Новая тест-система для скрининга ингибиторов серин-треониновых протеинкиназ: конструкт Escherichia coli APHVIII/Pk25

Тип работы:
Реферат
Предмет:
Биология


Узнать стоимость

Детальная информация о работе

Выдержка из работы

УДК 579. 69
Новая тест-система для скрининга ингибиторов серин-треониновых протеинкиназ: конструкт Escherichia coli APHVIII/Pk25
О. Б. Беккер1, М. Г. Алексеева1, Д. И. Осолодкин2, В. А. Палюлин2, С. М. Елизаров3,
Н. С. Зефиров2, В. Н. Даниленко1*
1 Учреждение Российской академии наук Институт общей генетики им. Н. И. Вавилова РАН, 119 991, Москва, ул. Губкина, 3
2 Химический факультет Московского государственного университета им. М. В. Ломоносова, 119 991, Москва, Ленинские горы, д. 1, стр. 3
3 Учреждение Российской академии наук Институт биохимии им. А. Н. Баха РАН, 119 071, Москва, Ленинский просп., 33
*E-mail: valerid@rutenia. ru Поступила в редакцию 28. 06. 2010 г.
РЕФЕРАТ Разработана оригинальная тест-система для скрининга ингибиторов серин-треониновых протеинкиназ на основе штамма Escherichia coli APHVIII/Pk25. Фосфорилирование протеинкиназами фермента аминогликозидфосфотрансферазы VIII (APHVIII), инактивирующего аминогликозидные антибиотики, увеличивает устойчивость бактерий к антибиотику канамицину. Ингибиторы протеинкиназ, напротив, снижают устойчивость клеток бактерий к канамицину. Получены модификации APHVIII, в которых сайт фосфорилирования Ser-146, фосфорилируемый киназой Pk25, изменен в соответствии с канонической последовательностью аутофосфорилирования Pk25 Streptomyces coelicolor. Модифицированные и исходный гены aphVIII клонированы в E. coli одновременно с геном, кодирующим каталитический домен pk25. При экспрессии этих генов в клетках происходит накопление кодируемых ими белков. Выделенный каталитический домен Pk25 сохраняет киназную активность полноразмерной протеинкиназы. Варианты E. coli, содержащие одновременно гены aphVIII и pk25, более устойчивы к канамицину, чем варианты, несущие только ген aphVIII. Ингибиторы протеинкиназ класса индолилмалеимидов подавляют активность Pk25 и понижают устойчивость клеток к канамицину. Моделирование пространственных структур APHVIII и Pk25 показало, что фосфорилируемый в молекуле APHVIII Ser-146 является аналогом фосфо-серина в области рибозного кармана протеинкиназ типа РКА, а структура Pk25 подобна структуре РknB Mycobacterium tuberculosis. Результаты докинга указывают на взаимодействие эффективных ингибиторов протеинкиназы Pk25 с АТФ-связывающей областью киназы. Разработанная оригинальная тест-система может быть использована для первичного отбора АТФ-конкурентных низкомолекулярных ингибиторов серин-треониновых протеинкиназ бактерий и человека.
КЛЮЧЕВЫЕ СЛОВА серин-треониновые протеинкиназы, индолилмалеимиды, скрининг ингибиторов протеинкиназ, бактериальная тест-система, Streptomyces.
ВВЕДЕНИЕ
Серин-треониновые протеинкиназы (СТПК) — универсальные регуляторы клеточного метаболизма эукариот [1−3]. Им также принадлежат ключевые роли в контроле процессов апоптоза, пролиферации и дифференцировки клеток, транспорта веществ из клетки и др. Нарушение функционирования киназ ассоциировано с развитием многих заболеваний человека, таких, как диабет [4], шизофрения [5], сердечно-сосудистые расстройства [6], а также
с патологическими состояниями, например канцерогенезом [7] и нарушением иммунитета [8]. В последние десятилетия интенсивное развитие получил биомишень-направленный поиск модуляторов (ингибиторов) протеинкиназ как потенциальных лекарственных препаратов нового поколения [9−11].
Серин-треониновые протеинкиназы эукариотического типа обнаружены у бактерий, включая патогенные для человека [12]. Установлено, что СТПК участвуют в формировании вирулентности, бакте-
риальных биопленок, поддержании толерантности, персистировании патогенных микроорганизмов. Показано ключевое значение СТПК в формировании вирулентности Streptococcus pneumonia, Mycobacterium tuberculosis, Staphylococcus aureus, Pseudomonas aeruginosa и ряда других патогенных бактерий [12−14]. Установлено их участие в модуляции устойчивости к антибиотикам у M. tuberculosis [15]. В последнее время ведется интенсивная работа по скринингу ингибиторов СТПК [16−19].
Ранее нами была разработана тест-система [20] для первичного скрининга (прескрининга) ингибиторов СТПК на основе сконструированного штамма Streptomyces lividans TK24 (66) APHVIII+, ключевым элементом которой является фермент, инактивирующий аминогликозидные антибиотики, — ами-ногликозидфосфотрансфераза типа VIII (APHVIII). Ген aphVIII, выделенный из генома Streptomyces rimosus, был клонирован и экспрессирован в S. livi-dans TK24 (66). Важной особенностью APHVIII S. ri-mosus является зависимость активности фермента от уровня его фосфорилирования эндогенными СТПК [21]. Фосфорилирование фермента APHVIII придает клеткам Streptomyces устойчивость к аминогликозид-ным антибиотикам. Ингибиторы СТПК препятствуют фосфорилированию и делают клетку более чувствительной к аминогликозидам [20]. Такая система изменения чувствительности клеток к аминогликозидам в присутствии ингибиторов СТПК позволяет вести первичный отбор ингибиторов этих СТПК. В геноме S. coelicolor A3(2) NC_3 888, близкородственном штамму S. lividans TK24 (66) ACEY01000000, идентифицированы и аннотированы 34 СТПК. Как минимум одна из них — протеинкиназа Рк25 (код доступа NCBI Reference Sequence: Protein NP_628 936. 1) — способна фосфорилировать APHVIII [22]. Для исключения неспецифического действия ингибиторов на другие СТПК S. lividans TK24 (66), предположительно способные фосфорилировать APHVIII, сконструирована и описана в данной работе тест-система на основе фермента APHVIII и каталитического домена протеинки-назы Pk25 в штамме Escherichia coli. Отсутствие в геноме E. coli собственных генов СТПК эукариотического типа делает тест-систему более чувствительной и позволяет отбирать ингибиторы, специфичные в отношении только Рк25 и ее близких гомологов [23].
экспериментальная часть
Штаммы: S. coelicolor A3(2) (ВКПМ, г. Москва), S. lividans TK24 (66) APHVIII+ (код доступа в GenBank ACEY01000000), E. coli DH5a: F-, Ф 80 AlacZAM15, A (lacZYA-argF), U169 (Promega) — BL21(DE3): F-, dcm, ompT, hsdS (rB-mB-), gaR (DE3) (Novagen).
Плазмидные векторы: pET16b, pET22b и pET32a (Novagen).
Среды. Для выращивания штаммов S. coelicolor A3(2) и S. lividans TK24 (66) использовались среды YSP и YEME [24]. Для выращивания E. coli использовали среду Лурия (L-бульон), NZCYM, М9-среду с 1. 5% глицерина (на 1 л): 6 г Na2HPO4, 3 г KH2PO4, 0.5 г NaCl, 1 г NH4Cl, рН 7. 4, 2 мл 1 М MgSO4, 15 мл глицерина. Для обеспечения селективного роста плазмидсодержащих клеток добавляли ампициллин (100 мкг/мл). Для экспрессии белка использовали индуктор IPTG в концентрации 1 мМ.
