Поражение зарази-хой (Orobanche сumana Wallr.) образцов подсолнечника коллекции ВИР и молекулярное диффе-ренцирование контрастных по устойчивости растений

Тип работы:
Реферат
Предмет:
Сельскохозяйственные науки


Узнать стоимость

Детальная информация о работе

Выдержка из работы

ISSN 0202−5493. МАСЛИЧНЫЕ КУЛЬТУРЫ. Научно-технический бюллетень Всероссийского научно-исследовательского института масличных культур. Вып.2 (148−149), 2011
Иммунитет и защита растений
Т.А Челюстникова,
старший научный сотрудник С. З. Гучетль,
кандидат биологических наук Н. М. Арасланова,
кандидат сельскохозяйственных наук, Т. С. Антонова,
доктор биологических наук
ГНУ ВНИИМК Россельхозакадемии
Россия, 350 038, г. Краснодар, ул. Филатова, д. 17
Тел. (861) 275−86−53, e-mail: antonova@ au. ru
ПОРАЖЕНИЕ ЗАРАЗИХОЙ (Orobanche cumana Wallr.) ОБРАЗЦОВ ПОДСОЛНЕЧНИКА КОЛЛЕКЦИИ ВИР И МОЛЕКУЛЯРНОЕ ДИФФЕРЕНЦИРОВАНИЕ КОНТРАСТНЫХ ПО УСТОЙЧИВОСТИ РАСТЕНИЙ
Ключевые слова: подсолнечник, заразиха, устойчивость, полиморфизм
УДК 633. 854. 78:631. 52
Подсолнечник — один из значимых источников растительного масла в мире и основной — в Российской Федерации. В настоящее время мощным ограничивающим фактором в производстве подсолнечника в Ростовской и Волгоградской областях, а также в ряде районов Ставропольского и Краснодарского краев является заразиха (Orobanche cumana Wallr.). Заразиха — паразитическое цветковое растение, не содержащее хлорофилла, использует воду, а также органические и минеральные вещества растения-хозяина, обладает высоким потенциалом воспроизводства. Поражение подсолнечника заразихой значительно снижает урожай, а многочисленные осыпающиеся семена засоряют почву, сохраняя всхожесть до 20 лет, ухудшая тем самым состояние посевов в последующие годы.
Основным способом борьбы с этим злостным сорняком является поиск источников
генетической устойчивости к новым вирулентным расам паразита и вовлечение их в селекционные программы. Более высока вероятность обнаружения генов устойчивости в коллекциях дикорастущих видов, однако существует некоторая устойчивость к заразихе и у культурного подсолнечника [1- 2].
Использование молекулярных технологий позволяет избежать фенотипических ошибок при отборах, дает возможность сократить сроки для создания материала с генами устойчивости к новым расам заразихи и таким образом ускорить селекционный процесс. Молекулярные маркеры, сцепленные с генами устойчивости к заразихе, могут стать полезным инструментом для контроля переноса генов и быстрой идентификации индивидов с интересующим селекционеров признаком [1- 3- 4].
Tang и соавторы (2003) идентифицировали молекулярные маркеры, сцепленные с геном Or5, определили положение этого локуса на молекулярной генетической карте подсолнечника [3]. Авторы предполагают, что эта область ответственна у подсолнечника за генетическую устойчивость к заразихе расы Е. Lu и соавторы (2000) идентифицировали пять SCAR (sequence characterized amplified region) маркеров в одной группе сцепления с геном Or5. Предложенная группа маркеров может быть использована для проведения массового сегрегационного анализа, для насыщения зоны, приближенной к гену Or5, новыми молекулярными маркерами [4]. Солоденко с соавторами, (2003) выявили полиморфные фрагменты амплификации ДНК, дифференцирующие устойчивые и восприимчивые к заразихе растения, определили сцепление молекулярного маркера и локуса Or3 [5]. Используя опыт и результаты исследований, проведенных в мире, мы начали молекулярное дифференцирование устойчивых и восприимчивых растений подсолнечника к заразихе, собранной в регионах РФ.
Целью нашей работы являлась оценка устойчивости образцов подсолнечника коллекции ВИР к заразихе и поиск молекулярных различий между устойчивыми и восприимчивыми растениями.
Материалы и методы. Для выявления устойчивых к заразихе генотипов использованы 500 образцов мировой коллекции культурного подсолнечника ВИР и испанская линия Р 96, устойчивая к расам заразихи от, А до F.
