Использование разработанных праймеров для детекции фагов группы Р034

Тип работы:
Реферат
Предмет:
Биология


Узнать стоимость

Детальная информация о работе

Выдержка из работы

УДК 578. 81
А. П. Райский, ассистент (БГТУ) — О. В. Дмитриева, инженер (БГТУ) —
А. А. Почтенная, студентка (БГТУ) — Н. А. Белясова, доцент (БГТУ)
ИСПОЛЬЗОВАНИЕ РАЗРАБОТАННЫХ ПРАЙМЕРОВ ДЛЯ ДЕТЕКЦИИ ФАГОВ ГРУППЫ Р034
В работе представлены результаты подбора праймеров для бактерифагов лактококков группы P034. На основании анализа секвенированных последовательностей генома фага BIM BV-37 подобрана структура четырех наборов олигонуклеотидных праймеров, обеспечивающих амплификацию характерных для ДНК фагов группы Р034 фрагментов. ПЦР-анализ коллекционных фагов группы Р034 с разработанными наборами праймеров показал пригодность одной из пар, которая обеспечивает получение ампликонов размером 392 пар нуклеотидов. Продукты амплификации уникальных последовательностей фага BIM BV-37 и родственных ему изолятов отличаются размерами от аналогичных продуктов, образующихся при ПЦР-детекции представителей групп с2, 936 и Р335. Праймеры были использованы для обнаружения фагов в составе сырого молока и молочных продуктах.
We present here the results of the primers selection for lactococcal bacteriophage group P034. Based on analysis of the sequenced genome of phage BIM BV-37 structure were designed four sets of oligonucleotide primers to ensure amplification characteristic of P034 phage DNA fragments. PCR analysis of the collections of phage group with P034-developed set of primers showed the suitability of one of the pairs, which ensures obtaining amplicons size 392 base pairs. PCR products were unique sequences of phage BIM BV-37 and kindred isolates vary in size from similar products produced in the PCR detection of representatives of groups c2, 936 and P335. PCR primers for timely detection of lac-tophages species Р034 in milk raw materials and other objects with their DNA were used.
Введение. В настоящее время в учреждениях Республики Беларусь, призванных осуществлять контроль за распространением лактофагов, а также составлять ассоциации заква-сочных культур для выявления вирулентных лактофагов и лизогенных бактерий используют методы титрования проб на потенциально чувствительных бактериях. Этот малоэффективный подход опасен тем, что заранее невозможно предсказать — будут ли подобранные наугад бактерии поддерживать репродукцию фагов, содержащихся в пробе [1, 2]. Гораздо более надежным и оперативным является другой метод детекции фагов — основанный на ПЦР-анализе. Этот метод нашел довольно широкое распространение в странах Европы, в Америке, Австралии, где используется для выявления в сырье, воде, полуфабрикатах, заквасках, а также в готовых продуктах лактофагов доминирующих в этих странах групп — с2, 936 и Р335 [3, 4, 5]. Для ПЦР-детекции фагов названных групп сконструированы олигонуклеотидные праймеры, обеспечивающие амплификацию фрагментов генов, уникальных для каждой группы. Однако для лактофагов группы Р034 таких праймеров не создано, поскольку эти фаги встречаются крайне редко в странах, где эффективно борются с фа-голизисом, и Р034-фаги остаются малоизученными. В то же время, как показано ранее [6], фаги группы Р034 составляют более 17% изолятов доминирующих в Беларуси лактофагов, что предопределяет необходимость разработки
способа их ПЦР-детекции. Для успешной борьбы с фаговой инфекцией и предотвращения развития фаголиса необходимо иметь возможность вовремя выявлять фаги всех групп.
В данной работе представлены результаты подбора праймеров для создания способа детекции фагов группы Р034.
Объекты и методы исследования. В работе использовали вирулентные лактофаги, выделенные из кисломолочных продуктов производства различных предприятий Республики Беларусь [7]. Фаги титровали на чувствительных тест-культурах Lactococcus actis из коллекции кафедры биотехнологии и биоэкологии.
Получение фаголизатов с высоким титром осуществляли в жидкой среде М17 в присутствии 0,5% глюкозы и 5 мМ СаС12.