Процедуры молекулярного клонирования. Выделение тотальной ДНК штаммов S. coelicolor A3(2) и S. lividans TK24 (66) APHVIII проводили согласно руководству [24]. Выделение плазмидной ДНК, приготовление компетентной культуры E. coli, трансформацию и анализ рекомбинантных плазмид проводили с использованием стандартных методов [25]. Амплификацию ДНК методом полимеразной цепной реакции (ПЦР) проводили с использованием набора «Амплификация» фирмы «Dialat Ltd.» на приборе Терцик ТП4-ПЦР01 (ДНК-Технология). Температурный режим подбирали с учетом длины и состава праймеров. Олигонуклеотиды синтезированы фирмой «Синтол». Они представлены в табл. 1. Нуклеотидную последовательность ДНК определяли по методу Сэнгера. Сравнительный анализ нуклеотидных последовательностей проводили с использованием программы BLAST (http: //www. ncbi. nlm. nih. gov/blast).
Электрофорез белков проводили в 12% полиакриламидном геле в денатурирующих условиях как описано ранее [21]. Для этого клетки, содержащие сконструированные плазмиды, выращивали в жидкой среде NZcYM, содержащей ампициллин (150 мкг/мл) при 34 °C до оптической плотности 0.6 (~1.5 ч), затем индуцировали экспрессию каталитического домена киназы добавлением IPTG до финальной концентрации 1 мМ. Далее проводили культивирование при 28 °C в течение 4 ч, отбирали биомассу, которую суспендировали в буфере: 62.5 мМ Трис-HCl, pH 6. 8- 5% глицерин- 2% меркаптоэтанол- 0. 1% SDS- бром-феноловый синий. Клетки разрушали кипячением в течение 10 мин в буфере и анализировали белки электрофорезом в полиакриламидном геле. В ячейки геля вносили по 25 мкг суммарного белка фракции. Электрофореграммы белков сканировали на лазерном денситометре Ultroscan 2205 LKB. В качестве контроля использовали фракцию белков штамма E. coli BL21(DE3), содержащего вектор без вставки.
Выделение белка клонированного в E. coli каталитического домена протеинкиназы Pk25. Клетки E. coli разрушали двукратной обработкой ультразвуком в буфере, содержащем 20 мМ Трис-HCl, рН
Таблица 1. Праймеры, использованные в работе*
Название Сайты рестрикции Структуры праймеров 5'--3'-
Pk25EN EcoRI ATCCGAATTATGGCACGGAAGATCGGCAG
Pk25C HindIII CCGCAAGCTTGGTGCCGTTGCCGGAACCG
Pk25CN NdeI TCGTCATATGCGTTACCGGCTCCATGAGCGGC
Pk25CC HindIII CCGCAAGCTTCATCCGCTGGGCCGACGCCG
Pk25NBgl Bgl II TTTTAGATCTAATAAGGAGATATACATGTACCGGCTCCATGAGCGGCT RBS начало кат. домена pk25
Pk25СBgl Bgl II CCG CAG ATC TAT CCG CTG GGC CGA CGC CGC
T7prom — TTAATACGACTCACTATAGG
T7term — CTAGTTATTGCTCAGCGG
APH 14б-1(+) — GCTGTCGCTACAGGGACGGTCAGCTTGGAGGATCTGGAC
APH 14б-1(-) — GTCCAGATCCTCCAAGCTGACCGTCCCTGTAGCGACAGC
APH 14б-2(+) — GCTGTCGCTACAGGGAGCGTCACCTTGTCGGATCTGGACGAG
APH 14б-2(-) — CTCGTCCAGATCCGACAAGGTGACGCTCCCTGTAGCGACAGC
APH 146-T (+) — GTCGCTGAAGGGACCGTCGACTTGGAG
APH 146-T (-) — CTCCAAGTCGACGGTCCCTTCAGCGAC
AphN NdeI TTTTCATATGGACGATGCGTTGCGTGC
AphC BamHI TTTTGGATCCTCAGAAGAACTCGTCCAAC
*Сайты узнавания рестриктазами выделены жирным шрифтом, нуклеотидные замены — однократным подчеркиванием.
7. 8, 10 мМ 2-меркаптоэтанола, 300 мМ NaCl и 1 мМ ФМСФ, или в этом же буфере, содержащем дополнительно 8 М мочевины. Нерастворимый материал удаляли центрифугированием при 20 000 g в течение 20 мин. Фракции растворенных белков E. coli наносили на колонки с Ni-NTA-агарозой (Qiagen), интенсивно промывали смолу буфером того же состава, содержащим дополнительно 50 мМ имидазола, рН 6. 0, и элюировали адсорбированный белок, пропуская через колонки соответствующий буфер (без мочевины — для нативного солерастворимого белка и с мочевиной — для денатурированного нерастворимого белка) с градиентом концентрации имидазола 0. 05−0.5 М [20]. Белки в элюате анализировали SDS-PAGE.
Анализ аутофосфорилирования выделенного белка каталитического домена Pk25 in situ проводили после разделения выделенного белка электрофорезом в денатурирующих условиях. Для ренатура-ции протеинкиназы в геле использовали процедуру Камешита и Фуджисава [26]. Гель с включенным в него белком интенсивно промывали для удаления SDS 50 мМ Трис-HCl, pH 7.8 с 25% 2-пропанолом и 8 М мочевиной. Далее проводили ренатурацию белка, удаляя денатуранты промыванием геля последовательно буферами А: 50 мМ Трис-HCl, pH 7. 8, и Б: 50 мМ Трис-HCl, pH 7. 8, 100 мМ NaCl, 6 мМ 2-мер-каптоэтанола, 5 мМ MgCl2, 1 мМ CaCl2. Затем гель инкубировали в присутствии 50 мкКи/мл [у^^АТФ
(7000 Ки/мМ, «Фосфор», РФ) в буфере Б для анализа протеинкиназной активности [21]. Белок в геле фиксировали и окрашивали в 40% ТХУ, отмывали от ТХУ и непрореагировавшей метки 5% уксусной кислотой, высушивали и ауторадиографировали, экспонируя с рентгеновской пленкой Kodak X-Omat AR.
Процедура клонирования в экспрессионные векторы pET32a, pET22b и pET^b. Клонирование гена протеинкиназы pk25 штамма S. coelicolor A3(2) и аналогичного гена штамма S. lividans ТК24 (бб) в E. coli проводили в составе экспрессионного вектора pET32a по сайтам EcoRI и HindIII (праймеры Pk25EN и Pk25C) (табл. 1). Клонирование каталитического домена протеинкиназы pk25 штамма S. coelicolor A3(2) в E. coli проводили в составе экспрессионного вектора pET22b по сайтам NdeI и HindIII (праймеры Pk25СN и Pk25СC). Клонирование модифицированного гена aphVIII в E. coli осуществляли в составе экспрессионного вектора pET^b по сайтам NdeI и XhoI (праймеры AphN и AphC). Клонирование каталитического домена протеинкиназы pk25 штамма S. coelicolor A3(2) в E. coli осуществляли в составе экспрессион-ных векторов pET^b + aphVIII146-S с немодифи-цированным сайтом фосфорилирования APHVIII, pET^b + aphVIII146−1, pET^b + aphVIII146−2, pET^b + aphVIII146−3 — с модифицированными сайтами по рестрикционному сайту BamHI (праймеры Pk25NBgl и Pk25СBgl).
