Биоремедиация нарушенных углеводородами и тяжелыми металлами почв с использованием Rhodococcus-биосурфактантов и иммобилизованных родококков

Тип работы:
Реферат
Предмет:
Химия


Узнать стоимость

Детальная информация о работе

Выдержка из работы

БИОРЕМЕДИАЦИЯ НАРУШЕННЫХ УГЛЕВОДОРОДАМИ И ТЯЖЕЛЫМИ МЕТАЛЛАМИ ПОЧВ С ИСПОЛЬЗОВАНИЕМ RHODOCOCCUS-БИОСУРФАКТАНТОВ И ИММОБИЛИЗОВАННЫХ РОДОКОККОВ
И. Б. ИВШИНА,
доктор биологических наук, заведующая лабораторией, профессор,
А. В. КРИВОРУЧКО,
кандидат биологических наук, научный сотрудник, старший преподаватель,
М. С. КУЮКИНА,
доктор биологических наук, ведущий научный сотрудник, профессор,
Институт экологии и генетики микроорганизмов Уральского отделения
Российской академии наук, Пермский государственный национальный исследовательский
университет,
Л. В. КОСТИНА,
кандидат биологических наук, старший инженер, Институт экологии и генетики микроорганизмов Уральского отделения Российской академии наук,
Т. А. ПЕШКУР,
кандидат биологических наук, ведущий специалист,
К. Д. КАННИНГХЭМ,
доктор биологических наук, директор,
Шотландская сеть технологий окружающей среды,
Университет Стратклайда (Великобритания)
614 081, г. Пермь, ул. Голева, д. 13- тел. 8 (342) 280-81-14- e-mail: ivshina@iegm. ru
Положительная рецензия представлена В. Д. Белоноговой, доктором фармацевтических наук, профессором, заведующей кафедрой фармакогнозии с курсом ботаники Пермской государственной фармацевтической академии.
Ключевые слова: нефтезагрязненная почва, тяжелые металлы, биоремедиация, актинобактерии рода Rhodococcus, биосурфактанты, иммобилизованные клетки.
Keywords: oil-contaminated soil, heavy metals, bioremediation, Rhodococcus actinobacteria, biosurfactants, immobilized cells.
Потребность в цивилизованных технологиях уничтожения последствий нефтяного загрязнения наземных экосистем трудно переоценить. Применение физико-химических методов ремедиации (сжигание, экскавация пластов почвы с дальнейшим складированием, механическая изоляция, высокотемпературная экстракция, промывание, обработка электрическим током, экстракция растворителями, окислительновосстановительные реакции) достигло своих пределов, и все большее значение приобретают способы биоремедиации нефтезагрязненных земель как экологически безопасные и относительно недорогие [1, 2]. Существующие приемы биорекультивации почв в основном направлены на устранение конкретного загрязнителя и малоэффективны при одновременном загрязнении почвы органическими и неорганическими поллютантами [3]. В регионах с умеренным и холодным климатом актуальны приемы рекультивации с использованием функционально-направленных технологий, предусматривающих эффективное стимулирование окисления углеводородов природными нефтеокисляющими микроорганизмами. Оптимальное сочетание агротехнических мероприятий позволяет снизить уровень загрязнения, как правило, на 30−40% в основном за счет легкодегра-дируемых компонентов нефти. При этом высокомолекулярные углеводородные компоненты, а также тяжелые металлы, содержание которых в нефти может шшш. т-ауи. пагоб. ги
достигать 1 г/кг [4], не разрушаются в течение ряда лет. Тяжелые углеводороды прочно соединяются с почвенными частицами, образуя гидрофобные пленки, и почвы становятся малодоступными для микроорганизмов. Подвижные тяжелые металлы не дегра-дируются, перераспределяются между отдельными компонентами экосистемы, накапливаясь в биомассе микроорганизмов и растений, и по трофическим цепям передаются в организмы высших животных и человека, подавляя их биологическую активность и жизнедеятельность.
