Изменчивость микросателлитной ДНК налима (lota lota) Обь-Иртышского бассейна: тестирование праймеров и оптимизация методики

Тип работы:
Реферат
Предмет:
Биология


Узнать стоимость

Детальная информация о работе

Выдержка из работы

УДК 597. 555. 5:577. 21. 088.7 ББК 28. 693. 32
С. Б. Ракитин, А. Р. Копориков, В. Д. Богданов, Ю. Я. Хрунык,
Л. Э. Ялковская, В. Л. Семериков, А. В. Бородин
ИЗМЕНЧИВОСТЬ МИКРОСАТЕЛЛИТНОЙ ДНК НАЛИМА (LOTA LOTA) ОБЬ-ИРТЫШСКОГО БАССЕЙНА: ТЕСТИРОВАНИЕ ПРАЙМЕРОВ И ОПТИМИЗАЦИЯ МЕТОДИКИ
S. B. Rakitin, A. R. Koporikov, V. D. Bogdanov, Yu. Ya. Khrunyk,
L. E. Yalkovskaya, V. L. Semerikov, A. V. Borodin
VARIATION OF MICROSATELLITE DNA OF BURBOT (LOTA LOTA) OF THE OB-IRTYSH BASIN: TESTING OF PRIMERS AND OPTIMIZATION OF THE METHOD
Объект исследований — налим (Lota lota) из двух районов Обь-Иртышского бассейна. Проведено тестирование микросателлитных праймеров, разработанных ранее для европейских и китайских популяций. Два из шести изученных микросателлитных локусов могут рассматриваться как маркеры и представляются перспективными для дальнейших исследований генетической структуры налима на протяжении всего ареала. Их использование на больших по количеству выборках из разных локалитетов и подбор новых дополнительных микросателлитных локусов будут достаточно эффективными для проведения популяционно-генетического анализа налима Обь-Иртышского бассейна.
Ключевые слова: налим, Lota lota, микросателлитная ДНК, оптимизация ПЦР, Обь-Иртышский бассейн.
The object of the researches is burbot (Lota lota) from two regions of the Ob-Irtysh basin. The microsatellite primers, designed for European and Chinese populations were tested. Two of six examined microsatellite loci can be considered as markers and can be perspective for the further analysis of burbot genetic structure within the whole species range. Their use in large in size assorted groups from different loci and selection of additional microsatellite loci will be rather effective for realization of the population genetic analysis of burbot from the Ob-Irtysh basin.
Key words: burbot, Lota lota, microsatellite DNA, optimization of PCR, Ob-Irtysh basin.
Введение
Проблема внутривидовой дифференциации в современных биологических исследованиях во многом остается открытой [1, 2]. Использование классического морфологического метода [3−5] не всегда позволяет определить систематическое положение исследуемой группы организмов [6]. Применение дополнительных методов, в частности молекулярно-генетических, повышает уровень значимости полученных данных. В этой связи, при изучении внутривидовой дифференциации налима (Lota lota L.) Обь-Иртышского бассейна, было решено наряду с морфологическими, физиологическими, экологическими, этологическими и географическими методами применить и один из молекулярно-генетических.
Систематическое положение и внутривидовая дифференциация налима в современной отечественной и зарубежной литературе несколько различаются [7−9], что является следствием использования разных методов. По свидетельству многих авторов [10−14], группировки налима в описываемых ими водоемах более или менее однородны, т. е. статистически значимо не различаются по морфологии, поведению, экологии, популяционной структуре и т. д. Исключением могут являться крупные речные системы. К таким речным системам однозначно можно отнести Обь-Иртышский бассейн, в котором обитает крупнейшая в мире группировка налима [15]. Условия обитания налима в разных частях бассейна очень сильно различаются (верховые проточные озера, русловые участки, широтные отличия и т. д.), дополнительное влияние оказывают огромные расстояния, препятствующие свободному обмену генами, и Новосибирская плотина, построенная в 50-е гг. ХХ в. Все это должно привести к генетической неоднородности население налима Обь-Иртышского бассейна. На базе Института экологии растений и животных
Уральского отделения РАН было начато изучение генетического разнообразия L. lota с использованием микросателлитных маркеров. Так как методика исследования изменчивости микроса-теллитной ДНК налима в России пока не отработана, то во многом работа является пионерной для данного вида на территории России. Результаты настоящей работы — первый шаг в определении внутривидовой структуры налима в Обь-Иртышском бассейне и в других речных и озерных системах России.