Для выделения ДНК осажденные центрифугированием при 36 600 g в течение 40 мин фаговые частицы ресуспендировали в 100 мкл ТЕ-буфера, добавляли 5 мкл 10% 8Б8 и выдерживали в течение 5 мин при 70 °C. Затем добавляли 20 мкл 5 М ацетата калия и помещали на лед на 30 мин. Центрифугировали при 15 500 g 15 мин при 4 °C. Отбирали супернатант и добавляли 250 мкл этанола. Центрифугировали при 15 500 g в течение 5 мин при 4 °C. Этанол тщательно удаляли, ДНК ресуспенди-ровали в ТЕ-буфере.
ПЦР -анализ осуществляли в объеме 50 мл, содержащем 1 цмоль/л каждого из трех пар
праймеров, специфичных по отношению к фагам групп с2, 936 и Р335- 1,25 U Тад-полимера-зы ДНК («Fermentas», Литва), Tag-буфер 1х и 1 мкл лизата (Т = 108 БОЕ/мл). В качестве контроля вместо лизата в рабочую смесь вносили 1 мкл стерильной среды М17. Амплификацию осуществляли в термоциклере «Терцик» при следующих режимах: 3 мин при 94 °C, 35 циклов по 30 с при 94 °C, 1 мин при 50 °C и 1 мин при 72 °C, последний шаг — 7 мин при 72 °C. ПЦР-продукты разделяли с использованием 1,5%-ного агарозного геля в ТАЕ-буфере, окрашивали бромистым этидием и визуализировали в УФ (А, = 280 нм).
Праймерами служили следующие последовательности: для фагов группы с2 —
5'- CAATCGAAGCAGGTGTAAAAGTTCGAGAAC 3'-, 5'- GCTTTATCCATTTGTAGGTATGCTTCTGC 3'-- для фагов группы 936 — 5'- ATCAGTTGGCT CAATGGAAGACCAAGCGG 3'-, 5'- GTTGCTTCTG
CTGTTGGTGTCAAATGAGGA 3'-- для фагов группы Р335 — 5'- GAAGCTAGGCGAATCAGT AAACTTGCTAG 3'-, 5'- CGGCTATCTCGTCAATTG TTCCGGTTGC 3'-.
Результаты и их обсуждение. Для разработки праймеров требуется подобрать фрагмент молекулы ДНК таким образом, чтобы два его концевых участка отличались бы по своей структуре генетической консервативностью и присутствовали только в составе бактериофагов лактококков группы Р034 но, в тоже время, отсутствовали в ДНК других групп фагов или генах бактерий.
Кроме того, для возможности использования разрабатываемых праймеров в мультиплексной ПЦР, размер образуемого при амплификации фрагмента должен отличаться от таковых для фагов остальных групп.
Сопоставление полученных в ходе сиквенс-анализа последовательностей нуклеотидов генома фага BIM BV-37 с информацией в базе данных BLAST 2.2. 18+ (http: //www. ncbi. nlm. nih. gov/blast) показало, что в составе известных фаговых геномов отсутствуют гомологичные последовательности. С использованием программы Primer BLAST (http: //www. ncbi. nlm. nih. gov/ tools/primer-blast/index. cgi) к секвенированным последовательностям подобрали четыре пары праймеров, не имеющих гомологии с геномами других организмов, последовательности которых есть в базе данных BLAST, чтобы изначально исключить возможность получения ложноположительных результатов.
Нуклеотидные последовательности праймеров представлены в табл. 1.
Каждая из подобранных пар праймеров обеспечивала амплификацию фрагмента ДНК фага BIM BV-37 с образованием ам-
пликона соответствующего размера, но лишь одна из них (Р1А и Р1В) приводила к образованию ампликонов в ПЦР ДНК других представителей группы Р034. На рисунке приведены результаты мультиплексной ПЦР, в которой использованы 7 пар олигонуклео-тидных праймеров. Матрицами служили ДНК фагов разных групп.
Таблица 1 Структуры подобранных праймеров
Прай- мер Последовательность нуклеотидов Продукт ампли- фикации, bp
P034A 5' TCAAACTCTTGT AAGTTA ATTTCACCC 3' 376
P034B 5' GTCCAGTTGTTGGTGGAG TCA 3'
PL 5' ACCTGAAACACTTCCCCC GTCCA 3' 392
P1B 5' GCGGTTTCATGGGTCGAG TGGT 3'
P4A 5' ACGTTGCCCGAACGAAAG GT 3' 369
P4B 5' CAACCCTTTGCGGGGCGT CT 3'
P5A 5' ACGCCACCTAAGACGCCA CC 3' 380
P5B 5' TGCCACTGAACAAGGGTC GCA 3'
Как следует из представленных данных, три пары олигонуклеотидных праймеров (Р034А, Р034В- Р4А, Р4В- Р5А, Р5В) гомологичны лишь фрагментам ДНК фага В1М ВУ-37 (группа Р034). То обстоятельство, что ДНК В1М ВУ-41 лактофагов, чьи вирионы имеют короткие хвостовые отростки, не содержат последовательностей, амплификация которых возможна с использованием указанных праймеров, свидетельствует, скорее всего, о том, что при определении структуры олигонуклеотидов за основу был взят один из секвенированных фрагментов ДНК В1М ВУ-37, который уникален для данного изо-лята и не встречается в ДНК других представителей группы Р034.
Пара праймеров Р1А и Р1 В позволила зарегистрировать образование ампликонов 392 Ьр и для других представителей группы Р034 (Е15, В1М ВУ-41).
Таким образом, подобранные олигонукле-отидные праймеры (Р1А и Р1В) позволяют проводить детекцию фагов Р034 и одновре-
