Исследование ассоциации полиморфизма генов фолатного обмена с риском врожденных аномалий развития

Тип работы:
Реферат
Предмет:
Биология


Узнать стоимость

Детальная информация о работе

Выдержка из работы

Вайнер А.С., Кудрявцева Е. А., Жечев Д. А., Кечин А. А., Гордеева Л. А., Воронина Е. Н., Боярских У. А., Шабалдин А. В., Филипенко М. Л.
Новосибирский государственный университет, Институт химической биологии и фундаментальной медицины СО РАН,
г. Новосибирск Институт экологии человека СО РАН, НИИ комплексных проблем сердечно-сосудистых заболеваний СО РАМН,
г. Кемерово
ИССЛЕДОВАНИЕ АССОЦИАЦИИ ПОЛИМОРФИЗМА ГЕНОВ ФОЛАТНОГО ОБМЕНА С РИСКОМ ВРОЖДЕННЫХ АНОМАЛИЙ РАЗВИТИЯ
Потребление фолиевой кислоты до зачатия и в ранние сроки беременности предотвращает ряд врожденных пороков развития (ВПР). Целью настоящего исследования являлось изучение ассоциации 11 полиморфных замен в генах ферментов фолатного цикла с риском рождения потомства с ВПР в русской этнической группе. Исследование было выполнено на выборке формата случай-контроль. Была проанализирована группа из 280 женщин, имеющих ребёнка с ВПР в анамнезе, и контрольная выборка из 390 женщин, имеющих 1 и более здоровых детей. В структуре ВПР лидирующие позиции занимали пороки нервной (24,2%), мочевыделительной (19,6%) и кровеносной систем (18,2%). Проведенный анализ позволил выявить ассоциацию двух полиморфных локусов с риском развития пороков системы кровообращения. Носительство аллеля 1298С MTHFR снижало риск этой патологии в 2,23 раза (р = 0,003), для аллеля 2756A MTR снижение риска составило 1,8 (р = 0,02). В объединенной выборке ВПР была показана ассоциация генотипа 677ТТ MTHFR с 2-кратным увеличением риска врожденных аномалий (р = 0,02) и ассоциация аллеля 2756A MTR с 1,5-кратным снижением риска (р = 0,007).
КЛЮЧЕВЫЕ СЛОВА: фолатный цикл- полиморфный локус- врожденные пороки развития- ассоциация.
Weiner A.S., Kudryavtseva E.A., Zhechev D.A., Kechin A.A., Gordeeva L.A. ,
Voronina E.N., Boyarskikh U.A., Shabaldin A.V., Filipenko M.L.
Novosibirsk State University,
Institute of chemical biology and fundamental medicine, Novosibirsk,
Institute of Human Ecology SB HAS,
Scientific-research institute for complex studying of cardiovascular diseases, Kemerovo
ASSOCIATION BETWEEN POLYMORPHISMS IN FOLATE-METABOLIZING GENES
AND RISK OF CONGENITAL ANOMALIES: A CASE-CONTROL STUDY
Periconceptional use of folic acid is effective for the prevention of some types of congenital anomalies (CA). The aim of our study was to investigate the role of 11 allele variants in the folate-metabolizing genes as a possible factor in predisposition to congenital anomalies in Russian population. We genotyped 280 mothers having an offspring with CA and 390 control mothers with 1 or more healthy children. Allele 1298С MTHFR was associated with a 2,23-fold decreased risk of congenital defects of cardiovascular system (p = 0,003), for 2756A MTR a decrease in risk of this pathology was 1,8 (p = 0,02). In combined sample of CA we observed an association of genotype 677ГТ MTHFR with a 2-fold increased risk (p = 0,02) and an association of allele 2756A MTR with a 1,5-fold decreased risk of having a child with CA.
KEY WORDS: folic acid- polymorphisms- congenital anomalies- association.
Врожденные пороки развития (ВПР) являются сложной гетерогенной группой врожденных заболеваний и синдромов. Этиология большинства ВПР мультифакториальна, то есть причиной их развития является совместное действие факторов экзогенной и эндогенной природы. В 90-х годах прошлого века было доказано, что одним из таких факторов является дефицит фолиевой кислоты у матери. Потребление фолата до зачатия и в ранние сроки беременности снижает риск таких аномалий, как дефекты нервной трубки, ВПР системы кровообращения (ВПР СК, особенно пороки конот-рункуса и дефекты межжелудочковой перегородки),
Корреспонденцию адресовать:
ВАЙНЕР Александра Сергеевна,
630 090, г. Новосибирск, пр. Лаврентьева, д. 8. Тел.: 8 (383) 363-51-71.
E-mail: hamlet85@yandex. ru
ВПР мочевыделительной системы (ВПР МВС), расщелины губы и нёба. Механизм протективного действия фолата в настоящее время до конца не выяснен. Предполагается, что недостаток фолата снижает эффективность синтеза нуклеотидов, что замедляет скорость митозов и пролиферативную способность клеток в критические периоды эмбриогенеза. Другой гипотезой является аккумуляция токсичной аминокислоты гомоцистеина, повреждающей клетки развивающегося эмбриона. Третья гипотеза заключается в ингибировании реакций метилирования вследствие недостатка S-аденозилметионина, вызванного дефицитом фолата, и избытка S-аденозилгомоцистеина из-за увеличения концентрации гомоцистеина. Метилирование необходимо для правильной сегрегации хромосом и регуляции экспрессии генов, в том числе ответственных за клеточную пролиферацию, диф-ференцировку и миграцию, поэтому нарушение этого процесса может лежать в основе развития ВПР.