Клонирование нуклеотидной последовательности каталитического домена протеинкиназы рk25 проводили в составе экспрессионного вектора рЕТ22Ь по сайтам NdeI-HindIII (праймеры Pk25CN, гомологичный N-концевой области каталитического домена, и Рк25СС, гомологичный С-концевой области каталитического домена). Для наработки фрагмента проводилась амплификация с тотальной ДНК S. coelicolor. Фрагмент ДНК, соответствующий каталитическому домену гена протеинкиназы рk25, препаративно выделяли из агарозного геля, секвенировали и клонировали в составе плазмиды рЕТ22Ь по сайтам эндонуклеаз рестрикции NdeI и HindIII. Полученной лигазной смесью трансформировали штамм E. coli DH5a. Скрининг рекомбинантных клонов осуществляли при помощи ПЦР с использованием стандартных праймеров T7prom и T7term. Из отобранных трансформантов выделяли плазмидные ДНК и проводили повторное секвенирование или рестрикционный анализ гибридных плазмид на наличие вставки. Далее полученными плазмидами рЕТ22b-рk25 трансформировали штамм E. coli BL21(DE3).
Cайт-направленный мутагенез области Ser-146 аминогликозидфосфотрансферазы APHVIII. Для проведения сайт-направленного мутагенеза использован метод точковых мутаций Нельсона [27]. Для получения мутантного варианта 1 (аминокислотные замены: Ser-146^Thr-146, Glu-144^Thr-144, Asp-148 Ser-148) синтезированы праймеры APH 146-
1(+) и APH 146−1(-) (табл. 1), предусматривающие данные замены. Для получения мутантного варианта
2 (замены Glu-144^Thr-144, Asp-148^Ser-148, Glu-150^Ser-150) синтезированы праймеры APH146−2(+) и APH146−2(-). Вариант 3 представляет собой замену Ser-146^Thr-146, проведенную с помощью синтезированных праймеров APH146-T (+) и APH146-T (-).
В качестве внешних праймеров использовались AphN и AphC, соответствующие 5'-- и З'--концевым фрагментам структурной части гена aphVIII.
Полученные в результате проведенного мутагенеза фрагменты секвенировали для подтверждения соответствующих нуклеотидных замен, после чего клонировали в составе мультикопийного вектора рЕТ16Ь под контроль транскрипционного и трансляционного сигналов бактериофага Т7 в рамке считывания с ATG экспрессионного участка по сайтам эндонуклеаз рестрикции NdeI и BamHI с последующей трансформацией штамма E. coli DH5a. Скрининг рекомбинантных клонов осуществляли при помощи ПЦР с использованием праймеров T7prom и T7term. Из отобранных трансформантов выделяли плазмидные ДНК и ре-секвенировали полученные мутантные гены.
Определение уровня устойчивости к канамицину отобранных трансформантов E. coli BL21(DE3).
Для анализа использовали клоны трансформантов E. coli BL21(DE3), содержащие гены исходной либо модифицированной aphVIII или aphVIII и рk25 в составе вектора pET16b. С помощью репликатора клоны трансформантов, устойчивые к ампициллину в концентрации 100 мкг/мл, переносили на чашки Петри с LB-средой, содержащей различные концентрации аминогликозидного антибиотика канамицина и индуктор IPTG, и фиксировали рост колоний через 25 ч культивирования при 37 °C.
Определение активности ингибиторов протеин-киназ на бактериальной тест-системе. Для определения активности ингибиторов использовался метод бумажных дисков. Методика заключалась в определении величины зоны подавления роста штамма, засеянного газоном на агаризованной среде, вокруг бумажных дисков, содержащих антибиотик или антибиотик в сочетании с ингибиторами серин-треониновых протеинкиназ. Тест-система: E. coli BL21(DE3)APHVШ/Рk25. Бактерии, выращенные на агаризованной LB-среде с ампициллином, смывали в жидкую LB-среду и выращивали в течение ночи при 37оС. Клетки центрифугировали (4000 об/мин, 10 мин). Осадок ресуспендировали в жидкой среде М9. Бактериальную суспензию смешивали с содержащей ампициллин и индуктор IPTG расплавленной агаризованной средой М9, в соотношении 1: 1 (v/v) и заливали полученной смесью чашки Петри с агаризованной средой М9 с ампициллином и IPTG. Ампициллин необходим для поддержания плазмиды в штаммах E. coli. На поверхность агара накладывали бумажные диски, содержащие антибиотик кана-мицин или антибиотик и ингибитор протеинкиназ. Культуру инкубировали в течение 1б ч при 37оС.
Моделирование структуры каталитического домена Рk25. В качестве шаблонов для построения модели структуры каталитического домена Pk25 были использованы рентгеноструктурные данные по киназе PknB M. tuberculosis (коды доступа в банке белковых структур PDB [28]: 1MRU [29], 106Y [30], 2FUM [31], 3F61 [32], 3F69 [32]). Аминокислотные последовательности шаблонных белков были извлечены непосредственно из структурных файлов, последовательность Pk25 S. coelicolor A3(2) была получена из GenBank (код доступа 21 223 157 [33]) — аннотирование каталитического домена было осуществлено на основании гомологии. Выравнивание аминокислотных последовательностей осуществляли с помощью программы ClustalX 2.0. 11 [34]. Моделирование осуществляли с помощью программы Modeller 9v5 [35]. Генерировали 35 различных моделей каталитических доменов, каждую из которых оптимизировали методом моделирования отжига. Лучшую модель выбирали на основе оценочной функции DOPE,
реализованной в Modeller, и валидации программой PROCHECK [3б]. Дальнейшую оптимизацию модели проводили в программном комплексе SYBYL 8.0 [37]: к моделям добавляли все требуемые атомы водорода и проводили 150 шагов минимизации энергии в силовом поле Tripos [38] методом Пауэлла.
Моделирование структуры каталитического домена APHVIII. Для моделирования структуры каталитического домена аминогликозидфосфотранс-феразы VIII дикого типа и ее мутантных вариантов была использована структура комплекса наиболее гомологичного белка APH (3'-)-IIa (код доступа 1ND4 [39], идентичность аминокислотной последовательности 36%) с канамицином. Методология моделирования аналогична описанной выше за тем исключением, что в каждом случае строили 50 моделей.
Докинг ингибиторов в модель структуры киназы Pk25 проводили с использованием программы Autodock 4.1 [40]. Структуры ингибиторов были сгенерированы с помощью средств программного комплекса SYBYL 8.0 и оптимизированы в силовом поле MMFF94 [41]. Подготовку к докингу осуществляли в программном комплексе MGLTools 1.5.4 [42] в соответствии с общепринятыми рекомендациями. Построение решеточных полей и докинг осуществляли с использованием параметров по умолчанию- расположение решетки для расчета потенциала лиганд-рецепторного взаимодействия выбирали таким образом, чтобы она включала в себя все важнейшие аминокислотные остатки области связывания АТФ. При докинге каждого лиганда поиск с помощью генетического алгоритма запускали 100 раз- результаты докинга группировали в кластеры, используя пороговое значение среднеквадратичного отклонения, равное 2.0 A. Анализ результатов докинга проводили с помощью MGLTools 1.5.4.
