Использование ПЦР в диагностике возбудителей воспалительных заболеваний репродуктивного тракта

Тип работы:
Реферат
Предмет:
Медицина


Узнать стоимость

Детальная информация о работе

Выдержка из работы

УДК 579. 2:579. 61:616. 6−07
ИСПОЛЬЗОВАНИЕ ПЦР В ДИАГНОСТИКЕ ВОЗБУДИТЕЛЕЙ ВОСПАЛИТЕЛЬНЫХ ЗАБОЛЕВАНИЙ РЕПРОДУКТИВНОГО ТРАКТА
1 2 Потатуркина-Нестерова Н.И., Немова И. С.
1 Тольяттинский государственный университет, Тольятти, Россия (445 667, г. Тольятти, ул. Белорусская, 14)
2 Ульяновский государственный университет, Ульяновск, Россия (432 970 г. Ульяновск, ул. Л. Толстого, 42),
potaturkinani@mail. ru_
В настоящее время ПЦР является одним из высокочувствительных методов диагностики инфекционных заболеваний, который позволяет выявлять единичные бактериальные клетки. Показано, что диагностическая и экономическая эффективность выявления возбудителей повышается за счет одновременной ПЦР-детекции наиболее значимых патогенов в смеси информативных субстратов. Целью настоящей работы явилось сравнение эффективности ПЦР с различными методиками выделения ДНК Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma urealyticum у больных c урогенитальными инфекциями. Показано, что в случае выделения ДНК с использованием сорбента, по сравнению с фенольно-хлороформным преципитирующим методом экстракции, наблюдался максимальный продукт амплификации, что свидетельствует о наиболее полном экстрагировании ДНК из бактерий. Данный метод ПЦР был наиболее эффективен при диагностике урогенитальных инфекций микоплазменной этиологии.
Ключевые слова: полимеразная цепная реакция, микоплазмы, репродуктивный тракт, воспалительные инфекции, микрофлора.
USING OF PCR IN THE DIAGNOSTICS OF INFLAMMATORY DISEASES OF THE REPRODUCTIVE TRACT
1 2 Potaturkina-Nesterova N.I., Nemova I.S.
1 Tolyatti State University
2 Ulyanovsk State University, Ulyanovsk, Russia (432 970, Ulyanovsk, Leo Tolstoy St., 42), potaturkinani@mail. ru_
Currently, PCR is a highly sensitive methods for the diagnosis of infectious diseases, which can detect single bacterial cells. It is shown that the diagnostic and economic efficiency of pathogens detection is enhanced by simultaneous PCR detection of the most significant pathogens in a mixture of informative substrates. The purpose of this work is comparing PCR efficiency with various means of Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma urealyticum DNA isolation among the patients with urogenital infections (UI). It was found out that in case of DNA isolation using sorbent, the maximum amplification product was observed in comparison with phenol-chloroform precipitation method of extraction. It testifies to more complete DNA extraction from bacteria. Such a PCR method was more effective while diagnostics of UI mycoplasma etiology.
Key words: polymerase chain reaction, mycoplasm, reproductive tract, inflammatory diseases, microflora.
Микрофлора влагалища является важнейшим индикатором состояния здоровья, а ее количественный и качественный состав отражает состояние половой системы. Регуляция видового и количественного состава микрофлоры вагинального биотопа в значительной мере зависит от иммунной, эндокринной систем организма и особенностей процессов обмена веществ.
Дестабилизация вагинальной экосистемы может быть вызвана рядом факторов, обусловленных урбанизацией населения, неблагоприятным воздействием окружающей среды, а также образом жизни: раннее начало и беспорядочные половые связи, бесконтрольное применение лекарственных препаратов, особенно антибиотиков и контрацептивов.
С использованием молекулярно-генетических приемов подтверждено, что доминантная микробиота влагалища взрослой женщины преимущественно представлена лактобактериями, бифидобактериями, но может различаться по количественному и качественному составу у отдельных индивидуумов и групп населения в зависимости от возраста, национальной принадлежности, условий проживания, состояния здоровья (Шендеров, 2005).
Одним из ведущих методов современной лабораторной диагностики инфекций репродуктивного тракта является полимеразная цепная реакция (ПЦР). Полимеразная цепная реакция, основанная на выявлении уникальных фрагментов геномов инфекционных агентов, соответствует данным требованиям, существенно расширяет возможности диагностики, позволяет обнаруживать некультивируемые и труднокультивируемые формы микроорганизмов (Говорун В.М., 2000- Шагинян И. А., 2000- Ребриков Д. В., 2009- Mullis K.B., 1994- Newton C.R., 1997- Farrell D.J., 2001).