ИССЛЕДОВАНИЕ АССОЦИАЦИИ ПОЛИМОРФИЗМА ГЕНОВ ФОЛАТНОГО ОБМЕНА С РИСКОМ ВРОЖДЕННЫХ АНОМАЛИЙ РАЗВИТИЯ
В случае ВПР нервной системы было показано, что дополнительное потребление фолата снижает риск этой патологии даже в том случае, если у матери не было дефицита фолиевой кислоты [1]. Это указывает на то, что такие женщины имеют нарушенный транспорт или метаболизм фолатов и повышение концентрации фолиевой кислоты в организме позволяет им преодолеть эти нарушения. Дефекты фолатного обмена могут быть обусловлены генетически, в том числе как результат влияния многих низкопенетрантных мутаций или полиморфных замен. В настоящей работе была поставлена задача изучить влияние ряда полиморфных локусов генов системы метаболизма фолиевой кислоты на риск рождения потомства с ВПР у жительниц ЗападноСибирского региона России. Были выбраны следующие локусы: C677T (ге1 801 133) и A1298C (ге1 801 131) в гене MTHFR, A2756G (ге1 805 087) в гене MTR, A66G Ы801 394) в гене MTRR, C1420T (Ы979 277) в гене SHMT1, G1958A (^2 236 225) в гене MTHFD1, 84468 (ге72 058 776) в гене CBS, ге4 646 750 в гене FTHFD, rs16876512 и G742A (ге3 733 890) в гене BHMT и ге1 907 362 в гене CUBN. Выбор локусов осуществлялся в соответствии со следующими критериями: ассоциация с каким-либо типом ВПР, показанная в работах других авторов (в настоящее время данные по большинству локусов противоречивы), доказанное или предположительное влияние локуса на функциональную активность фермента, количество белкового продукта на уровень таких параметров, как концентрация гомоцистеина, или метилирование ДНК.
МАТЕРИАЛ И МЕТОДЫ
В работе была проанализирована выборка из 280 женщин, имеющих ребёнка с ВПР в анамнезе (средний возраст 25,8 ± 5,2 лет), а также контрольная группа из 390 женщин, имеющих одного и более здоровых детей (средний возраст 25,3 ± 5,5 лет). ВПР были диагностированы антенатально в ходе планового мониторинга, проводимого в Областном перинатальном центре г. Кемерово. Все женщины проживали на территории Кемеровской области и принадлежали к русской этнической группе. Распределение ВПР по типам в соответствии с между-
народной классификацией болезней, травм и состояний, влияющих на здоровье, 10-го пересмотра (МКБ-10) представлено на рисунке.
В работе использовались Tween 20, додецилсуль-фат натрия, TRIS-OH, акриламид, ^^метиленбисак-риламид, ТЕМЕД, SYbR Green I- Taq-ДНК-полиме-раза, эндонуклеаза рестрикции Bme18I, протеиназа К. Остальные реактивы были отечественного производства и имели категорию не ниже «х.ч.». Дезоксинук-леозидтрифосфаты (dNTP), TaqMan-зонды и олиго-нуклеотидные праймеры синтезированы в ИХБФМ СОРАН.
ДНК выделяли из венозной крови с использованием стандартной процедуры, включающей выделение и лизис клеток крови, гидролиз белков проте-иназой К, очистку ДНК экстракцией примесей фенол-хлороформом и осаждение ДНК этанолом. Определение генотипов полиморфных локусов G1958A гена MTHFD1 и 844ins68 гена CBS проводилось методом мультиплексного ПЦР-ПДРФ анализа. ПЦР проводили в конечном объеме 15 мкл, содержащем 65 мМ Трис-HCl (рН 8,9), 16 мМ сульфат аммония- 3,5 мМ MgCl2- 0,05%-ный Tween 20- 0,2 мМ dNTP- 0.3 мкМ растворы олигонуклеотидных праймеров (табл. 1), 20−100 нг ДНК и 1 ед. акт. Taq-ДНК-по-лимеразы на ДНК-амплификаторе с начальной денатурацией при 95 °C 3 мин., далее в течение 40 циклов с денатурацией 10 с при 95 °C, отжигом праймеров 10 с при 63 °C и элонгацией 15 с при 72 °C. Финальную элонгацию проводили при 72 °C в течение
5 мин. Амплификационные продукты обрабатывали эндонуклеазой рестрикции Bme18I, продукты гидролиза анализировали в 8%-ном ПААГ.