РЕзуЛЬТАТы
Клонирование и сравнение полноразмерного гена серин-треониновой протеинкиназы pK25 S. coelicolor и pK25 S. lividans
В секвенированной нуклеотидной последовательности генома S. lividans TK24 ACEY01000000 ген про-теинкиназы, гомологичный гену pK25 S. coelicolor на 99. 8%, отличается шестью нуклеотидами, в том числе содержит вставку — C (664). Наличие вставки ведет за собой сдвиг рамки считывания в аминокислотной последовательности каталитического домена. Для сравнения интересующих нас протеинкиназ, имеющихся в нашей коллекции штаммов S. coelicolor A3(2) и S. lividans TK24 (бб), было проведено клонирование и секвенирование генов этих протеинкиназ. Для выделения генов pK25 серин-треониновых про-теинкиназ из геномов S. coelicolor и S. lividans были
синтезированы два олигонуклеотида (Pk25EN, гомологичный проксимальной (N-концевой) области значащей части цепи гена- Pk25C, комплементарный дистальной части (C-концевой) значащей цепи гена), содержащие в своем составе сайты рестрикции HindIII и EcoRI (табл. 1). В результате амплификации с тотальной ДНК S. coelicolor и S. lividans были наработаны заданные ДНК-фрагменты и клонированы в составе экспрессионного вектора рЕТ32а по сайтам эндонуклеаз рестрикции HindIII и EcoRI в штамм E. coli DH5a. Секвенированием и анализом ДНК-фрагментов их идентифицировали как pK25. При сравнении генов S. coelicolor и S. lividans найдены нуклеотидные замены в позициях 123, 237, 279, 435, 963 от первого кодона atg структурной области гена pK25 S. lividans. Данные замены не приводят к заменам аминокислот в белковой последовательности. Таким образом, аминокислотные последовательности полноразмерного продукта гена pK25 S. coeli-color и S. lividans являются идентичными.
Клонирование и экспрессия нуклеотидной последовательности каталитического домена протеинкиназы Pk25 штамма S. coelicolor в экспрессионный вектор pET22b
Для клонирования были синтезированы два олигонуклеотида ^к25С^ Pk25СС), которые содержали в своем составе сайты для рестриктаз NdeI и HindIII (табл. 1). Полученный в результате амплификации фрагмент рестрицировали и клонировали в E. coli DH5a в составе экспрессионного вектора рЕТ22Ь. После ресеквенирования сконструированными векторами трансформировали экспрессионный штамм E. coli BL21(DE3).
Для изучения экспрессии нуклеотидной последовательности каталитического домена протеин-киназы в клетках отобранных трансформантов E. coli проводили гель-электрофорез растворимой фракции клеточных белков в денатурирующих условиях. В качестве контроля использовали фракцию белков из клеток штамма E. coli BL21(DE3) рЕТ22Ь. В клетках E. coli, содержащих плазмиду pET22b-Pk25 с последовательностью каталитического домена pk25, наблюдалась единственная по сравнению c контрольными клетками (клетки E. coli, содержащие плазмиду pET22b, но без последовательности каталитического домена pk25) дополнительная фракция белка с молекулярной массой около 28 кДа (рис. 1а). Эта величина соответствует расчетной молекулярной массе (27.8 кДа) каталитического домена протеинкиназы Рк25 штамма S. coe-licolor A3(2). По данным сканирования, содержание белка в дополнительной фракции составляет до 3. 5% от суммарного белка.








1 2 3 4 5 6 7 8 9 10
28 кДа*
Рис. 1. а — Электрофорез растворимой фракции белков штамма E. coli BL21(DE3). 1 — маркеры,
2 — контроль (фракция белков из клеток штамма E. coli BL21(DE3) рЕТ22Ь), 3−10 — клоны E. coli, содержащие плазмиду рЕТ22Ь-рк25. (*- белковая фракция, соответствующая каталитическому домену Рк25). б — Электрофорез изолированного каталитического домена Pk25 S. coelicolor в полиакриламидном геле. 1 — ауторадиограмма самофос-форилированного в геле каталитического домена,
2 — окраска Кумасси.
б
а
Моделирование пространственной структуры каталитического домена Pk25
Основные структурные особенности киназы Pk25 отражены в модели. Модель близка к структуре шаблона PknB M. tuberculosis в силу значительной степени идентичности последовательностей (рис. 2а). Суммарный заряд аминокислот каталитического домена равен -3. Наиболее заметные различия между структурами модели и шаблона наблюдаются в области спирали С (вставка четырех аминокислотных остатков в Pk25), в петле между фрагментами Р4 и Р5 (делеция четырех аминокислотных остатков в Pk25) и в области спирали п3 (делеция пяти аминокислотных остатков в Pk25). Конформация активационной петли отличается от шаблона вследствие высокой подвижности петли. Тем не менее, указанные различия не влияют на конформацию аминокислотных остатков в центре связывания АТФ. Пять аминокислотных остатков АТФ-связывающего кармана Pk25 отличаются от соответствующих остатков PknB (рис. 26): V72I, I90M, Y94L, M145L, M155T (нумерация в соответствии с последовательностью PknB). Первые три замены относительно консервативны и не должны оказывать решающего влияния на процесс взаимодействия с ингибитором. Замена Y94L находится в области шарнира, и лиганды взаимодействуют с атомами основной цепи данного остатка, а не с его боковой цепью. Две последние замены не консервативны и должны оказывать влияние на взаимодействие с ингибиторами- в частности, обе замены приводят к увеличению доступного объема кармана связывания. Наконец, благодаря введению
остатка треонина в позицию 155 в этой области появляется дополнительная гидроксильная группа.
Анализ аутофосфорилирования в активационной петле каталитического домена Pk25
Белковую фракцию каталитического домена Pk25, клонированного и экспрессированного в E. coli, выделяли из лизата бактерий хроматографией на гистидинсвязывающей смоле в нативных условиях или в присутствии 8 М мочевины и после электрофоретического разделения анализировали его внутриклеточную локализацию и способность к аутофосфорилированию in situ. Было показано, что во фракции солерастворимых белков клетки каталитический домен Pk25 отсутствует. Этот рекомбинантный белок локализуется во фракции нерастворимых белков клетки и может быть переведен в растворимое состояние в присутствии мочевины, что и было проделано. После электрофоретического разделения значение молекулярной массы анализируемого фрагмента составляет 28 кДа, что хорошо совпадает с расчетным значением для клонированного домена. В присутствии [у_32Р]АТФ белок включает в свой состав меченый фосфат (рис. 1б). Анализ фосфорилирования после разделения белков в геле позволяет исключить интерферирующее влияние возможных примесей на результаты. В целом, полученные данные указывают на то, что выделенный белок каталитического домена Рк25 является ферментативно активным и способен к аутофосфорилированию. Локализация каталитического домена Рк25-киназы во фракции
Рис. 2. Модель пространственной структуры Рк25. а — Сопоставление структур шаблонного белка PknB M. tuberculosis (зеленый) и Pk25 (окрашена по типам вторичной структуры). б — Карман связывания АТФ в PknB (окрашен по типам атомов) и Pk25 (оранжевый), отмечены неконсервативные аминокислотные остатки. в — Способ связывания LCTA-1425 с киназой Pk25. Ван-дер-ваальсова поверхность киназы окрашена согласно донорно-акцепторным свойствам (красный — донор водородной связи, синий — акцептор).
