее время выяснено, что на поведение животных могут влиять не только гормоны -вещества, выделяемые внутреннюю среду эндокринными железами и осуществляющие регуляцию и координацию функций других органов и тканей, но и феромоны — вещества, выделяемые экзокринными железами во внешнюю среду и влияющие на поведение других особей того же вида.
Особую группу среди феромонов составляют половые феромоны, которые выполняют важную роль в химической коммуникации животных. Половые феромоны относятся к «праймер-феромонам», то есть к длительно действующим веществам, с помощью которых особи противоположного пола получают информацию о сексуальной готовности. Именно по половым феромонам животные осуществляют поиск партнёра для спаривания. Например, чернохвостые олени-самцы в брачной период метят себя секретом, возбуждающим самок, благодаря чему самки способны обнаруживать своего «возлюбленного» за несколько километров. Баран улавливает малейшие изменения запаха мочи у овец и таким образом определяет степень их готовности к спариванию. Однако лидером по запахам является кабан, который выделяет с мочой и слюной сильнейший мускусный запах. Содержащиеся в нем половые феромоны, даже в небольшом количестве, улавливаются самками.
Домашние свиньи также обладают выраженной феромональной активностью. Нами был проведён следующий эксперимент. В ветеринарной клинике Курской ГСХА в одной из комнат с большой площадью были разложены в разных местах
Results of researches reduction functions of a uterus at pigs after sexual stimulation of pheromones a male pig are resulted. It is shown that pheromones raise amplitude, frequency and duration from a uterus at pigs.
Key words: amplitude of reductions, uterus, motility, sexual pheromones, stimulation, pigs, frequency of reductions.
небольшие ватно-марлевые тампоны, обработанные дистиллированной водой, отваром комбикорма, мочой свиноматки, мочой половозрелого хряка и мочой 2-месячного хрячка. Было установлено, что из всех тампонов свиноматку привлёк внимание только тампон, обработанный мочой половозрелого хряка, который она очень быстро обнаружила. При этом было отмечено, что свиноматка, находившаяся в половой охоте, обнаруживала тампон с мочой взрослого хряка значительно быстрее, чем свиноматка вне половой охоты. Ей для этого потребовалось всего несколько секунд. То есть у самки в период сексуальной активности значительно повышается чувствительность к половым феромонам самца. В свою очередь самцы безошибочно обнаруживают из множества самок именно ту, которая проявляет половую охоту. Все вышеуказанные примеры связаны с половыми феромонами, которые выделяют особи противоположного пола.
В настоящее время известно, что стабильными компонентами половых феромонов хряков является стероид андростенон-5а-андрост-16-ен-3-он и соответствующий кетон — андростенол-5а-андрост-16-ен-3-ол, которые синтезируются в семенниках и с кровью разносятся по всему организму. Данные вещества содержатся в относительно большом количестве в моче и слюне хряков. Значительно меньше их в мышцах и жировой клетчатке. однако этого достаточно, чтобы из-за неприятного запаха сделать свинину практически непригодной к употреблению.

ПоказатьСвернуть
Заполнить форму текущей работой