Определение генотипов SNP (однонуклеотидных полиморфных локусов) в генах MTHFR, MTR, MTRR, FTHFD, SHMT1 и локуса rs3733890 BHMT проводилось методом ПЦР в режиме реального времени с использованием конкурирующих TaqMan-зондов. ПЦР проводилась в конечном объеме 25 мкл, содержащем 65 мМ Трис-HCl (рН 8,9), 24 мМ сульфат аммония- 3,0 мМ MgC^- 0,01%-ный Tween 20- 0,2 мМ dNTP- 0,3 мкМ растворы олигонуклеотид-ных праймеров (табл. 1), 0,1 мкМ растворы TaqMan-зондов (табл. 1), 20−100 нг ДНК и 1 ед. акт. Taq-ДНК-полимеразы. ПЦР проводили на ДНК-ампли-
Сведения об авторах:
ВАЙНЕР Александра Сергеевна, аспирант, Новосибирский государственный университет, г. Новосибирск, Россия. E-mail: hamlet85@yandex. ru КУДРЯВЦЕВА Екатерина Алексеевна, аспирант, Новосибирский государственный университет, г. Новосибирск, Россия. E-mail: kudryavtseva_kat-hrin@ngs. ru
ЖЕЧЕВ Дмитрий Александрович, студент, Новосибирский государственный университет, г. Новосибирск, Россия. E-mail: dima_zhechev@mail. ru КЕЧИН Андрей Андреевич, студент, Новосибирский государственный университет, г. Новосибирск, Россия. E-mail: a.a. kechin@mail. ru ГОРДЕЕВА Людмила Александровна, канд. биол. наук, зав. лабораторией молекулярной иммунохимии канцерогенеза, Институт экологии человека СО РАН, г. Кемерово, Россия. E-mail: ihe@kemtel. ru
ВОРОНИНА Елена Николаевна, канд. биол. наук, мл. науч. сотрудник, Институт химической биологии и фундаментальной медицины СО РАН, г. Новосибирск, Россия. E-mail: voronina_l@mail. ru
БОЯРСКИХ Ульяна Александровна, канд. биол. наук, мл. науч. сотрудник, Институт химической биологии и фундаментальной медицины СО РАН, г. Новосибирск, Россия. E-mail: boyarskih. u@gmail. com
ШАБАЛДИН Андрей Владимирович, доктор мед. наук, ведущий науч. сотрудник, НИИ комплексных проблем сердечно-сосудистых заболеваний СО РАМН, г. Кемерово, Россия. E-mail: weit2007@yandex. ru
ФИЛИПЕНКО Максим Леонидович, канд. биол. наук, руководитель группы фармакогеномики, Институт химической биологии и фундаментальной медицины СО РАН, г. Новосибирск, Россия. E-mail: max@niboch. nsc. ru
¦ ИССЛЕДОВАНИЕ АССОЦИАЦИИ ПОЛИМОРФИЗМА ГЕНОВ ФОЛАТНОГО ОБМЕНА С РИСКОМ ВРОЖДЕННЫХ АНОМАЛИЙ РАЗВИТИЯ
Рисунок 1
Распределение ВПР по типам в % от общего количества образцов в выборке
Примечание: 1 — ВПР центральной нервной системы (ВПР ЦНС, Q00 — Q07 в соответствии с МКБ-10) — 2 — ВПР мочевыделительной системы (ВПР МВС, Q60 — Q64) — 3 — ВПР системы кровообращения (ВПР СК, Q20 — Q28) — 4 — ВПР и деформации костно-мышечной системы (ВПР КМС, Q65 — Q79) — 5 — множественные ВПР- 6 — ВПР органов пищеварения Ю38 — Q45) — 7 — ВПР органов дыхания Ю30 — Q34) — 8 — расщелины губы и неба Ю35 — Q37) — 9 — другие ВПР.
30 25
20
15
10
5
123 456 789
24,2
19,6
IO,/
9,5 " ,
0,1 7
1 1 1 1 1 i i i
фикаторах iCycler iQ5 и CFX96 с начальной денатурацией при 96 °C 2 мин., далее в течение 45 циклов: 96 °C 8 с, затем 60 °C для rs4646750 FTHFD, C677T MTHFR, и C1420T SHMT1, 58 °C для A1298C MTHFR, A2756G MTR и A66G MTRR в течение 40 с.
Для определения генотипов локусов rs1907362 CUBN и rs16876512 BHMT использовалась аллель-специфичная ПЦР в режиме реального времени. Состав ПЦР-смеси: 10 мМ Трис-HCl (рН 8,9), 55 мМ KCl- 2,5 мМ MgCl2- 0,01%-ный Tween 20- 0,2 мМ dNTP- 0,3 мкМ растворы олигонуклеотидных праймеров (табл. 1), SYBR Green I (разведение 1: 25 000), 20−100 нг ДНК и 1 ед. акт. Taq-ДНК-полимеразы. Протокол ПЦР: начальная денатурация при 96 °C 2 мин., далее в течение 48 циклов 96 °C 6 с, 65°С
6 с, 72 °C 6 с, 80 °C 10 с. Кривые плавления снимались в диапазоне температур 70−96° с шагом 0,5°С.