Рис. 3. Модель пространственной, а структуры АРНУШ. а — Сопоставление структуры АРН (3'-)-11а (код доступа 1ND4, оранжевый) и модели АРНУШ (окрашена по типам вторичной структуры). б — Аминокислотные остатки в активационной петле АРНУШ дикого типа (атомы углерода оранжевые) и мутанта 146−1 (атомы углерода серые).
нерастворимых белков клетки не противоречит возможности его аутофосфорилирования в ходе экспрессии, а также не исключает его активности в отношении растворимых и нерастворимых белков. Эти результаты совпадают с аналогичными данными для каталитических доменов протеинкиназ Streptomyces и Mycobacterium [43−45]. Установлено, что фосфорилирование происходит в активационной петле СТПК по серину. Анализ специфичности фосфорилирования субстратов СТПК M. tuberculosis показал, что с наибольшей эффективностью осуществляется фосфорилирование участков, аналогичных сайтам аутофосфорилирования исследуемой протеинкиназы [46].
Моделирование пространственной структуры ами-ногликозидфосфотрансферазы VIII
Модель структуры каталитического домена АРНУШ близка к структуре шаблонного белка АРН (3')-11а (рис. 3а). Наибольшее подобие структур достигается в областях связывания АТФ и канамицина, а также в активационной петле- небольшие вставки в АРНУШ по сравнению с аминокислотной последовательностью шаблона располагаются в структурно неконсервативных областях петель между различными элементами вторичной структуры белка и не вносят решающего вклада в укладку его основной цепи. Физико-химические свойства и конформации критически важных аминокислотных остатков,
ЭКСПЕРИМЕНТАЛЬНЫЕ СТАТЬИ Таблица 2. Модификации сайта фосфорилирования Ser-146 APHVIII
Исходные ферменты и модифицированные варианты APHVIII Сайты фосфорилирования и их модификации*
Pk25 ATTLTESGSFVG
APHVIII avaegs146vdled
APHVIII146−1 AVATGT VSLED — -14b —
APHVIII146−2 AVATGS VSLSD — 14b — -
APHVIII146−3 AVAEGT, 4bVDLED -14b
APHVIII146−4 avaega146vdled
*Получившиеся в результате модификаций аминокислотные замены выделены подчеркиванием.
образующих области связывания канамицина и АТФ, также совпадают в шаблоне и модели. Структура мутанта APHVIII146−1 почти полностью совпадает со структурой фермента дикого типа. Различия наблюдаются лишь в области активационной петли и мало влияют на глобальную конформацию (рис. 3б).
Сайт фосфорилирования APHVIII — аминокислотный остаток (Ser-146) — аналог фосфосерина в области, гомологичной рибозному карману серин-треониновых протеинкиназ типа РКА [47]. При моделировании молекулярной динамики нефосфорилированной по Ser-146 APHVIII в комплексе с канамицином (с АТФ и двумя связанными ионами Mg2+) были выявлены существенные изменения в структуре фермента, характеризуемые ослаблением контакта между N-и С-концевыми доменами [48, 49].
Модификация области S-146 аминогликозидфосфо-трансферазы APHVIII — сайта фосфорилирования киназой Рк25
Сайт аутофосфорилирования в активационной петле Рк25 был определен путем сравнения с соответствующим районом PknB M. tuberculosis [50]:
PknB DFGI ARAIAD SGNSVTQTAAVGTAQYLSPE Pk25 DFGV AQVAGA TTLTESGSFVGSPEYTAPE
Для оптимизации конструкции тест-системы E. coli APHVIII/Pk25 мы провели модификацию потенциального сайта фосфорилирования AVAEGS146VDLED в активационной петле APHVIII. Целью было приблизить сайт Ser-146 APHVIII по своей структуре к сайту аутофосфорилирования Pk25 TTLTESGSFVG. Для этого проведены модификации окружения Ser-146 фермента APHVIII (табл. 2), предусматривающие аминокислотные замены, выделенные подчеркиванием. Полученные мутантные варианты гена aphVIII146−1, aphVIII146−2, aphVIII146−3, aph-
VIII146−4 лигировали в плазмидный вектор pET16b по сайтам рестрикции NdeI-BamHI и клонировали в штамм E. coli DH5a. После ресеквенирования полученными плазмидами pET16baphVIIIm1 (рис. 4а) трансформировали штамм E. coli BL21(DE3). Для изучения экспрессии белка в клетках E. coli всех вариантов APHVIII проводили гель-электрофорез растворимой фракции клеточных белков в денатурирующих условиях.
В клетках E. coli, содержащих плазмиду pET-16baphVIII, экспрессировался белок одинаковой молекулярной массы — около 31 кДа. Эта величина соответствует расчетной молекулярной массе белка APHVIII, равной 31.5 кДа.
Создание конструкции, содержащей гены аминогли-козидфосфотрансферазы aphVIII и протеинкиназы pk25
Амплификацию р^: 25 проводили с праймеров Pk25N-Bgl и Pk25CBgl (табл. 1) с ДНК плазмидного вектора рЕТ22Ь-рк25. Праймер Pk25NBgl содержит сайт связывания с рибосомой (RBS) и кодон ATG для нуклеотидной последовательности каталитического домена протеинкиназы Pk25. В плазмидные векторы pET16baphVIIIm1, содержащие описанные ранее варианты aphVIII, по сайту BamHI лигировали амплифицированную и рестрицированную по сайту BglII последовательность pk25. Отбор клонов проводили в два этапа. На первом этапе отбирали целевые клоны со вставкой путем амплификации со стандартных векторных праймеров: T7promoter primer и T7terminator primer по величине вставки. На втором этапе отбирали клоны с требуемой ориентацией фрагментов амплификацией с праймеров AphN и Pk25CC (табл. 1) по наличию и величине вставки. После перекрестного ресеквенирования, полученными плазмидами pET16APC (рис. 4б) трансформировали штамм E. coli BL21(DE3). В индуцирующих
Рис. 4. Векторные конструкции. а — Вектор pET16baphVШm1 с мутантными вариантами aphVIII146−1, ар^ У111 146−2, aphVIII146−3, aphVIII146−4 и исходным aphVIII146-S. б — Векторные конструкции, включающие рк25 и модифицированные aphVlII: aphVIII146−1, aphVIII146−2, aphVIII146−3, aphVIII146-S.
условиях проверяли экспрессию генов арЬУШ и рк25 гель-электрофорезом. В первых четырех вариантах (рис. 5) (дорожки 2−5) видны дополнительные фракции белка APHVШ, на следующей дорожке (6) — дополнительная фракция Рк25, на последних четырех дорожках (7−10) — белковые фракции с молекулярными массами 31.5 кДа, что соответствует APHVШ, и 28 кДа, что соответствует Рк25. Для уточнения результатов было проведено масс-спектрометрическое исследование дополнительных белковых фракций
31.5 кДа 28 кДа
123 456 789 10
Рис. 5. Электрофореграмма белков штамма E. coli BL21(DE3), каталитического домена Pk25, APHVIII.
1 — белковый маркер, 2 — фракция APHVIII146-S (исходный), 3 — фракция APHVIII146−1, 4 — фракция APH-VIII146−2, 5 — фракция APHVIII146−3, 6 — каталитический домен Pk25 (Pk25), 7 — фракции APHVIII146-S/ Pk25,
8 — фракции APHVIII146−1/Pk25, 9 — фракции APH-VIII146−2/Pk25, 10 — фракции APHVIII146−3/Pk25. В качестве контролей анализировали фракции белков из клеток штамма E. coli BL21(DE3), содержащих плазмиду рЕТ22Ь/рк25 и плазмиду pET16baphVIII (исходный вариант).