Семена подсолнечника сеяли в короба, заполненные смесью просеянной почвы с речным песком в соотношении 3:1. В почвенную смесь вносили семена заразихи, собранные в Тацинском районе Ростовской области, из расчета 200 мг семян на 1 кг почвы. По ранее опубликованным данным, в этой популяции заразихи высока концентрация высоковирулентных рас E, F, G [6].
Растения подсолнечника выращивали в теплице в течение 30 дней при температуре 22−25°С при 16 часовом фотопериоде. Через 30 дней после появления всходов проводили их оценку на устойчивость к заразихе. Восприимчивыми считались растения, на корнях которых были обнаружены клубеньки заразихи или сформировавшиеся побеги- устойчивыми — растения, на корнях которых не было обнаружено здоровых клубеньков и побегов, но были видны многочисленные некрозы клеток в области проникновения проростков заразихи и погибшие клубеньки. Учитывали процент пораженных растений и степень поражения. Степень поражения учитывали как среднее количество клубеньков и цветоносов паразита на одно поражённое растение. В качестве контроля был использован сорт ВНИИМК 8883, не обладающий устойчивостью к современным расам О. ситапа.
Для молекулярного анализа отбирали по два настоящих листа с растения. Выделение ДНК проводили по модифицированному методу Saghai-Maroof et а1. [7]. Ткани листьев гомогенизировали с 0,9 мл СТАВ буфера, в течение часа инкубировали при температуре 65 оС. Затем добавляли половину объема смеси хлороформа и изоамилового спирта (24: 1) и тщательно перемешивали с последующим центрифугированием. Очистку хлороформом проводили дважды. Осаждение ДНК проводили охлажденным до -20 оС изопропаноло-вым спиртом. Подсушенную ДНК растворяли в течение 12 часов в стерильной воде. Концентрацию ДНК в полученном препарате определяли по интенсивности свечения пробы объемом 10 мкл в ультрафиолетовом свете в 1% -ном агарозном геле с содержанием бромистого этидия.
Для проведения полимеразной цепной реакции использовали 25 мкл реакционной смеси следующего состава: 67 мМ трис-HCl, рН 8,8- 16,6 мM сульфата аммония- 2,5 мM MgCl2- 0,01% Tween 20- по 0,2 мM дезокси-рибонуклеозид фосфатов- по 10 пМ прайме-
ров- 10 нг матричной ДНК и 1 ед. рекомби-нантной термостабильной ДНК полимеразы (Москва, ГосНИИгенетика). Амплификацию проводили в приборе Терцик (ДНК-технология, Россия). Для амплификации ДНК применяли нуклеотидные последовательности пяти пар SCAR-праймеров, сконструированных [4] (см. табл. 2). Термальный режим реакций подбирали для каждой пары прайме-ров с учетом их нуклеотидного состава. Для большинства проведенных реакций оптимальным оказался режим амплификации с начальной денатурацией при 96 оС в течение 2 мин, затем 30 циклов при соблюдении тем-пературно-времен-ного режима: отжиг при 60−65 оС в течение 40 сек, элонгация — 1 мин при 70 оС, денатурация при 94 оС — 30 сек, финальная элонгация — 2 мин.
Электрофоретическое разделение продуктов амплификации проводили в агарозном геле (2% агароза, 1*ТАЕ-буфер) с использованием камеры для горизонтального электрофореза (SE. 1, ДНК-технология, Россия) в течение 1−1,5 часов при силе тока 50 mA, напряжении 90−100 V. Документирование результатов электрофореза обеспечивалось при помощи гель-документирующей видеосистемы BIO-PRINT (Vilber Lourmat, Франция).
Результаты и обсуждение. Расовый состав популяций заразихи динамичен, находится в зависимости от преобладающего сортимента подсолнечника в регионе. Задачей селекционеров является поиск источников устойчивости к новым вирулентным расам и создание сортов и гибридов с привнесением в них генов устойчивости. В связи с этим и проведена оценка устойчивости образцов культурного подсолнечника мировой коллекции ВИР, различающихся по происхождению. Результаты приведены в таблице 1. Большая часть тестированного материала в разной степени, но стопроцентно поражалась заразихой. По степени поражения образцы коллекции ВИР условно можно разделить на три группы. Первая группа включает образцы со степенью поражения на уровне контроля. В нее вошли образцы: 2982 (из Испании), 2925 (из Франции), 2995 (из Португалии), 3020 (из Венгрии), 3074 и 3080 (из Мексики). Среднее количество клубеньков и побегов заразихи на одно поражённое растение у этих образцов было в пределах от 96 до 121. Вторая группа со средней степенью поражения от 58 до73 включает образцы: 2930 (из
Франции), 2975 (из Австралии), 2978 (из Испании), 2988 (из Болгарии), 3004 (из Югославии), 3015 (из Венгрии).