Статистическая обработка данных: сравнение частот встречаемости аллелей и генотипов с целью выявления ассоциации с риском ВПР проводили с использованием критерия х2, тест на соответствие рас-
пределения генотипов равновесию Харди-Вайнбер-га — с использованием точного критерия. Различия считали статистически значимыми при р & lt- 0,05. Для оценки величины относительного риска использовали отношение шансов (OR) с его доверительным интервалом (С. 1.) при уровне значимости 95%. Вычисления производили с помощью он-лайн программы DeFinetti (http: //ihg2. helmholtz-muenchen. de/cgi-
Мета-анализ: В мета-анализ включали исследования, в которых проводился анализ ассоциации ло-куса А1298С MTHFR с риском ВПР на выборке формата случай (матери детей с ВПР) — контроль. Поиск публикаций осуществлялся с помощью базы данных PubMed. Для мета-анализа использовали значения OR и 95% С. 1. (аллель С аллель А). Предположение о гетерогенности данных, включенных в мета-анализ, проверяли при помощи х2-теста (уровень значимости р = 0,1). Поскольку гетерогенность была статистически значима (р = 0,04), то для расчета обобщенного значения OR использовали модель
Information about authors:
WEINER Alexandra Sergeevna, postgraduate student, Novosibirsk State University, Novosibirsk, Russia. E-mail: hamlet85@yandex. ru KUDRYAVTSEVA Ekaterina Alekseevna, postgraduate student, Novosibirsk State University, Novosibirsk, Russia. E-mail: kudryavtseva_kathrin@ngs. ru ZHECHEV Dmitry Alexandrovich, student, Novosibirsk State University, Novosibirsk, Russia. E-mail: dima_zhechev@mail. ru KECHIN Andrey Andreevich, student, Novosibirsk State University, Novosibirsk, Russia. E-mail: a.a. kechin@mail. ru
GORDEEVA Ludmila Alexandrovna, candidate of biological sciences, Institute of Human Ecology SB RAS, Kemerovo, Russia. E-mail: ihe@kemtel. ru VORONINA Elena Nikolaevna, candidate of biological sciences, junior research scientist, Institute of chemical biology and fundamental medicine, Novosibirsk, Russia. E-mail: voronina_l@mail. ru
BOYARSKIKH Uljana Aleksandrovna, candidate of biological sciences, junior research scientist, Institute of chemical biology and fundamental medicine, Novosibirsk, Russia. E-mail: boyarskih. u@gmail. com
SHABALDIN Andrey Vladimirovich, doctor of medical sciences, leader scientist, Scientific-research institute for complex studying of cardiovascular diseases, Kemerovo, Russia. E-mail: weit2007@yandex. ru
FILIPENKO Maxim Leonidovich, candidate of biological sciences, Institute of chemical biology and fundamental medicine, Novosibirsk, Russia. E-mail: max@niboch. nsc. ru
Таблица 1
Последовательности праймеров и TaqMan зондов
Локус Праймеры TaqMan зонды
MTHFR C677T ctgaagcacttgaaggag tcacaaagcggaagaatg R6G-ctgcgggagccgatttc-BHQ FAM-ctgcgggagtcgatttcat-BHQ
MTHFR A1298C aggagctgctgaagatgtg atcactcactttgtgaccattc FAM-ccagtgaagaaagtgtctttg-BHQ R6G-ccagtgaagcaagtgtctttg-BHQ
MTR A2756G ctatcttgcattttcagtgttcc atctgtttctaccacttaccttgag R6G-ctcataatggccctgtctaa-BHQ FAM-ctcataatggtcctgtctaa-BHQ
MTRR A66G ccttatcggattcactaatacagtg tgaggaggtttctgttactatatgc R6G-cttgctcacacatttcttct-BHQ FAM-cttgctcacatatttcttct-BHQ
SHMT1 С1420Т ccaggtgggtccagagtg gagagactggcaggggataag R6G-cttcgcctctctcttccctct-BHQ FAM-cttcgcctctttcttccctct-BHQ
FTHFD rs4646750 acatgttcatagccaaggagga ctcccaaagcccacatgaag R6G-ctgtcatgatcgtctctcggt-BHQ FAM-ctgtcatgatcatctctcggtt-BHQ
BHMT rs3733890 tcacaggagcatccatcattg gcttgttgcagtcaggagtgt R6G-aggctgcccgactgaaag-BHQ FAM-aggctgcccaactgaaag-BHQ
MTHFD1 G1958A tccataccgttgaatgtgtggtc ccaacaagcttgagtgcggtc
CBS 844ins68 caggcacctgcctttacttctgag ggttgtctgctccgtctggttc
CUBN rs1907362 taactccatttgagggagaaatac taactccatttgagggagaaatat tacactgatctttcactgaattgc
BHMT rs16876512 gcaaggcatgtttgggtatag agaagtccattcgatgctcag agaagtccattcgatgctcaa
случайных эффектов. Все вычисления выполняли при помощи пакетов статистики (GenABEL- rmeta) для языка R (version 2.6. 0).
РЕЗУЛЬТАТЫ
В настоящей работе были определены генотипы 11-ти полиморфных локусов в генах ферментов фо-латного цикла в выборке женщин, имеющих ребёнка с ВПР, и в контрольной группе (табл. 2). Распределение частот генотипов для всех исследуемых SNP в контрольной группе соответствовало закону Хар-ди-Вайнберга. В выборке женщин с ВПР плода в анамнезе отклонение от закона Харди-Вайнберга было показано для локусов A66G MTRR и rs4646750 FTHFD в подгруппе ВПР ЦНС и локуса C1420T SHMT1 в подгруппе ВПР МВС (табл. 2), однако это отклонение нивелируется при введении поправки Бон-феррони на множественное сравнение, к тому же указанные подгруппы имеют небольшой размер. Поэтому такое отклонение считали приемлемым.
Частоты аллелей и генотипов в экспериментальной выборке сравнили с таковыми в группе контроля с целью выявления ассоциации исследуемых SNP с риском развития ВПР. Выявленные ассоциации приведены в таблице 3. Локус A1298C MTHFR показал ассоциацию со снижением риска ВПР СК (OR [C vs A] = 0,45 (0,26−0,78), p = 0,003). Для локу-
са А2756С в гене MTR была показана ассоциация аллеля 2756А со снижением риска ВПР в объединенной выборке врожденных аномалий ^ [А У8 О] = 0,69 (0,52−0,90), р,= 0,007) и в подгруппе ВПР СК (OR [А У8 О] = 0,56 (0,34−0,92), р = 0. 02). В объединенной выборке ВПР была также показана ассоциация генотипа 677ТТ MTHFR с увеличением риска этой патологии (OR [ТТ У8 СС] = 1,97 (1,113,49), р = 0,02).