менно отличать фаги данной группы от представителей групп Р335, 936 и с2, амплификация ДНК которых приводит к образованию ПЦР-продуктов размером 196, 318 и 444 п. н. соответственно.
1 — i00 bp маркер- 2 — BIM BY-2S (c2A, B) —
3 — BIM BY-27 (936A, B) — 4 — x4ii-f (P335A, B) —
5 — BIM BY-37 (P034A, B) — 6 — BIM BY-4i (P034A, B) —
7 — BIM BY-37 (P4A, B) — 8 — BIM BY-4i (P4A, B) —
9 — BIM BY-37 (P5A, B) — 10 — BIM BY-4i (P5A, B) —
11 — BIM BY-37 (PiA, B) — 12 — BIM BY-4i (PiA, B)
Продукты амплификации ДНК лактофагов в мультиплексной ПЦР
Для изучения чувствительности метода ПЦР и определения порога чувствительности провели амплификацию лизатов фагов BIM BY-37 и BIM BY-4i, представителей группы Р034 в серии последовательных разведений. Результаты представлены в табл. 2.
Таблица 2
Результаты ПЦР-детекции лактофагов в образцах продуктов
Таким образом, условия проведения ПЦР и разработанные праймеры позволяют выявлять фаги группы Р034 в достаточно низкой концен-тации 104−105 БОЕ/мл. Кроме того, детекция фагов методом ПЦР не требует наличия чувствительных к ним тест-культур, что значительно
повышает вероятность своевременного обнаружения бактериофагов.
Разработанный способ ПЦР-детекции фагов группы Р034 в мультиплексной ПЦР опробован при выявлении лактофагов в образцах кисломолочных продуктов (34 образца). Результаты анализа приведены в табл. 3.
Таблица 3
Результаты ПЦР-детекции лактофагов в образцах продуктов
Продукт (предприятие-изготовитель) Размер ампли- кона, bp
Сырок творожный (ГМЗ г. Новогрудок)
Сыр «Голландский» (ГМЗ г. Щучин) 444
Сметана (ГМЗ г. Щучин)
Масса творожная (ГМЗ г. Могилев)
Творог «Нежирный» (ГМЗ г. Новогрудок) i96
Творог 9% (ГМЗ г. Щучин) 392
Сметана 10% (ГМЗ г. Барановичи)
Творог 5% (Глубокский МКК) 3iS
Сыр «Российский» (ГМЗ г. Ружаны)
25 проб молока и продуктов Не выявлено
Полученные результаты подтверждают возможность использования разработанных олигонуклеотидных праймеров для детекции и идентификации редких фагов группы Р034 семейства Podoviridae.
Дальнейшие исследования возможности обнаружения фагов методом мультиплексной ПЦР и использование праймеров для фагов других представителей заквасочной микробиоты, как, например, Lactobacillus [8], позволит в одной реакции обнаруживать фаги нескольких родов молочнокислых бактерий.
Заключение. Разработаны олигонуклео-тидные праймеры для ПЦР -детекции редких фагов группы Р034. С помощью разработанных праймеров, совместно с уже известными последовательностями, специфичными к геномам фагов групп с2, 936 и Р335, в ходе мультиплексной ПЦР выявлены лактофаги четырех групп в молоке и молочных продуктах.
Работа выполнена в рамках финансируемого задания ГППИ (2006−2010 гг.) «Новые биотехнологии».
Литература
1. Boucher, I. Phages of Lactococcus lactis: an ecological and economical equilibrium / I. Boucher,
Титр лизата, БОЕ/мл Регистрация ампликонов для лизатов фагов
BIM BY-37 BIM BY-4i
i09 + +
10s + +
i07 + +
i06 + +
i05 + +
i04 + -
i03 — -
S. Moineau // Recent Res. Devel. Virol. — 2001. -Vol. 3. — P. 243−256.
2. Characterization and classification of virulent bacteriophages isolated from a cheddar cheese plant // C. N. Casey [et al.] // J. Appl. Bacteriol. -1993. — Vol. 74. — P. 268−275.
3. Species and type phages of lactococcal bacteriophages / A. W. Jarvis [et al.] // Intervirology. -1991. — Vol. 32. — P. 2−9.
4. Labrie, S. Multiplex PCR for detection and identification of lactococcal bacteriophages / S. Labrie, S. Moineau // Applied and Environmental Microbiology. — 2000. — Vol. 66, № 3. — P. 987−994.
5. Multiplex PCR for the detection and identification of dairy bacteriophages in milk // B. del
Rio [et al.] // Food Microbiology. — 2007. -Yol. 24. — P. 75-Si.
6. Raiski, A. Biodiversity of Lactococcus lactis bacteriophages in the Republic of Belarus / A. Raiski, N. Belyasova // Int. J. Food Microbiol. -2009. — Yol. i30. — P. i-5.
7. Фенотипическая характеристика лактофагов молочных продуктов / А. П. Райский [и др.] // Наука и инновации. — 200S. — № 4. -С. 36−40.
S. Detection and identification of Lactobacillus helveticus bacteriophages by PCR / M. Zago [et al.] // J. Dairy Res. — 2008. — Yol. 75. -P. i96−20i.
Поступила 26. 03. 2010

ПоказатьСвернуть
Заполнить форму текущей работой