Целью настоящей работы явилось выявление клинических изолятов семейства Mycoplasmataceae, возбудителей воспалительных инфекций репродуктивного тракта, с использованием ПЦР-диагностики классическим методом выделения ДНК с использованием сорбента и фенольно-хлороформным преципитирующим методом экстракции ДНК.
Материалы и методы. Изучено 268 образцов исследуемого материала, полученного у пациентов с острым и хроническим уретритом (41,7%), аднекситом (13,8%), эндоцервицитом (26,8%) и кольпитом (18,2%). Микробиологическую диагностику производили культуральным методом с использованием питательных сред «Микоплазма-50» и «Микоплазма-АЧ ФГУ» (НИИЭМ им. Пастера) [3].
Из полученных культур микоплазм выделяли 67 образцов ДНК M. hominis, 46 — M. genitalium, 155 — U. urealyticum. Выделение ДНК проводили с использованием оптимизированных коммерческих наборов: «Проба ГС» и «Проба НК» производства ООО «ДНК-Технология» (г. Москва), «Пробоподготовка универсальная для выделения ДНК» ООО «ИзоГен» (г. Москва), «ДНК-Экспресс» и «Выделение ДНК из биопроб» НПФ «Литех» (г. Москва) и «ДНК-сорб-А-М — вариант 100» «ИнтеЛабСервис» (г. Москва). Выделение ДНК проводили по методике НПФ «Литех» (г. Москва).
Для проведения амплификации использована коммерческая стандартная лиофилизованная реакционная смесь с оптимизированной для классической схемы ПЦР буферной системой производства ООО «ИзоГен» (г. Москва), НПФ «Литех» (г. Москва).
С целью электрофоретической детекции применяли 2,3%-ный агарозный гель и коммерческие наборы производства ООО «ДНК-Технология» (г. Москва) (ПОЛИМИК УР и ПОЛИМИК МК).
Отбор проб микоплазм проводили в одноразовые полипропиленовые пробирки «Эппендорф» объемом 1,6 мл. Материал из колоний микоплазм помещали 5GG мкл стерильного G, 9% NaCl, осаждали при 12GGG об. /мин на центрифуге «Эппендорф» (Cyclotemp-2G2, Россия). Осадок ресуспендировали и разводили в буфере, содержащем 2,5 mM MgCl2 G, G1% желатин, до конечной концентрации 1G4 КОЕ/мл. Культуры лизировали при помощи коммерческого набора «ДНК-Экспресс» (НПФ «Литех», г. Москва) для термического клеточного лизиса. Хранение образцов перед использованием осуществляли при 4 0С.
Для процесса амплификации использовали приборы «Терцик» производства ООО «ДНК-Технология» (г. Москва) с активным регулированием внутри реакционной смеси, что позволяет не только добиться стабильной температуры (±G, 1 °С), но и проводить сам процесс в более короткие сроки.
Проведение амплификации состояло из трех этапов: денатурации ДНК при 94 °C, отжига праймеров на денатурированной ДНК и элонгации (синтеза новой цепи с помощью фермента Taq-ДНК-полимеразы, наибольшая активность которого проявляется при 72 °С).
В работе применяли: классический метод выделения ДНК с использованием сорбента (первый метод) и фенольно-хлороформный преципитирующий метод экстракции ДНК (второй метод).
Праймеры для идентификации M genitalium CCACTCGAGCCAAGGCCAAGGCCCTC-2G, 2 и CTACGGGGAAAGCGGGGGA-2G, для M. hominis P-12G CTCCCGGAACCGGCTCACC и P-56 TGGGCGGACCCCTCATGCCAG, U. urealyticum Ur5-
GCGCAGGCGGGTTTGAAGTTTGGT-3.
Ur2−5GCCCTATCCCGAACTGAGTAAC-3 были выбраны на основании нуклеотидной последовательности в GenBank LG8642 и использованы для амплификации фрагмента генов G37 и G317 микоплазм длиной 215 и 713 н.п. соответственно. Для подбора праймеров были использованы программы Gene Runner Version 3. G5 и Primer Blast (ресурсы GeneBank).
На этапе детекции продукты амплификации ПЦР (2G мкл) анализировали электрофоретически, для чего были использованы готовые агарозные гели, содержащие 2,3% агарозы и бромистого этидия. Электрофоретический буфер также входил в состав коммерческого набора.
Анализ электрофореграмм проводили с помощью видеосистемы Gel Imager и программного обеспечения Gel Analyzer, что позволило документировать и обрабатывать видеоизображение фореграмм в УФ-излучении при длине волны 254 нм.
Статистическую обработку данных проводили при помощи программы «Statistica for Windows».
Результаты. Исследование 268 клинических образцов ДНК выявило наличие в них M. hominis, M. genitalium и U. urealyticum. в 92 (34,3%) случаях (рис. 1).