Для локуса А1298С MTHFR был выполнен мета-анализ, в который включали результаты настоящего исследования и трех других аналогичных работ, в которых также исследовалась ассоциация этого SNP с риском ВПР СК. Суммарный объем выборок составил: 428 женщин, имеющих ребенка с ВПР СК плода в анамнезе, и 852 женщины в контрольной группе. Обобщенное значение OR [С У8 А] составило 0,92, С. 1. (0,76 — 1,13), р = 0. 43. Тест на гетерогенность выявил статистически значимую неоднородность результатов исследований (р = 0,04).
ОБСУЖДЕНИЕ
Изменение баланса в метаболизме фолиевой кислоты может влиять на уровень метилирования ДНК, концентрацию гомоцистеи-на и эффективность синтеза нуклеотидов. В ряде работ было показано, что эти метаболические параметры важны для нормального течения эмбриогенеза. Так, повышение уровня гомоцистеина в плазме или амниотической жидкости матери ассоциируется с ВПР ЦНС, ВПР СК, расщелинами губы и нёба и хромосомными болезнями плода. В работе Wang et а1. [2] на выборке ДНК, выделенной из нервной ткани абортусов, было продемонстрировано, что снижение уровня метилирования ЬШЕ-1 повторов, а также тотального метилирования генома, увеличивает риск ВПР ЦНС (OR = 5,24, С. 1. (1,52 — 18,12), р = 0,009). В экспериментах на эмбрионах птиц и животных ингибирование реакций метилирования нарушало дифференцировку и миграцию клеток [3], в том числе вызывало развитие дефектов нервной трубки [4]. Потребление метионина, необходимой для метилирования аминокислоты, напротив, снижало частоту дефектов нервной трубки у потомства мышей, генетически предрасположенных к этой патологии [5].
Одной из причин нарушения баланса в цикле фолиевой кислоты может быть полиморфизм генов фо-латного обмена. Носительство матерью аллелей, изменяющих концентрацию ключевых метаболитов (го-моцистеина, метионина, S-аденозилметионина) в её крови, может приводить к неадекватному поступлению этих соединений в ткани эмбриона и нарушать
Благодарности
Работа была поддержана Федеральной целевой программой «Научные и научно-педагогические кадры инновационной России» на 2009−2013 годы, ГК № 14. 740. 11. 0734- а также Фондом поддержки Медико-Биотехнологический исследований.
¦ ИССЛЕДОВАНИЕ АССОЦИАЦИИ ПОЛИМОРФИЗМА ГЕНОВ ФОЛАТНОГО ОБМЕНА С РИСКОМ ВРОЖДЕННЫХ АНОМАЛИЙ РАЗВИТИЯ
Таблица 2
Распределение по генотипам выборки матерей, имеющих ребёнка с ВПР, и контрольной группы.
Анализ соответствия выборок равновесию Харди-Вайнберга
Контроль ВПР* ВПР МВС ВПР ЦНС ВПР СК ВПР КМС
MTHFR C677T CCCT:^ 173: 149:26 108: 101:32 27: 13:5 22: 29:7 18: 21:6 11: 9:1
P** 0,51 0,32 0,12 0,78 1,00 1,00
MTHFR A1298C AA: AC: CC 174: 159:42 120: 95:33 20: 17:8 27: 27:4 33: 13:2 9: 11:4
P** 0,56 1,00 0,21 0,54 0,62 1,00
MTR A2756G AA: AG: GG 238: 120:13 125: 83:18 25: 17:1 35: 16:5 22: 13:6 8: 11:0
P** 0,74 0,40 0,66 0,14 0,14 0,25
MTRR A66G AA: AG: GG 71: 191:128 50: 119:94 10: 27:13 14: 22:26 9: 23:19 4: 11:9
P** 1,00 0,26 0,78 0,04 0,77 1,00
SHMT1C1420T CCCT:^ 190: 164:35 115: 135:24 23: 29:0 30: 29:9 27: 20:4 8: 15:2
P** 1,00 0,10 0,005 0,60 1,00 0,39
FTHFD rs4646750 AA: AG: GG 344: 37:1 234: 30:2 42: 6:0 60: 5:2 43: 8:0 22: 2:0
P** 1,00 0,29 1,00 0,02 1,00 1,00
CUBN rs1907362 GG: GA: AA 329: 30:0 230: 16:0 46: 2:0 59: 4:0 41: 5:0 21: 2:0
P** 1,00 1,00 1,00 1,00 1,00 1,00
MTHFD1G1958A GG: GA: AA 101: 151:86 74: 135:55 13: 28:9 13: 37:15 9: 27:10 10: 10:6
P** 0,06 0,71 0,57 0,33 0,37 0,42
CBS 844ins68 DD: DI: II 274: 40:4 224: 36:1 44: 6:0 55: 8:0 41: 8:0 21: 3:0
P** 0,09 1,00 1,00 1,00 1,00 1,00
BHMT rs16876512 GG: GA: AA 304: 68:3 230: 39:2 46: 6:1 58: 7:0 40: 10:0 22: 5:0
P** 1,00 0,68 0,25 1,00 1,00 1,00
BHMT rs3733 8 9 0 GG: GA: AA 193: 160:26 150: 98:16 29: 20:2 41: 21:3 31: 15:4 12: 12:0
P** 0,44 1,00 0,71 1,00 0,25 0,27
Примечание: * объединенная выборка матерей, имеющих ребёнка с ВПР- **ответствие закону Харди-Вайнберга.