на дорожке 7. По результатам исследования более тяжелая фракция содержит аминокислотную последовательность APHVIII (gb|AAY27879. l| aminoglycoside-O-phosphotransferase VIII). Более легкая фракция содержит аминокислотную последовательность, соответствующую каталитическому домену Pk25 (ig|l100219 NP_628 936.1 serine/threonine protein kinase S. coelicolor A3(2)).
Анализ уровня устойчивости к канамицину вариантов E. coli BL21(DE3), содержащих различные модификации гена aphVIII и их комбинации с рк25 Все созданные конструкции исследованы по уровню устойчивости к аминогликозидному антибиотику канамицину (табл. 3). Штамм BL21(DE3), содержащий плазмиду pET16b с геном aphVIII (исходный вариант), был устойчив к канамицину (325 мкг/мл).
Замены, произведенные в варианте APHVIII146−1, приводили к снижению устойчивости на 48%. У варианта APHVIII146−2 устойчивость снижалась на 54%. Уровень устойчивости варианта APHVIII146−3 с заменой Ser-146 на Thr-146 не изменялся. В случае замены Ser-146 на Ala-146 (APHVIII146−4), т. е. полной инактивации сайта фосфорилирования Ser-146, уровень устойчивости к канамицину падал на 70%. Активность APHVIII146−4 in vitro совпадает с полученными данными, т. е. активность мутантных вариантов составляет около 30% от исходной [51]. Все конструкции APHVIII с Рк25 обладали более высоким уровнем активности. Уровень устойчивости к канамицину возрастал на 91% в случае с APHVIII146−1/Pk25, на 83% в случае с APHVIII146−2/Pk25, на 23% при замене Ser-146 на Thr-146 и в случае с исходной APHVIII -APHVIII/Pk25 (табл. 3).
Неактивный
Bis-5
Bis-5
+ Канамицин
Активный Bis-1
Канамицин
Bis-1
+ Канамицин
Сигнал б

Протеинкиназа Рк25
^ Фосфорилирование APHVIII Ser146−1, KanR (325 мкг/мл)
Устойчивость к канамицину Сигнал
I
Ингибитор ------Протеинкиназа Рк25
протеинкиназы
Нет фосфорилирования APHVIII Ser146−1, KanS (170 мкг/мл)
I
Чувствительность к канамицину
Рис. 6. Бактериальная тест-система E. coli aphVIII/Pk25 для скрининга ингибиторов серин-треониновых протеин-киназ. а — Принцип тест-системы: фосфорилирование APHVIII по Ser-146 Pk25 приводит к устойчивости E. coli к канамицину- добавление ингибитора препятствует фосфорилированию и снижает устойчивость к канамицину. б — Валидация тест-системы с использованием классических ингибиторов Bis-1 и Bis-5 [52]: добавление Bis-1 приводит к увеличению зоны.
а
Докинг ингибиторов класса индолилмалеимидов в модель структуры Рк25
На сконструированной ранее тест-системе ?. 1ю{-dans APHVШ+ был проведен скрининг соединений различных химических классов: бензодиазинов, бензофталазинов, циклопентендионов, индолилма-леимидов, пиразолов, тиазолов, тиазолтетразинов и др. (неопубликованные данные). Среди индолил-малеимидов было обнаружено значительное число соединений, проявляющих ингибиторную активность по отношению к протеинкиназам, для которых был проведен молекулярный докинг с целью установления предположительного способа связывания. Результаты докинга указывают на возможность взаимодействия между областью связывания АТФ киназы Рк25 и отобранными на сконструированной
тест-системе ?. ividans ТК24 (66) APHVШ/СТПК ингибиторами: LCTA-1385, LCTA-1398, LCTA-1425 [20], бис-индолилмалеимид-1 [52].
При докинге исследованных в данной работе ингибиторов Рк25 наблюдаются консервативные взаимодействия между малеимидным фрагментом и основной цепью шарнирной области киназы (рис. 2в). Ингибиторы бис-индолилмалеимид-1 (Bis-1) и LCTA-1425 образуют две водородные связи — между карбонильным атомом кислорода малеимидного фрагмента и амидным атомом водорода аминокислотного остатка Val96, а также между имидным атомом водорода ма-леимидного фрагмента и карбонильным кислородом основной цепи аминокислотного остатка Glu94. У ингибиторов LCTA-1385 и LCTA-1398 имеется лишь первая из названных водородных связей, поскольку
Таблица 3. Уровень устойчивости к канамицину E. coli BL21(DE3), содержащей различные варианты APHVIII
Название Модифицированные конструкты APHVIII Устойчивость к канамицину вариантов E. coli, мкг/мл
APHVIII APHVIII+Pk25
146-S AVAEG S146 VDLED 325±5 400±10
146−1 AVATG T146 VSLED 170±10 325±5
146−2 AVATG S146 VSLSD 150±10 275±10
146−3 AVAEG T146 VDLED 325±5 400±10
146−4 AVAEG А146 VDLED 100±5 —
Таблица 4. Зависимость уровня устойчивости к канамицину E. coli APHVIII146−1/Pk25 от действия ингибиторов СТПК
Название известных ингибиторов СТПК класса индолилмалеимидов Структурная формула ингибитора Субингибирующая концентрация ингибитора, нмоль/диск Зона ингибирования в тест-системе E. coli APHVIII146−1/Pk25 при совместном действии Km+ ингибитор, мм
Bis-1 zvjfy& gt- 700 13. 0
LCTA-1425 125 12. 0
LCTA-1398 250 13. 0
LCTA-1385 125 12. 0
Примечание. Зона ингибирования только канамицином (Km) (5 мг/диск) — 10 мм. Уровень устойчивости к канамицину культуры E. coli, содержащей APHVIII146−1 и Pk25, проводили методом бумажных дисков как описано в разделе «Экспериментальная часть». Характеристики индолилмалеимидов серии LCTA, полученных от проф. М. Н. Преображенской, описаны ранее [20].
атом водорода малеимидного фрагмента в них замещен. Как следствие, предсказанная энергия взаимодействия с киназой для двух последних соединений ниже энергии для двух первых на 1 ккал/моль, однако в обоих случаях взаимодействие киназы с ингибитором можно считать выгодным.
Выбор и валидация1 тест-системы E. coli APHVIII/ /Рк25
Ранее была сконструирована и валидирована [20] тест-система S. lividans TK24 (66) APHVIII/СТПК [20]. Регистрируемый эффект данной системы основан на кумулятивном действии антибиотика канами-цина и модулятора СТПК в субингибирующей2 [20] концентрации, приводящем к появлению или увеличению зоны ингибирования роста индикаторной культуры. Размер зоны отсутствия роста позволял
1 Валидация — система последовательно выполняемых проверок и испытаний по доказательству того, что любой материал, процесс, метод, процедура, деятельность, оборудование или механизм могут, будут и позволяют достигать ожидаемого результата [53, 54].
2 Величина субингибирующей концентрации вдвое меньше величины минимальной ингибирующей концентрации (МИК).