35- 34,3%
30- 26,1% А
25- А
20- к
% 15- Ш
10- Ш
5- ш
/ 1 -J ^
Культуральный метод ПЦР
Рис. 1. Показатели инфицированности пациенток микоплазмами, выявленными
культуральным методом и ПЦР.
Результаты ПЦР-анализа микоплазм показали, что использование видоспецифических праймеров позволяет дифференцировать виды M. hominis, M. genitalium и U. urealyticum. В ряде случаев ДНК из клинических образцов реагировала с праймерами на два или три указанных вида возбудителей одновременно, что указывает на их возможную ассоциацию. В виде моноинфекций микоплазмы выявлены у 62 пациенток (23,1%), в виде ассоциаций — у 93 человек (34,7%). Наиболее частыми ассоциантами являлись M. hominis и U. urealyticum (62%), а также M. hominis и M. genitalium (36%). У 2% больных женщин были обнаружены ассоциации, включающие М. hominis, M. genitalium и U. urealyticum.
Анализ выявляемости возбудителей при воспалительных заболеваниях урогенитального тракта показал, что М. hominis культуральным методом была выявлена у 95 больных (35,8%). Из них микоплазмы обнаружили у 41 больной уретритом (43,2%), у 22 (23,1%) -эндоцервицитом, у 12 (12,6%) — аднекситом и у 20 (21,1%) — кольпитом (табл. 1).
Таблица 1 — Показатели выявления микоплазм у пациенток с воспалительными заболеваниями урогенитального тракта культуральным методом и ПЦР
Возбудители Заболевания
Уретрит Цервицит Аднексит Кольпит
M. hominis 61(94%) 42(65%) 22(34%) 30(46%)
M. genitalium 54(83%) 28(43%) 12(17%) 10(15%)
U. urealyticum 63(23%) 44(16%) 28(10%) 32(12%)
Далее было проведено сравнительное изучение результатов ПЦР при подготовке проб ДНК к амплификации: классическим методом выделения ДНК с использованием сорбента (1 метод) и фенольно-хлороформным преципитирующим методом экстракции ДНК (2 метод). Проведенные исследования показали, что в случае выделения ДНК с использованием сорбента наблюдался максимальный продукт амплификации, что свидетельствует о наиболее полном экстрагировании ДНК из бактериальных клеток. Ни в одном случае с использованием сорбента не было выявлено ингибирования реакции, что также имеет важное значение при оценке результатов (табл. 2).
Таблица 2 — Результаты выявления микоплазм методом ПЦР при воспалительных заболеваниях урогенитального тракта (%)
Возбудители Варианты ПЦР
Классический метод ПЦР с использованием сорбента Фенольно-хлороформный метод
Ureaplasma urealiticum 47 —
Mycoplasma hominis 35 —
Mycoplasma genitalium 18 —
При амплификации ДНК классическим методом с использованием сорбента (рис. 2) было установлено, что амплифицируемые фрагменты ДНК содержали в 12 пробе 500 пар нуклеотидных оснований (п.о.), в 14 пробе — 200 п.о., в 18 пробе — 528 п.о., в 22 пробе — 500 п.о., что соответствует положительному результату.
Полученные результаты свидетельствовали не только о положительных результатах содержания копий ДНК в исследуемом материале, но и позволили определить их количественные показатели.
Рис. 2. Электрофореграмма полученных продуктов амплификации в агарозном геле:
1−3 «Проба ГС» (НПФ «ДНК-Технология»), 4−6 «Пробоподготовка универсальная для выделения ДНК» (ООО «ИзоГен»), 7−9 «Выделение ДНК из биопроб» (НПФ «Литех»), 10−12 «ДНК-сорб-А-М — вариант 100» («ИнтеЛабСервис»), 16−18 «ДНК-Экспресс» (НПФ «Литех»), 19−21 «Проба НК» (НПФ «ДНК-Технология), 1, 4, 7, 10, 13, 16, 19 — отрицательные контроли (в качестве пробы — деионизированная вода), 2, 5, 8, 11, 17, 20 — отрицательные контроли (в качестве пробы — буферные растворы наборов для растворения выделенных, ДНК — соответственно наборам), 3, 6, 9, 12, 14, 18, 21, 22 — аликвота выделенной ДНК M. hominis.
Выделение тотальной ДНК фенольно-хлороформным преципитирующим методом ДНК показало, что полосы электрофореграммы не четкие, что свидетельствует о деградации ДНК (рис. 3).
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
Рис. 3. Электрофореграмма тотальной ДНК после этапа выделения:
1−3 «Проба ГС» (НПФ «ДНК-Технология»), 4−6 «Пробоподготовка универсальная для выделения ДНК» (ООО «ИзоГен»), 7−9 «Выделение ДНК из биопроб» (НПФ «Литех»), 10−12 «ДНК-сорб-А-М — вариант 100» («ИнтеЛабСервис»), 13−15 «ДНК-Экспресс» (НПФ «Литех»), 1, 4, 7, 10, 13 — отрицательные контроли — деионизированная вода, 2, 5, 8, 11, 14 -отрицательные контроли — буферные растворы наборов для растворения выделенных ДНК-соответственно наборам, 3, 6, 9, 12, 15 — культура M. hominis.