Таблица 3
Ассоциации полиморфных локусов генов фолатного цикла с риском рождения ребёнка с аномалиями развития в Западно-Сибирском регионе России
Локус Тип ВПР* Частота аллеля в выборке ВПР*/группе контроля OR, C.I., p
Аллель С (ВПР) — 18% Аллель С (контроль) — 32% OR (CC vs AA) = 0,25 (0,06−1,09), p = 0,05
MTHFR A1298C ВПР СК OR (AC vs AA) = 0,43 (0,22−0,85), p = 0,01 OR (C vs A) = 0,45 (0,26−0,78), p = 0,003
Аллель в (ВПР) — 30% Аллель в (контроль) — 20% OR (AA vs GG) = 0,20 (0,07−0,58), p = 0,001
MTR A2756G ВПР СК OR (AG vs GG) = 0,24 (0,08−0,72), p = 0,007 OR (A vs G) = 0,56 (0,34−0,92), p = 0,02
Аллель в (ВПР) — 26% Аллель в (контроль) — 20% OR (AA vs GG) = 0,38 (0,18−0,80), p = 0,009
ВПР (объединенная выборка) OR (AG vs GG) = 0,50 (0,23−1,08), p = 0,07 OR (A vs G) = 0,69 (0,52−0,90), p = 0,007
Аллель Т (ВПР) — 34% Аллель Т (контроль) — 29% OR (TT vs CC) =1,97 (1,11−3,49), p = 0,02
MTHFR C677T ВПР (объединенная выборка) OR (CT vs CC) = 1,09 (0,77−1,54), p = 0,64 OR (T vs C) = 1,28 (1,00−1,65), p = 0,05
Примечание: * подгруппа ВПР, для которой была выявлена ассоциация.
его развитие. В настоящей работе мы анализировали влияние ряда полиморфных замен в генах фо-латного цикла на риск возникновения ВПР различных подтипов.
Наиболее изученной нуклеотидной заменой в генах метаболизма фолата является замена С677Т в гене MTHFR, кодирующем фермент метилентетрагид-рофолатредуктазу. Данная замена приводит к замене А222У в каталитическом домене фермента, снижает его активность и ассоциируется с гипометилированием ДНК и аккумуляцией гомоцистеина [6]. В многочисленных работах изучалось влияние этого SNP
на риск развития двух видов ВПР — ВПР ЦНС и ВПР СК, результаты этих работ были включены в мета-анализы. В мета-анализе авторов Amorim et al. [7] была выявлена ассоциация носительства эмбрионом генотипа 677ТТ с риском развития спинномозговой грыжи (OR = 1,62, C.I. [1,38 — 1,90]), аналогичный результат был показан в работе Botto et al [8] (OR = 1,8, C.I. [1,4 — 2,2]). В последней работе также анализировалось влияние генотипа матери, генотип 677ТТ тоже показал ассоциацию с увеличением риска (OR = 2, C.I. [1,5 — 2,8]). В мета-анализах, объединяющих результаты исследования влияния этого локуса на
14
№ 3(46) 2011 с/^иь и^пя вс7|узбассе
риск ВПР СК, значимой ассоциации показано не было ни для материнского генотипа, ни для генотипа эмбриона [9], несмотря на то, что в отдельных работах ассоциация всё же выявлялась.
В настоящей работе локус С677Т MTHFR показал ассоциацию с риском ВПР в объединенной выборке врожденных пороков (табл. 3). Однако при делении выборки на подгруппы (ВПР МВС, ВПР ЦНС, ВПР СК и ВПР КМС) ни в одной из этих подгрупп ассоциации выявлено не было. Остальные подгруппы ВПР имели слишком маленький размер, чтобы их можно было анализировать по отдельности, поэтому полученный нами результат можно трактовать только как влияние аллеля C677T MTHFR на риск ВПР в целом. Объяснить тот факт, что нам не удалось подтвердить ассоциацию этого SNP с ВПР ЦНС в русской этнической группе, можно следующим образом. Во-первых, в вышеуказанных мета-анализах исследовались выборки, однородные по типу патологии. В нашей же работе подгруппа ВПР ЦНС состояла не только из матерей, имеющих плод со спинномозговой грыжей, но также и с анэнцефалией, омфалоцеле и другими видами аномалий ЦНС. Возможно, эти виды имеют этиологические отличия. Во-вторых, в настоящем исследовании, при размере подгруппы ВПР ЦНС в 58 образцов, с вероятностью 80% мы могли детектировать ассоциацию только с OR не ниже 2, то есть более слабая ассоциация могла остаться невыявленной. В-третьих, на эффект этого SNP могут оказывать модулирующее влияние факторы окружающей среды, такие как уровень потребления фолата, витаминов группы В, метионина, и, поскольку влияние этих факторов не учитывалось, это могло маскировать имеющуюся на самом деле ассоциацию.