Задача исследования — тестирование микросателлитных праймеров, разработанных для популяций налима из Европы и Китая- оценка их пригодности для изучения генетической структуры населения налима российской части Обь-Иртышского бассейна, а также оптимизация методики микросателлитного анализа.
Постановка задачи
Налим — циркумполярный вид, широко распространен в Северном полушарии, однако работы по изучению его популяционно-генетической структуры редки и касаются в основном группировок налима на территории Европы и Китая [16−19]. Полная картина генетической структуры на протяжении всего ареала отсутствует.
До недавнего времени основным инструментом для получения информации о генетической структуре популяций различных видов рыб было использование изоферментных генетических маркеров [20]. В последнее время среди молекулярно-генетических методов, используемых в популяционно-экологических исследованиях, особое внимание уделяется анализу микро-сателлитной ДНК [21]. Выявляемый с их помощью уровень ДНК полиморфизма на порядок выше аллозимной изменчивости [22]. Микросателлитные локусы ядерной ДНК (микросателлиты — от англ. microsatellites, или STR-локусы — Short Tandem Repeats, или SSR-локусы — Simple Sequence Repeats) представляют собой фрагменты ДНК с большим количеством тандемно повторяющихся идентичных «мотивов» или «повторов»: коротких последовательностей из нескольких (от одной до шести) пар нуклеотидов. Микросателлиты встречаются в большом количестве в геномах всех эукариот и локализованы как в некодирующих, так и в кодирующих (значительно реже) участках генома [23]. В классе рыб микросателлитный локус встречается приблизительно на каждые 10 000 пар нуклеотидов (пн), тогда как минисателлитный локус — на каждые 1 500 000 пн [24]. STR-локусы высокополиморфны, что делает их эффективными маркерами при детальных популяционно-экологических исследованиях [25]. По всей видимости, такая высокая вариабельность микросателлитов объясняется более высокими темпами их мутирования по сравнению с мутабильностью остальной геномной ДНК, составляющей около 10−2-10−6 на локус за поколение против 10−5-10−6 у структурных генов [21, 26−27]. Считается, что микросателлитные локусы селективно нейтральны, однако имеются данные об эффектах микросателлитной ДНК по отношению к некоторым фенотипическим характеристикам, включая организацию и функционирование генома эукариот [23, 25]. Высокий уровень полиморфизма, кодоминантный тип наследования и связанная с этим возможность легкой идентификации гомо- и гетерозигот делают микросателлиты удобным генетическим маркером для изучения генетических и демографических процессов в популяциях живых организмов. Изучение популяционно-генетической структуры представляет большой научный, а для видов растений и животных, имеющих большое хозяйственное значение, — и практический интерес. Особенно актуально знание популяционно-генетической структуры видов рыб, которые становятся объектом все более интенсивного хозяйственного использования человеком.
Материал и методика исследований
Сбор материала проводили зимой 2012−2013 гг. Для тестирования микросателлитных ло-кусов использовали ткани рыб, взятых из двух мест (по 4 особи из каждого) Обь-Иртышского бассейна (рис. 1). Первый район сбора материала — р. Собь, левобережный нерестовый приток Нижней Оби. Выборка взята от производителей, пришедших на нерест. Вторая выборка собрана в нижнем течении р. Иртыш в Уватском районе Тюменской области.
Для анализа ДНК были зафиксированы пробы белых мышц в 96%-м этаноле. Тотальную ДНК выделяли из мышечной ткани методом солевой экстракции [28] с некоторыми модификациями. К измельченной и высушенной от этанола мышечной ткани добавляли 270 мкл буфера