С целью повышения биодоступности углеводородных ксенобиотиков используют поверхностноактивные вещества (сурфактанты), которые способствуют десорбции и солюбилизации нефтяных компонентов, тем самым облегчая их ассимиляцию микробными клетками. Однако повсеместно применяемые в промышленности синтетические сурфактанты — это экологически опасные вещества с высокой степенью токсичности и низкой степенью деградабельности, которые активно аккумулируются в почвенных биоценозах. В связи с этим перспективным является использование сурфактантов бактериального происхождения, обладающих низкой токсичностью, биодеградабельностью, устойчивой активностью в экстремальных условиях. Известна способность биологических сурфактантов к образованию комплексных соединений с ионами металлов,
хотя возможности применения данного эффекта для устранения загрязнения тяжелыми металлами до сих пор мало исследованы [5].
Актинобактерии рода Rhodococcus обладают высокой углеводородокисляющей активностью, способны к аккумуляции ионов тяжелых металлов и синтезу нетоксичных биосурфактантов с выраженной нефтеотмывающей и эмульгирующей активностью и могут быть использованы в технологиях восстановления почв, загрязненных углеводородами и тяжелыми металлами [6−8]. Известно, что углеводо-родокисляющая активность родококков повышается за счет иммобилизации внутри или на поверхности различных носителей [9].
Цель и методика исследований.
Цель настоящей работы — оценка возможности использования Rhodococcus-биосурфактантов и иммобилизованных родококков для биоремедиации почв, загрязненных углеводородами и солями тяжелых металлов. В работе использовали 49 штаммов родококков, выделенных на территории Пермского края, принадлежащих к видам R. erythropolis, R. fas-cians, «R. longus», R. opacus, R. rhodochrous, R. ruber и депонированных в Региональной профилированной коллекции алканотрофных микроорганизмов (официальный акроним коллекции — ИЭГМ, www. iegm. ru/iegmcol, номер во Всемирной федерации коллекций культур — 768). Родококки выращивали в мясопептонном бульоне или минеральной среде с добавлением глюкозы, н-додекана или н-гексадекана при перемешивании (160 об. /мин), 28 °C в течение 28−120 ч. Способность культур к синтезу Rhodococcus-биосурфактантов оценивали по эмульгирующей активности (E24) в отношении н-гексадекана. Биосурфактанты получали методом соникации (30 мин, 23 кГц, 0,7 А) из родококков, выращенных в присутствии н-додекана [10]. Иммобилизацию бактериальных клеток проводили путем адсорбции на поверхности древесных опилок, гидрофобизованных с помощью биосурфактанта из R. ruber ИЭГМ 231, а также путем включения в гранулы криогеля на основе поливинилового спирта (ПВС). Степень резистентности планктонных и иммобилизованных родококков к тяжелым металлам (Cu, Cd, Cr, Mo, Ni, Pb, Zn) определяли микро-луночным методом по способности родококков расти в присутствии 0,08−250,0 мМ ионов металлов. О поглощающей способности родококков судили по степени исчезновения тяжелых металлов из среды культивирования, при этом параллельно регистрировали количество ионов, поглощенных клеточной биомассой. Углеводородокисляющую активность ро-дококков оценивали гравиметрическим методом по скорости окисления н-гексадекана.