проводить предварительную оценку эффективности исследуемого ингибитора СТПК [20]. Поэтому принципиально важным при создании новой тест-системы является диапазон изменений уровня устойчивости к канамицину, определяемый различными конструкциями APHVIII. Исходя из этого, вариант APHVIII146−1 является предпочтительным. Поэтому для дальнейших исследований нами выбрана конструкция E. coli APHVIII146−1/Pk25 (рис. 6). Для валидации тест-системы E. coli APHVIII146−1/Pk25 были использованы ранее описанные ингибиторы СТПК класса индолилмалеимидов: LCTA-1385, LCTA-1398, LCTA-1425 [20] и Bis-1 [52] (табл. 4). В качестве стандартной концентрации канамици-на выбрана 5 мг/диск (образуемая зона подавления роста — 10 мм). Все исследованные вещества снижают уровень устойчивости к канамицину. Вещества из библиотеки класса индолилмалеимидов LcTA-1033, LcTA-1196, Bis-5, не проявляющие активности в тест-системе S. lividans TK24 (66) APHVIII/СТПК [20], не дали позитивного результата и в тест-системе E. coli APHVIII146−1/Pk25, что подтверждает адекватность использованной тест-системы.
Таблица 5. Лигандсвязывающие аминокислоты аденинсвязывающего кармана серин-треониновых протеинкиназ, бактериальных и Homo sapiens
Протеинкиназа Функции протеинкиназ в патогенезе и физиологии Аминокислоты аденинсвязывающего кармана Существенность замен
СТПК бактерий
Pk25 S. coelicolor Модуляция устойчивости ар^гена LVAVMLVLT Оригинал
PknA M. tuberculosis Синтез клеточной стенки IVA IMLVLT Несущественна
PknJ M. tuberculosis Персистенция в хозяине LVA IMFVLS «
Stkl Streptococcus agalactiae Регулирует клеточную сегрегацию GBS и вирулентность IVAIMYVLT «
StkP S. pneumonia Фрагмент сигнального пути, вовлеченного в инвазию легких и кровотока IVAIMYVLT «
SP-STK S. pyogenes Деление клетки, морфология колоний, участие в вирулентности IVAIMYVLT «
PpkA P. aeruginosa Регуляция экспрессии фактора вирулентности LVATMYLLS Существенна
PknB/Stkl Staphylococcus aureus subsp. aureus Регуляция пуринового биосинтеза, аутолизиса, центрального метаболизма LVAIMYILF «
PknB M. tuberculosis Деление клетки, ингибирование слияния лизосом LVAIMY VMM «
СТПК Homo sapiens
РКА H. sapiens Аллергия, болезни миокарда LVALMYVLT Несущественна
CaMK ID H. sapiens Диабет II типа LVA IMLVLS «
Pac2 H. sapiens Заболевание клеток эпидермиса по действием УФ IVA IMYLLT «
BR kinl H. sapiens Регуляция клеточного гомеостаза LVAVLHVLA Существенна
NUAK SNFl-ll H. sapiens Модуляция фактораTNF-alpha в раковых клетках LVAIMYALA «
CaMMI H. sapiens Индукция долговременной синаптической памяти LVAIMYALA «
Примечание. В таблице представлены серин-треониновые протеинкиназы, имеющие не более четырех аминокислотных замен лигандсвязывающей последовательности LVAVMLVLT Рк25. Несущественные аминокислотные замены обозначены (-), существенные замены — (=), замены в области gatekeeper обозначены (_). Селективность отбираемых ингибиторов по отношению к протеинкиназе определяется сродством лигандов ингибитора к 9 аминокислотам аденинсвязывающего кармана протеинкиназы.
ОБСУЖДЕНИЕ
Потенциальные возможности использования тест-системы E. coli APHVШ146−1/Рk25 для скрининга ингибиторов СТПК
Сконструированная тест-система может быть использована для первичного отбора (прескрининга) АТФ-конкурентных низкомолекулярных ингибиторов [2], способных диффундировать в агаризованной среде через клеточную стенку E. coli и взаимодействовать
с аденинсвязывающим карманом каталитического домена серин-треониновой протеинкиназы Рк25. Селективность отбираемых ингибиторов будет определяться сродством лигандов ингибитора к аминокислотам аде-нинсвязывающего кармана протеинкиназы. Известно, что идентичность функционально сходных аминокислотных последовательностей позволяет предполагать сходство их пространственной структуры, в том числе лигандсвязывающих карманов, отвечающих за селективность ингибиторов [31, 55].
Сравнение аминокислотных последовательностей каталитического домена Рк25 с каталитическими доменами бактериальных СТПК, в том числе патогенных микроорганизмов с помощью Genomic BLAST (http: //www. ncbi. nlm. nih. gov/sutils/genom_table. cgi), позволяет выявить 13 белков с идентичностью более 35%. Среди них присутствуют представители СТПК Mycobacterium, Staphylococcus, Streptococcus, Pseudomonas. Аналогичное сравнение с СТПК человека выявляет 19 белков с идентичностью более 30%. Среди них протеинкиназы семейств SAD, BR, NUAK (SNF), DAPK3, PNCK, CaMKII, CaMKI, Zip, PKA, HUNK, PAK2, Mark-PAR1, SIK2, OPK NimA.
Ингибиторы СТПК, конкурентно замещающие АТФ, присоединяются к аденинсвязывающему карману каталитического домена киназы. Аденин-связывающий карман состоит из константных и вариабельных аминокислот. Нами проведена классификация СТПК грамположительных бактерий [23, 56], основанная на физико-химических свойствах боковых цепей девяти вариабельных аминокислот аденинсвязывающего кармана каталитического домена. В настоящей работе мы использовали этот критерий для выбора СТПК патогенных бактерий и человека, которые могут модулироваться отобранными в предлагаемой тест-системе E. coli APHVIII/Pk25 ингибиторами. В табл. 5 представлены 9 из 13 потенциальных лигандсвязывающих последовательностей СТПК патогенных бактерий и 6 из 19 последовательностей СТПК человека. Критерием отбора служило наличие не более четырех аминокислотных замен
из девяти в положениях вариабельных аминокислот в аденинсвязывающем кармане Pk25 S. lividans (S. coelicolor) LVAVMLVLT (табл. 5). Существенными считали замены неполярных аминокислот на полярные в первых четырех и восьмом положениях (обозначено =) — все замены, кроме подобной аминокислоты на подобную — в девятом положении (обозначено =), любые замены в пятом положении (gatekeeper) -(обозначено_). Замены в положении 6 (зона шарнира) и 7 менее существенны. Несущественные замены обозначали (-). Наличие от 2 до 4 несущественных замен не изменяет характер взаимодействия ингибиторов с аденинсвязывающей последовательностью протеинкиназы. Поэтому протеинкиназа Рк25 может служить основой для отбора ингибиторов 5 из 13 СТПК патогенных бактерий и 3 из 19 СТПК человека. Критерий структурного сходства аденинсвязывающего кармана является более адекватным, чем процент гомологии белковой последовательности всей протяженности каталитического домена киназы.
Таким образом, сконструированная тест-система может быть использована для прескрининга ингибиторов СТПК ряда патогенных микроорганизмов, например PknA, PknJ M. tuberculosis, StkP S. pneumonia, SP-STK S. pyogenes, а также некоторых СТПК человека, например РКА, CaMKI, Pac2. •
Работа поддержана Российским фондом фундаментальных исследований (грант № 09−04−12 025).