Проведенные исследования продемонстрировали, что ПЦР является базовым методом, позволяющим эффективно выявлять виды возбудителей воспалительных инфекций репродуктивного тракта. За счет его применения были получены оригинальные данные о распространении и особенностях циркуляции микроорганизмов, заключающиеся в высокой частоте выявления, значительном количестве ассоциаций инфекционных агентов и достаточно стабильном поддержании распределения возбудителей по частоте выявления.
Амплификация ДНК классическим вариантом с использованием сорбента позволяет более точно оценить полноту сохранения ДНК, чем фенольно-хлороформный преципитирующий метод экстракции ДНК после термического лизиса клеток. При экстракция ДНК сорбентом наблюдается максимальный продукт амплификации, свидетельствующий о наиболее полном экстрагировании ДНК из бактериальных клеток. Ни
в одном случае с использованием сорбента не было выявлено ингибирование реакции, кроме того, все коммерческие наборы с применением сорбентов от разных производителей давали сопоставимые результаты.
На электрофореграмме тотальной ДНК после термического лизиса клеток и фенольно-хлороформный преципитирующей экстракции ДНК образуются следы деградации ДНК и наличия примеси. Эти продукты не отражаются на процессе амплификации ДНК M. hominis, M. genitalium и U. urealyticum, но могут играть роль ингибиторов при работе с биологическим материалом от пациентов. Таким образом, методику выделения ДНК необходимо выбирать исходя из конкретных потребностей эксперимента и наличия реагентов и времени.
Работа выполнена при поддержке Минобрнауки Р Ф в рамках соглашения 14. B37. 21. 2010.
Список литературы
1. Бухарин О. В. Проблемы персистенции патогенов в инфектологии // Журнал микробиологии, эпидемиологии и иммунобиологии. — 2006. — № 4. — С. 4−8.
2. Дмитриев А. Г. Лабораторная диагностика бактериальных урогенитальных инфекций. -М.: Медицинская книга, 2003. — 336 с.
3. Карамова А. Э. Значение микоплазм в развитии воспалительных заболеваний урогенитального тракта, генетические аспекты резистентности к антибиотикам, тактика ведения больных: автореф. … канд. мед. наук. — М., 2003. — 19 с.
4. Красноженов Е. П. Микробиологическая диагностика инфекционных заболеваний. -Ростов н/Д: Феникс, 2006. — 252 с.
5. Лашин С. А. и др. Корреляции оперонной структуры с длиной генома у 14 видов микоплазм // Вестник ВОГиС. — 2009. — Т. 13. — № 1. — С. 84−89.
6. Методические указания МУ 1.3. 1888−04. Организация работы при исследованиях методом ПЦР материала, инфицированного патогенными биологическими агентами III-IV групп патогенности. — М., 2004.
7. Прилепская В. Н., Кисина В. И., Соколовский Е. В. К вопросу о роли микоплазм в урогенитальной патологии // Гинекология. — 2007. — № 1.
8. Савичева А. М. Лабораторная диагностика и терапия репродуктивно значимых инфекций // Лечащий врач. — 2008. — № 3.
9. Brotman R.M., Erbelding E.J., Jamshidi R.M. et al. Findings associated with recurrence of bacterial vaginosis among adolescents attending sexually transmitted diseases clinics // J. Pediatr Adolesc Gynecol. — 2007. — Aug- 20 (4): 225−31.
10. Valysheva I.V. New Method for the Determination of Anti-lactoferrin Activity of Microorganisms / Valysheva I.V., Valyshev F.V., Kartashova O.L., Chainikova I.N., Bukharin O.V. // Журнал микробиологии, эпидемиологии и иммунобиологии. — 2003. — № 4. — С. 64−67.
11. Ferris M.J., Masztal A., Martin D.H. Use of speciesdirected 16S rRNA gene PCR primers for detection of Atopobium vaginae in patients with bacterial vaginosis // J. Clin. Microbiol. — 2004- 42: 5892−4.
Рецензенты:
Ильина Н. А., д.б.н., профессор кафедры зоологии, проректор по научной работе ФГБОУ ВПО «Ульяновский государственный педагогический университет им. И.Н. Ульянова», г. Ульяновск.
Нестеров А. С., д.м.н., профессор кафедры инфекционных и кожно-венерических болезней ФГБОУ ВПО «Ульяновский государственный университет», г. Ульяновск.

ПоказатьСвернуть
Заполнить форму текущей работой