В экспериментах по биоремедиации использовали модельную почву (50% песка, 30% глины, 20% грунтосмеси), в которую вносили сырую нефть (5,0 вес. %) — модельную смесь углеводородов (н-декан, н-ундекан, н-додекан, н-тетрадекан, н-гексадекан, н-гептадекан, н-нонадекан — 11,90% каждый, при-стан — 3,96%, антрацен, аценафтен, нафталин, фе-нантрен — 2,68% каждый) в концентрации 5,0 вес. %- модельную смесь ПАУ (бензо (а)пирен, нафталин, пирен, фенантрен, хризен в равных количествах) в концентрации 0,01 вес. %- соли тяжелых металлов
(NH4)6Mo7O24 или NiSO4 в концентрации 1,0 вес. %. Почву вносили в стеклянные колонки или пластиковые контейнеры и обрабатывали с помощью Rhodococcus-биосурфактантов (4 г/л), синтетического сурфактанта Твина 60 (1 г/л) или иммобилизованных родококков (4 X 108 клеток/г почвы) при комнатной температуре в течение 1−4 мес. Подобранные концентрации (био)сурфактантов соответствовали трем критическим концентрациям мицеллообразования. Интенсивность биоремедиации оценивали по дыхательной активности почвы с помощью респирометра Micro-Oxymax® («Columbus Instruments», США). Остаточные нефтепродукты и тяжелые металлы определяли методами хромато-масс-спектрометрии и атомно-эмиссионной спектроскопии соответственно. Мониторинг интродуцированных родококков в почве проводили методом прямой ПЦР-детекции с праймерами к генам 16S рРНК видов R. erythropolis (Re1 5'-CGTCTAATACCGGATATGACCTCCTATC3'-, Re2 5'-GCAAGCTAGCAGTTGAGCTGCTGGT 3'-) и R. ruber (Ru1 5GTCTAATACCGGATAGGACCTCGGGA3'-. Ru2 5TACCGTCACTTGCGCTTCGTCGGTAC3'-) [11]. Комплексообразование ионов металлов с Rhodococcus-биосурфактантами регистрировали методом ионообменного анализа с помощью измерения констант условной стабильности [12], а также методом пошагового спектрофотометрического сканирования смеси биосурфактанта и металла при X от 180 до 1200 нм.
Результаты исследований.
В результате скрининга коллекционных культур актинобактерий выявлены эффективные продуценты биосурфактантов (R. erythropolis ИЭГМ 186, ИЭГМ 267, ИЭГМ 275, ИЭГМ 708, R. fascians ИЭГМ 38, R. rhodochrous ИЭГМ 647, R. ruber ИЭГМ 231, ИЭГМ 327), характеризующиеся высокой (E24 = 3875%) эмульгирующей активностью, максимальными показателями устойчивости к солям тяжелых металлов (МИК & gt- 100 мМ), аккумуляции ионов тяжелых металлов (48−88%), углеводородокисляющей активности (16−20 г/(л-ч)). Установлено, что индукция ок-сигеназного ферментного комплекса путем предварительного выращивания данных штаммов в присутствии н-алканов и последующая иммобилизация на поверхности модифицированных опилок или в гранулах ПВС приводит к увеличению их металлорези-стентности в 2−4 раза, аккумулирующей способности на 10−15%, углеводородокисляющей активности в 4−16 раз. Иммобилизованные клетки R. erythropolis ИЭГМ 275 и R. ruber ИЭГМ 231 были использованы нами в дальнейших экспериментах.
Показано, что внесение Rhodococcus-биосурфактантов в модельную почву приводит к снижению уровня загрязнения сырой нефтью на 76%, модельной смесью углеводородов на 39%, ПАУ на 75%, молибдат ионами на 88%, катионами никеля на 92% (табл. 1). Как видно из рис. 1, интенсивность процесса десорбции нефтяных углеводородов из почвы под воздействием Rhodococcus-биосурфактантов на 6−78% выше таковой синтетического Твина 60. При этом наиболее эффективное извлечение нефтяных углеводородов наблюдается в случае прямоцепочечных и разветвленных алканов с длиной цепи 16−19 атомов углерода, а также полициклического углеводорода фенантрена. Экспериментально доказано, что вымы-
66
www. m-avu. narod. ru
Таблица 1
Уровень остаточного загрязнения в почве после биоремедиации (вес. %)
~~ Загрязнитель Способ ~~ биоремедиации Сырая нефть Mодельная смесь углеводородов ПАУ MoO42- Ni2+
Rhodococcus-биосурфактанты 1,2 1,5 0,0025 0,12 0,08
Родококки, иммобилизованные на модифицированных опилках 3,3 1,8 0,0060 0,77 0,70
Родококки, иммобилизованные в ПВС 2,8 1,7 0,0070 0,78 0,72
Контроль (почва без обработки) 4,5 3,1 0,0100 0,94 0,95
вание тяжелых металлов из почвы под воздействием Rhodococcus-биосурфактантов связано с образованием прочных хелатных комплексов между металлом и молекулами биосурфактанта. При этом рассчитанные молярные соотношения органических лигандов биосурфактантов и ионов тяжелых металлов составляли (2,28 ± 0,30), константы условной стабильности составляли (9,15 ± 1,05). Данные показатели в 2,5 раза превышали таковые для описанных в литературе комплексов ионов тяжелых металлов с рамнолипи-дом из Pseudomonas aeruginosa [12].