СПИСОК ЛИТЕРАТУРЫ
1. Manning G., Whyte D.B., Martinez R., et al. // Science. 2002. V. 298. P. 1912−1934.
2. Cohen P. // Nat. Rev. Drug Discov. 2002. V. 1. P. 309−315.
3. Levitzki A. // Acc. Chem. Res. 2003. V. 36. P. 462−469.
4. D’Alessandris C., Lauro R., Presta I., Sesti G. // Diabetolo-gia. 2007. V. 50(4). P. 840−849.
5. Barbier E., Zapata A., Oh E., et al. // Neuropsychopharmacology. 2007. V. 32(8). P. 1774−1782.
6. Shirai H., Autieri M., Eguchi S. // Curr. Opin Nephrol. Hy-pertens. 2007. V. 16(2). P. 111−115.
7. Collins I., Workman P. // Nat. Chem. Biol. 2006. V. 2.
P. 689−700.
8. Ishida A., Kameshita I., Sueyoshi N., et al. // J. Pharmacol. Sci. 2007. V. 103(1). P. 5−11.
9. Goldstein D.M., Gray N.S., Zarrinkar P.P. // Nat. Rev. Drug Discov. 2008. V. 7. P. 391−397.
10. Bain J., Plater L., Elliott M., et al // Biochem. J. 2007. V. 408. P. 297−315.
11. Liu Y., Gray N.S. // Nat. Chem. Biol. 2006. V. 2. P. 358−364.
12. Shi L., Potts M., Kennelly P.J. // FEMS Microbiol. Rev. 1998. V. 22. P. 229−253.
13. Echenique J., Kadioglu A., Romao S., et al. // Infect. Immun. 2004. V. 72(4). P. 2434−2437.
14. Cozzone A.J. // J. Mol. Microbiol. Biotechnol. 2005. V. 9.
P. 198−213.
15. Perez J., Garcia R., Bach H., et al. // Biochem. Biophys. Res. Commun. 2006. V. 348(1). P. 6−12.
16. Drews S.J., Hung F., Av-Gay Y. // FEMS Microbiol. Lett. 2001. V. 205(2). P. 369−374.
17. Saini D.K., Tyagi J.S. // J. Biomol. Screen. 2005. V. 10(3).
P. 215−224.
18. Wehenkel A., Bellinzoni M., Grana M., et al. // Biochim. Biophys. Acta. 2008. V. 1784(1). P. 193−202.
19. Waczek F., Szabadkai I., Nemeth G., et al. // Immunol. Lett. 2008. V. 116(2). P. 225−231.
20. Danilenko V.N., Simonov A.Y., Lakatosh S.A., et al. // J. Med. Chem. 2008. V. 51. P. 7731−7736.
21. Елизаров С. М., Сергиенко О. В., Сизова И. А. и др. // Мол. биология. 2005. Т. 39. С. 1−9.
22. Беккер О. Б., Елизаров С. М., Алексеева М. Т. и др. // Микробиология. 2008. Т. 77(5). С. 630−638.
23. Danilenko V.N., Osolodkin D.I., Lakatosh S.A., et al. // Current Top. Med. Chemistry. 2010. In press.
24. Kieser T., Bibb M.J., Buttner M.J., et al. Practical Streptomyces Genetics. Norwich, John Innes Foundation. England, 2000. P. 613.
25. Sambrook J., Fritsch E.F., Maniatis T. Molecular Cloning:
A Laboratory Manual. 2nd ed. Cold Spring Harbor, N.Y.- Cold Spring Harbor Lab. Press, 1989.
26. Kameshita I., Fujisawa H. // Anal. Biochem. 1989. V. 183.
P. 139−143.
27. Nelson R.M., Long G.L. // Anal. Biochem. 1989. V. 180.
P. 147−151.
28. Berman H.M., Westbrook J., Feng Z., et al. // Nucleic Acids Research. 2000. V. 28. P. 235−242.
29. Young T.A., Delagoutte B., Endrizzi J.A., et al. // Nat. Struct. Biol. 2003. V. 10. P. 168−174.
30. Ortiz-Lombardia M., Pompeo F., Boitel B., Alzari P.M. // J. Biol. Chem. 2003. V. 278. P. 13 094−13 100.
31. Wehenkel A., Fernandez P., Bellinzoni M., et al. // FEBS Lett. 2006. V. 580. P. 3018−3022.
32. Mieczkowski C., Iavarone A.T., Alber T. // EMBO J. 2008. V. 27. P. 3186−3197.
33. Bentley S.D., Chater K.F., Cerdeno-Tarraga, et al. // Nature. 2002. V. 417. P. 141−147.
34. Larkin M.A., Blackshields G., Brown N.P. // Bioinformatics. 2007. V. 23. P. 2947−2948.
35. Sali A., Blundell T.L. // J. Mol. Biol. 1993. V. 234. P. 779 815.
36. Laskowski R.A., MacArthur M.W., Moss D.S. ,
Thornton J.M. // J. Appl. Cryst. 1993. V. 26. P. 283−291.
37. SYBYL 8. 0, Tripos International, 1699 South Hanley Rd., St. Louis, Missouri, 63 144, USA.
38. Fong D.H., Berghuis A.M. // EMBO J. 2002. V. 21. P. 23 232 331.
39. Nurizzo D., Shewry S.C., Perlin M.H., et al. // J. Mol. Biol.
2003. V. 327. P. 491−506.
40. Huey R., Morris G.M., Olson A.J., Goodsell D.S. // J. Comput. Chem. 2007. V. 28. P. 1145−1152.
41. Halgren T.A. // J. Am. Chem. Soc. 1990. V. 112. P. 4710−4723.
42. Sanner M.F. // J. Mol. Graphics Mod. 1999. V. 17. P. 57-el.
43. Umeyyama T., Horinouchi S. // Bacteriol. 2001. V. 1B3.
P. 5506−5512.
44. Petrickova K., Tichy P., Petricek M. // Biochem. Biophys. Res. Commun. 2000. V. 279(3). P. 942−948.
45. Scherr N., Muller P., Perisa D., et al. // J. Bacteriol. 2009.
V. 191(14). P. 4546−4554.
46. Villarino A., Duran R., Wehenkel A. // J. Mol. Biol. 2005.
V. 350. P. 953−963.
47. Taylor S.S., Yang J., Wu J., et al. // Biochim. Biophys. Acta. 2004. V. 1697(1−2). P. 259−269.
4B. Scheeff E.D., Bourne P.E. // PloS Comput. Biol. 2005. V. 1.
P. 0359−0381.
49. Nurizzo D., Shewry S.C., Perlin M.H., et al. // J. Mol. Biol.
2003. V. 327. P. 491−506.
50. Duran R., Villarino A., Bellinzoni M. // Biochem. Biophys. Res. Commun. 2005. V. 333(3). P. 858−867.
51. Alekseeva M., Elizarov S. // Congress EurasiaBio-2010,
13−15 apr. 2010, Moscow.
52. Brehmer D., Godl K., Zech B., et al. // Mol. Cell Proteomics.
2004. V. 3(5). P. 490−500.
53. Konings E.J.M., Roomans H.H.S. // Food Chem. 1997. V. 59.
P. 599−603.
54. Попов А. Ю. Валидация — что, где, когда? // Чистые помещения и технологические среды, 2003. № 3.
55. Scherr N., Honnappa S., Kunz G., et al. // Proc. Natl. Acad. Sci. USA. 2007. V. 104. P. 12 151−12 156.
56. Zakharevich N.V., Osolodkin D.I., Artamonova I.I., et al. // Congress EurasiaBio-2010, 13−15 apr. 2010, Moscow.

ПоказатьСвернуть
Заполнить форму текущей работой