Таблица 1 Поражение некоторых образцов подсолнечника коллекции ВИР заразихой (О. ситапа) при искусственном заражении в теплице
Особенно интересна третья группа образцов, степень поражения которых была в пределах от 12 до 28 экземпляров заразихи на растение. Она включает образцы: 2931 (из Франции), 2973 (из Австралии), 2938, 2953 и 2954 (из Аргентины) и линию Р 96, созданную в Испании, не входящую в коллекцию ВИР и обладающую устойчивостью к расам от, А до F. Среди тестированных образцов подсолнечника 2973, 2953, 2954 и Р 96 наблюдалось расщепление на непораженные и поражённые в слабой степени экземпляры.
Для выяснения причины различий по устойчивости к заразихе среди учетных растений внутри образцов, выполнено сравнение ДНК, выделенной отдельно из пяти пораженных и пяти непораженных растений образцов 2953, 2954 и линии Р 96. В нашей работе с популяцией заразихи, состоящей из смеси рас, учитывалось известное предположение [5], что гены устойчивости к ней расположены кластерно, подобно генам устойчивости к ложной мучнистой росе — Р1 1, Р1 2 и Р1 6, формирующим кластер и сцепленным с одними и теми же ДНК маркерами. Поэтому были использованы 5 локусов ДНК (табл. 2),
предложенные Lu et al. (2000) [4], как характеризующие устойчивость к расе Е заразихи.
Таблица 2
Характеристика SCAR маркеров, использованных для дифференциации контрастных по устойчивости к заразихе растений подсолнечника
ВНИИМК 2011 г.
При проведении амплификации ДНК по приведенным в таблице 2 пяти локусам получены следующие результаты. По локусам RTS29, RTS40 и RTS43 продукты амплификации ДНК у пораженных и непораженных растений не отличались. Отличия в амплико-нах получены по локусам RTS05 и RTS28. По локусу RTS28 у пораженных и непораженных растений линии Р 96 амплифицированы одинаковые фрагменты ДНК. У непораженных растений образцов 2953 и 2954 обнаружены более интенсивные фракции и, возможно, при использовании других методов разделения продуктов реакции будут визуализированы различия по количеству фрагментов. Продукты амплификации ДНК по локусу RTS05 различали пораженные и непораженные растения у образцов 2953, 2954 и линии Р 96 (рисунок). У восприимчивых растений присутствовала фракция ДНК 650 п.н. Это указывает на генетическую неоднородность внутри указанных образцов, различающихся и по устойчивости к вирулентным расам заразихи. Поэтому локус RTS 05 можно в дальнейшем использовать как маркерный при анализе растений, устойчивых и восприимчивых к высоковирулентным расам заразихи.