Применение иммобилизованных родококков способствует удалению из почвы от 34 до 65% нефтяных углеводородов и извлечению от 23 до 30% ионов MoO42- и Ni2+ (табл. 1). При этом не выявлено различий между функциональной активностью ро-дококков, включенных в полимерный гель и адсорбированных на поверхности опилок. Независимо от способа иммобилизации интродуцированные родо-кокки сохраняли высокую функциональную активность и стабильно доминировали в бактериоценозе загрязненной почвы на протяжении всего периода биоремедиации. Показано, что внесение в почву иммобилизованных родококков приводит к интенсификации процессов почвенного дыхания, обусловленных биодеградацией углеводородов. Так, потребление кислорода и выделение углекислого газа в почве с иммобилизованными клетками в 4 раза превышает данные показатели в нативной почве, содержащей только аборигенные микроорганизмы (рис. 2). Как видно из рис. 3, направленная интродукция родо-кокков в почвенные экосистемы сопровождается изменениями структуры природного бактериоценоза. Установлено, что при внесении иммобилизованных клеток R. erythropolis или R. ruber в почву их доля в популяции углеводородокисляющих бактерий увеличивается с 2,0% до 7,0%, или с 0,5 до 5,0%, в течение двух недель биоремедиации соответственно. К концу биоремедиационного процесса относительное содержание родококков в очищенной почве снижается до уровня, характерного для нативной почвы, что указывает на экологическую безопасность использования иммобилизованных родококков для очистки природных биотопов, загрязненных углеводородами и солями тяжелых металлов. По нашим данным, представители R. erythropolis изначально присутствуют в нефтезагрязненной почве, что свидетельствует об их убиквитарности и высокой конкурентоспособности в автохтонных микробных популяциях. В то же время R. ruber характеризуются высокой резистентностью к неблагоприятным факторам внешней среды (пониженным температурам, высокой кислотности и солености, повышенным концентрациям ксенобиотиков) и могут быть использованы в экстремальных экологических условиях или при высоком уровне загряз-www. m-avu. narod. ru
5. 00
^ ^ ¦ Исходное загрязнение
4 00 ¦ Контроль (вода)
3. 50 пТвин 60
3 QQ? Rhodococcus-биосурфактант
2. 50 —
2. 00 —
1. 50 —
ГІЛМІ
Углеводороды
Рисунок 1
Содержание нефтяных углеводородов в почве после обработки (био)сурфактантами Углеводороды: 1 — антрацен, 2 — аценафтен, 3 — нафталин, 4 — фенантрен, З — пристан, 6 — н-декан, 1 — н-ундекан, 8 — н-додекан, 9 — н-тетрадекан, 10 — н-гексадекан, 11 — н-гептадекан, 12 — н-нонадекан.
нения. Таким образом, внесение иммобилизованных родококков обеспечивает эффективную деградацию углеводородов и детоксикацию тяжелых металлов, тогда как применение Rhodococcus-биосурфактантов приводит к увеличению подвижности и биодоступности данных загрязнителей для почвенных микроорганизмов.
Выводы. Рекомендации.
Установлено, что применение Rhodococcus-сурфактантов и биокатализаторов на основе иммобилизованных родококков способствует извлечению из почвы до 80−90% нефтяных углеводородов и тяжелых металлов. Экспериментально подтверждена экологическая безопасность разработанных биопрепаратов для использования в открытых экосистемах. Выявлена эффективность Rhodococcus-биосурфактантов и иммобилизованных родококков в отношении наиболее устойчивых к разложению компонентов сырой нефти (высокомолекулярные алканы, ПАУ) и тяжелых металлов. Подтверждена целесообразность замены синтетических сурфактантов бактериальными аналогами, которые проявляют повышенную десорбирующую активность по сравнению с Твином 60. Следует отметить, что использованные в работе культуры родококков выделены на территории Уральского региона и адаптированы к условиям холодного и умеренного климата. Таким образом, полученные Rhodococcus-сурфактанты и иммобилизованные клетки родококков могут быть рекомендованы для использования в технологиях ремедиации загрязненных и антропогенно нарушенных территорий Урала, в том числе для борьбы с хроническими нефтезагрязнениями. Для разработки технологии биоремедиации загрязненных углеводородами и тяжелыми металлами почв, готовой к внедрению, целесообразно дальнейшее продолжение исследований в полевых условиях, в том числе при совместном использовании Rhodococcus-биосурфактантов и иммобилизованных родококков.