Другой полиморфный локус в гене MTHFR — локус A1298C — показал в нашей работе значимую ассоциацию со снижением риска ВПР СК. Данная нуклеотидная замена приводит к замене E429A в регуляторном домене фермента и снижению его активности — более слабому, чем в случае замены C677T. В некоторых работах была показана ассоциация этого SNP с гипометилированием ДНК и увеличением концентрации гомоцистеина [6, 10], что могло бы объяснить ассоциацию аллеля 1298C с повышенным риском ВПР, то есть результат, противоположный нашему. С другой стороны, снижение активности MTHFR могло бы приводить к накоплению 5,10-метилентетра-гидрофолата и, таким образом, направлять одноуглеродные фрагменты в реакции синтеза нуклеотидов, обеспечивая потребность быстро делящихся клеток эмбриона в субстрате для синтеза ДНК. В таком случае эмбрион, имеющий генотип 1298AC или 1298CC, имел бы преимущество по сравнению с носителями генотипа 1298AA. В исследованиях Hobbs et al. [11] и Goldmuntz et al. [12], в которых использовался другой подход к поиску ассоциаций, анализ триад мать-отец-ребёнок, такой эффект генотипа эмбриона на риск ВПР СК и был показан. В первой работе было выявлено, что аллель 1298A значимо чаще передаётся потомству с пороком, чем это могло ожи-
даться исходя из закона Менделя, и носительство хотя бы одного аллеля 1298С у ребёнка вызывало снижение риска развития этого типа ВПР. В исследовании Goldmuntz et al. также была показана ассоциация локуса A1298C MTHFR у ребёнка со сниженным риском ВПР СК. Возможно, полученная нами ассоциация объясняется тем, что в потомстве от выборки матерей, в которой частота генотипов 1298AA298AC выше популяционной, частота этих генотипов также может оказаться выше, и у таких эмбрионов будут чаще развиваться ВПР СК.
В трёх работах, аналогичных по формату настоящему исследованию (случай-контоль, изучение влияния материнского эффекта), выполненных на популяциях разного этнического происхождения, ассоциации этого локуса с риском ВПР СК обнаружено не было [13]. Мы объединили результаты нашего исследования с результатами вышеприведенных трех работ и выполнили мета-анализ (рис.). Обобщенное значение OR (алелль 1298C vs. алелль 1298A) составило 0,92, C.I. (0,76 — 1,13), p = 0,43. Таким образом, ассоциация была статистически незначима. Однако, была выявлена значимая гетерогенность результатов, включенных в анализ работ (р = 0,04). Это говорит о том, что эффект аллеля варирьирует от популяции к популяции, и полученную нами ассоциацию нельзя экстраполировать на другие этнические группы.
Ещё одной ассоциацией, обнаруженной в нашем исследовании, была ассоциация аллеля 2756A MTR со снижением риска врожденных аномалий в объединенной выборке ВПР и в подгруппе ВПР СК (табл. 3). Замена A2756G в гене MTR ведёт к аминокислотной замене D919G вблизи кобаламин-связывающего домена фермента метионин-синтазы, утилизирующей гомоцистеин в реакции синтеза метионина. Функциональная роль данной замены остаётся невыясненной. Van der Put et al. [14] предположил, что она может нарушать пространственную структуру фермента и его функцию. Однако в работах, исследующих влияние этого SNP на уровень гомоцистеина, были получены следующие результаты: в 9 исследованиях концентрация гомоцистеина не зависела от генотипа по данному локусу [13, 15], а в 5 работах мутантный аллель 2756G снижал уровень этого соединения [16], что говорит о том, что, возможно, замена является активирующей. В таком случае полученный нами результат вызывает сомнение. В работах других авторов, посвященных поиску ассоциации этого локуса с разными видами ВПР, в основном никакого влияния этого SNP на риск ВПР обнаружено не было. Имеются, однако, три работы, в которых ассоциация была продемонстрирована, и во всех трёх случаях, как и в нашей работе, аллель 2756G повышал риск ВПР — ВПР ЦНС (спинномозговой грыжи) [17], расщелины губы и нёба [18] и ВПР СК (ассоциация на грани статистической значимости) [12]. Стоит отметить, что в соответствии с данными, полученными в результате проекта HapMap (www. hap-map. org), ген MTR расположен в протяженном блоке неравновесия по сцеплению, так что, вероятно,
¦ ИССЛЕДОВАНИЕ АССОЦИАЦИИ ПОЛИМОРФИЗМА ГЕНОВ ФОЛАТНОГО ОБМЕНА С РИСКОМ ВРОЖДЕННЫХ АНОМАЛИЙ РАЗВИТИЯ
замена А2756С на самом деле сцеплена с каким-то другим функциональным SNP, ассоциированным со снижением риска ВПР.
Остальные проанализированные локусы не показали ассоциации с ВПР и их подтипами. Необходимо уточнить, что в случае ге4 646 750 FTHFD и ВПР ЦНС, а также С1420Т SHMT1 и ВПР МВС, значимые различия в частотах встречаемости генотипов между экспериментальной и контрольной выборками всё же были выявлены. Но это, скорее всего, является следствием отклонения распределения частот генотипов от закона Харди-Вайнберга в подгруппах ВПР, поскольку рассчитанные значения доверительного интервала для полученных OR были очень велики, а значения р — близки к номинальному, напри-
мер, для SHMT1 OR (СС У8 ГГ) = 8,76, С. 1. (0,52 -147,52), р = 0,04.