Выводы. Среди 500 образцов культурного подсолнечника коллекции ВИР не выявлено полностью устойчивых к высоковирулентной популяции заразихи из Тацинского-района Ростовской области. Однако образцы различались по степени поражения. Обнару-
№ п/п № каталога Происхождение Учетных расте-ний, шт. Пораженных растений, % Степень поражения
1 2925 Франция 30 100 110
2 2930 Франция 30 100 61
3 2931 Франция 31 100 20
4 2938 Аргентина 34 100 12
5 2953 Аргентина 30 89 11
6 2954 Аргентина 30 82 12
7 2973 Австралия 30 90 28
8 2975 Австралия 30 100 73
9 2978 Испания 30 100 62
10 2982 Испания 31 100 121
11 2988 Болгария 30 100 58
12 2995 Португалия 30 100 96
13 2996 Португалия 31 100 89
14 3004 Югославия 30 100 68
15 3015 Венгрия 29 100 65
16 3020 Венгрия 30 100 98
17 3074 Мексика 30 100 97
18 3080 Мексика 30 100 115
19 Р 96 Испания 30 78 12
19 ВНИИМК 8883, контроль 30 100 115
Назва ние локусов Последовательность фланкирующих праймеров 5'--3'- Полиморфизм в образцах
Р 96 2953 2954
RTS 05 TGGTCGCAGATGGACGTGTGGGTG GTCGCAGAGAGTGAGAGAGAGTGT + + +
RTS28 AGTAGACGGGCAAAGCGAAAGGAT AGTAGACGGGTTGAATATGTTGAA — + +
RTS29 GCTTCCCCTTAATGATCCGGAAGA GCTTCCCCTTGGCTAGAAGATGAA — - -
RTS40 TCCACCGAGCTACCAGTTCCGGAG TCCACCGAGCGAGCATATTCCGAG — - -
RTS43 CGGAGAGCGAGCATAGGGTCAGGT CGGAGAGCGACGACATCATTCCAA — - -
(+) — есть полиморфизм между пораженными и непораженными растениями- (-) — нет полиморфизма между пораженными и непораженными растениями
ISSN 0202−5493. МАСЛИЧНЫЕ КУЛЬТУРЫ. Научно-технический бюллетень Всероссийского научно-исследовательского института масличных культур. Вып.2 (148−149), 2011
* * *
1 2 3 4 5 6 М
Рисунок — Электрофоретические спектры продуктов амплификации ДНК у устойчивых и восприимчивых растений подсолнечника по локусу RTS 05. Дорожки: 1, 3, 5 — устойчивые растения- 2, 4, 6 -восприимчивые растения- образцы: 1, 2 — Р 96- 3, 4 -2953- 5, 6 — 2954- М — маркер молекулярного веса 1 кЬ- стрелкой указана полиморфная зона 650 п.н.
жено четыре образца с разделением на устойчивые и восприимчивые растения. Методом ПЦР ДНК по двум SCAR локусам найдены генетические отличия у пораженных и непораженных растений внутри образцов. Локус RTS 05 пригоден для использования в качестве маркерного при анализе растений, устойчивых и восприимчивых к высоковирулентным расам.
Исследования выполнены при финансовой поддержке РФФИ, грант № 11−04−96 502.
Авторы выражают благодарность д. б. н. В. А. Гавриловой и к. с-х. н. В. Т. Рожковой за любезно предоставленный семенной материал подсолнечника из коллекции ВИР.
Список литературы
1. Fernandez-Martinez, J.M. Update on breeding for resistance to sunflower broomrape / J. M Fernandez-Martinez, J. Dominguez, B. Pe-rez-Vich and L. Velasco // Helia. — 2008. -№ 48. — P. 73−84.
2. Monica Iuoras. Preliminary studies related to the use of marker assisted selection for resistance to Orobanche rnmana Wallr. in sunflower / M. Iuoras, D. Stanciu, M. Nastase, F. Geronzi // Romanian agricultural research. -2004. — № 21. — P. 33−37.
3. Tang, S. Genetic mapping of the Or5 gene for resistance to Orobanche race E in sunflower / S. Tang, A. Heesacker, V.K. Kishore, A. Fernandez, E. Sadik, G. Cole, St. Knapp. // Crop. Sci. — 2003. -V. 43. — P. 1021−1028.
4. Lu, Y.H. Development of SCAR markers linked to the gene Or5 conferring resistance to broomrape (Orobanche cumana Wallr.) in sunflower / Y.H. Lu, J.M. Melero-Vara, J.A. Blanchard // TAG. — 2000. — 100. — P. 626−632.
5. Солоденко, А. Е. Маркирование гена устойчивости к заразихе Or3 у подсолнечника / А. Е. Солоденко, А. В. Саналатий, В. В. Толмачев, К. В. Ведмедева, Ю. М. Сиволап // Цитология и генетика. — 2005. — С. 9−12.
6. Антонова, Т. С. Вирулентность заразихи, поражающей подсолнечник в Волгоградской и Ростовской областях / Т. С. Антонова, Н. М. Арасланова, С. А. Рамазанова, С. З. Гучетль, Т. А. Челюстникова // Масличные культуры: Науч. -тех. бюл. ВНИИМК. -2009. — Вып.1 (140). — С. 31−37.
7. Saghai-Maroof, M.A. Ribosomal DNA spacer-length polymorphisms in barley: Mende-lian inheritance, chromosomal location, and population dynamics / M.A. Saghai-Maroof, K.M. Soliman, R.A. Jorgensen, R.W. Allard // PNAS USA. — 1984. — 81. — P. 8014−8018.

ПоказатьСвернуть
Заполнить форму текущей работой