еї
Время, ч Время, ч
Рисунок 2
Дыхательная активность нефтезагрязненной почвы с иммобилизованными родококками Варианты опыта: 1 — нефтезагрязненная почва + родококки на модифицированных опилках,
2 — контроль (нефтезагрязненная почва)
* I? a
* О arS 0−0- -fl) О '-S et С[ S
61
5
4
з
2
? Нефтезагрязненная почва + родококки в ПВС
П
п
п
14
Время, нед
Рисунок 3
Динамика изменения относительного содержания представителей R. erythropolis ИЭГМ 275 и R. ruber ИЭГМ 231 в почвенных
углеводородокисляющих бактериоценозах
Исследования поддержаны грантами ФЦП 16. 518. 11. 7069- 16. 513. 12. 3015) и Министерства об-«Исследования и разработки по приоритетным на- разования Пермского края по поддержке научных правлениям развития научно-технологического проектов международной исследовательской группы комплекса России на 2007−2013 гг.» (госконтракты ученых (Соглашение № С-26−206).
Литература
1. Gan S., Lau E. V., Ng H. K. Remediation of soils contaminated with polycyclic aromatic hydrocarbons (PAHs) // Journal of Hazardous Materials. 2009. V. 172. P. 532−549.
2. Mulligan C. N., Yong R. N., Gibbs B. F. An evaluation of technologies for the heavy metal remediation of dredged sediments // Journal of Hazardous Materials. 2001. V. 85. P. 145−163.
3. Megharaj M., Ramakrishnan B., Venkateswarlu K., Sethunathan N., Naidu R. Bioremediation approaches for organic pollutants: a critical perspective // Environment International. 2011. V. 37. P. 1362−1375.
4. Gondall M. A., Hussain T., Yamari Z. H., Baig M. A. Detection of heavy metals in Arabian crude oil residue using laser induced breakdown spectroscopy // Talanta. 2006. V. 69. P. 1072−1078.
5. Mulligan C. N. Environmental applications for biosurfactants // Environmental Pollution. 2005. V. 133.
P. 183−198.
6. Костина Л., Куюкина М., Ившина И. Биосорбция, биоаккумуляция и способы извлечения тяжелых металлов. Saarbrucken: LAP Lambert Academic Publishing, 2010. 254 с.
7. Kuyukina M. S., Ivshina I. B. Rhodococcus biosurfactants: biosynthesis, properties and potential applications // Microbiology Monographs. London- New York: Springer-Verlag, 2010. V. 16. P. 292−313.
8. Martinkova L., Uhnakova B., Patek M., Nesvera J., Kren V. Biodegradation potential of the genus Rhodococcus // Environment International. 2009. V. 35. P. 162−177.
9. Патент Р Ф. 2007. № 2 298 033.
10. Ivshina I. B., Kuyukina M. S., Philp J. C., Christofi N. Oil desorption from mineral and organic materials using biosurfactant complexes produced by Rhodococcus species // World Journal of Microbiology and Biotechnology.
1998. V. 14. P. 711−717.
11. Bell K. S., Kuyukina M. S., Heidbrink S., Philp J. C., Aw D. W. J., Ivshina I. B., Christofi N. Identification and environmental detection of Rhodococcus species by 16S rDNA-targeted PCR // Journal of Applied Microbiology.
1999. V. 87. P. 472−480.
12. Ochoa-Loza F. J., Artiola J. F., Maier R. M. Stability constants for the complexation of various metals with a rhamnolipid biosurfactant // Journal of Environmental Quality. 2001. V. 30. P. 479−485.
68 www. m-avu. narod. ru

ПоказатьСвернуть
Заполнить форму текущей работой