ЗАКЛЮЧЕНИЕ
В данном исследовании анализировались ассоциации 11 локусов в генах ферментов фолатного цикла с риском развития ВПР плода. Выявлена ассоциация ло-куса А1298С MTHFR со снижением риска ВПР СК, локусов А2756С MTR и С677T MTHFR — с увеличением риска ВПР в объединенной выборке врожденных аномалий, а также локуса А2756С MTR с повышенным риском ВПР СК. Обнаруженные ассоциации требуют дальнейшего подтверждения на выборках большего размера и разной этнической принадлежности.
ЛИТЕРАТУРА:
1. Is disordered folate metabolism the basis for the genetic predisposition to neural tube defects? /Yates J.R., Ferguson-Smith M.A., Shenkin A. et al. //Clin. Genet. — 1987. — V. 31, N 5. — P. 279−287.
2. Relation between hypomethylation of long interspersed nucleotide elements and risk of neural tube defects /Wang L., Wang F., Guan J. et al. //Am. J. Clin. Nutr. — V. 91, N 5. — P. 1359−1367.
3. Effects of a DNA demethylating agent — 5-azacytidine — on testicular morphology during mouse embryo development /Bulut H.E., Ozdemir O., Basimoglu-Koca Y. et al. //Okajimas Folia Anat. Jpn. — 1999. — V. 76, N 1. — P. 47−53.
4. W. Inhibition of transmethylation disturbs neurulation in chick embryos /Afman L.A., Blom H.J., Drittij M.J. et al. //Brain. Res. Dev. Brain.
Res. — 2005. — V. 158, N 1−2. — P. 59−65.
5. Essien, F.B. Methionine but not folinic acid or vitamin B-12 alters the frequency of neural tube defects in Axd mutant mice /Essien F.B., Wan-
nberg S.L. //J. Nutr. — 1993. — V. 123, N 1. — P. 27−34.
6. 5,10-methylenetetrahydrofolate reductase (MTHFR) 677C-& gt-T and 1298A-& gt-C mutations are associated with DNA hypomethylation /Castro R., Rivera I., Ravasco P. et al. //J. Med. Genet. — 2004. — V. 41, N 6. — P. 454−458.
7. Non-Latin European descent could be a requirement for association of NTDs and MTHFR variant 677C & gt- T: a meta-analysis /Amorim M.R. ,
Lima M.A., Castilla E.E., Orioli I.M. //Am. J. Med. Genet. A. — 2007. — V. 143A, N 15. — P. 1726−1732.
8. Botto, L.D. 5,10-Methylenetetrahydrofolate reductase gene variants and congenital anomalies: a HuGE review /Botto L.D., Yang Q. //Am. J. Epidemiol. — 2000. — V. 151, N 9. — P. 862−877.
9. Hyperhomocysteinemia and MTHFR polymorphisms in association with orofacial clefts and congenital heart defects: a meta-analysis /Ver-
kleij-Hagoort A., Bliek J., Sayed-Tabatabaei F. et al. //Am. J. Med. Genet. A. — 2007. — V. 143A, N 9. — P. 952−960.
10. Homocysteine levels are associated with MTHFR A1298C polymorphism in Indian population /Kumar J., Das S.K., Sharma P. et al. //J. Hum.
Genet. — 2005. — V. 50, N 12. — P. 655−663.
11. Congenital heart defects and genetic variants in the methylenetetrahydroflate reductase gene /Hobbs C.A., James S.J., Parsian A. et al. //J. Med. Genet. — 2006. — V. 43, N 2. — P. 162−166.
12. of folate metabolism genes and the risk of conotruncal cardiac defects /Goldmuntz E., Woyciechowski S., Renstrom D. et al. //Circ. Cardi-ovasc. Genet. — 2008. — V. 1, N 2. — P. 126−132.
13. Homocysteine concentrations and molecular analysis in patients with congenital heart defects /Galdieri L.C., Arrieta S.R., Silva C.M. et al. //Arch. Med. Res. — 2007. — V. 38, N 2. — P. 212−218.
14. Sequence analysis of the coding region of human methionine synthase: relevance to hyperhomocysteinaemia in neural-tube defects and vascular disease /Van Der Put N.M., Van Der Molen E.F., Kluijtmans L.A. et al. //Qjm. — 1997. — V. 90, N 8. — P. 511−517.
15. The heritability of plasma homocysteine, and the influence of genetic variation in the homocysteine methylation pathway /Siva A., De Lan-
ge M., Clayton D. et al. //Qjm. — 2007. — V. 100, N 8. — P. 495−499.
16. Methionine synthase D919G polymorphism is a significant but modest determinant of circulating homocysteine concentrations /Harmon D.L., Shields D.C., Woodside J.V. et al. //Genet. Epidemiol. — 1999. — V. 17, N 4. — P. 298−309.
17. Transcobalamin and methionine synthase reductase mutated polymorphisms aggravate the risk of neural tube defects in humans /Gueant-Rodriguez R.M., Rendeli C., Namour B. et al. //Neurosci. Lett. — 2003. — V. 344, N 3. — P. 189−192.
18. Mostowska, A. Maternal MTR genotype contributes to the risk of non-syndromic cleft lip and palate in the Polish population /Mostowska A. ,
Hozyasz K.K., Jagodzinski P.P. //Clin. Genet. — 2006. — V. 69, N 6. — P. 512−517.

ПоказатьСвернуть
Заполнить форму текущей работой