(25 мМ ЭДТА, 75 мМ №С1, 10 мМ Tris (pH 7,5)), 30 мкл 10%-го раствора SDS и 15 мкл протеи-назы К (20 мкг/мкл), инкубировали при температуре 37 °C в течение 12−16 часов. К полученному в результате лизиса продукту добавляли 200 мкл 6М-го раствора №С1, центрифугировали 15 минут на максимальной скорости, супернатант переносили в новые пробирки и повторяли последний шаг. На следующем этапе к супернатанту добавляли 3 объема 96%-го этанола (1 500 мкл) и инкубировали в течение 2 часов при температуре -20 °С, затем центрифугировали на максимальной скорости 20 минут при температуре +4 °С. Полученный осадок, содержащий тотальную ДНК, два раза (1 000 мкл и 500 мкл соответственно) промывали в 70%-м этаноле, высушивали при комнатной температуре и растворяли в 100 мкл воды.
Рис. 1. Места отбора проб: 1 — левобережный уральский приток Нижней Оби р. Собь-
2 — участок р. Иртыш (Уватский район Тюменской области)
Оценку качества полученных препаратов тотальной ДНК проводили электрофоретическим методом, используя 1%-й агарозный гель, содержащий бромистый этидий и ДНК фага X, гидролизованной эндонуклеазой BgII, в качестве маркера длин фрагментов. Концентрацию ДНК определяли на спектрофотометре для её последующего выравнивания для проведения полимеразной цепной реакции (ПЦР). Нами было подобрано и протестировано 6 пар праймеров, разработанных для европейских (Llol, Llo 11, Llo12, Llo32, Llo34) и китайских (EF139390) популяций налима, характеристика которых представлена в табл. 1.
Критериями отбора было наличие полиморфизма по выбранным локусам, а также размер продуктов амплификации, подходящий для дальнейшего создания панели микросателлитных локусов для автоматического анализа на генетическом анализаторе ABI Prizm 3130. Выбранные праймеры были синтезированы ЗАО «Синтол» (г. Москва). Полимеразную цепную реакцию проводили в термоциклире MyCycler «Bio-Rad», с использованием следующих реактивов: смеси дезоксирибонуклеотидов и Taq-полимеразы — производитель «СибЭнзим» (г. Новосибирск), MgCl2 и ПЦР-буфера (100 мМ Tris-HCl (pH 8,8) — 500 мМ KCl- 0,8% Nonidet P40) — производитель «Fermentas» (г. Вильнюс). На первом этапе работы использовали состав и режим ПЦР, рекомендуемый авторами, разработавшими праймеры [19, 29]. В дальнейшем для повышения эффективности ПЦР опытным путем подбирали оптимальные условия: температуру отжига праймеров и концентрацию ионов Mg2+
Таблица 1
Характеристика исследованных микросателлитных локусов
Локус Последовательности праймеров (5−3-) Повторяющаяся последова- тельность Диапазон аллельных размеров, пн Температура отжига, °С Число аллелей / ожидаемая гетерозиготность Источник информации
Llo1 F: CCTAACTCGCTGTGTCACTTTC R: GCACTGTTTAATGCCACTGC ^)25 170−200 12/0,84
Llo11 F: TGCTGGCTACAGTGGAGGAG R: CGAGCGTTAAAGAGCTGAAG (AC)17 136−142 5/0,56
Llo12 F: CAAACTGCTCTGCTGTCTGC R: TCTGTCGAGACTTGGGAAGG (CA)22 150−168 55 7/0,65 [29]
Llo32 F: CACTCCCGAAAAATAAACAC R: GTTTTCACCCTTCTTACGTG (GA)26 207−243 13/0,85
Llo34 F: AAGAAGATTGCACAGAGAGC R: TGACAGTGTTTCCAGACAAG ^)30 T (GA)37 260−294 17/0,88
EF 139 390 F: AACAACACCACCCTGACCT R: ATCATGGTGGGACTCCAGAC (CA)32 103−225 59 14/0,93 [19]
Электрофорез амплифицированных фрагментов ДНК проводили в 2%-м агарозном геле в ТАЕ-буфере с бромистым этидием (5 мкг/мл) и фотографировали в проходящем ультрафиолетовом излучении. Приблизительный размер каждого фрагмента определяли путем сравнения со стандартом молекулярной массы — маркером 100 Ьр + 50 Ьр («СибЭнзим» (г. Новосибирск)). Для более точного определения размеров фрагментов использовали электрофорез в полиакриламидном денатурирующем геле.
Результаты исследований и их обсуждение
При использовании состава и режима ПЦР, рекомендуемых авторами, разработавшими праймеры [19, 29] (табл. 2), не все исследуемые локусы поддерживали реакцию амплификации. Так, праймеры Llo32, Llo34 и EF139390 не дали в результате ПЦР ампликонов, а для праймеров Llo1, Llo11 и Llo12 наблюдалось наличие продуктов неспецифических реакций амплификации.
Эффективность ПЦР зависит от многих параметров, таких как температура отжига праймеров, их концентрация, концентрация ионов Mg2+, а также от количества циклов амплификации, концентрации ДНК-матрицы и др. Дальнейшие исследования были направлены на поиск оптимальных условий амплификации и улучшения состава смеси для ПЦР.
Была проведена модификация состава ПЦР-реакции. Амплификацию проводили в 10 мкл реакционной смеси следующего состава: 2 мкл ДНК (40−100 нг), 1 мкл каждого праймера (2 мкМ), 0,2 мкл смеси дезоксирибонуклеотидов (10 мМ каждого), 0,6 мкл MgQ2 (25 мМ), 1 мкл 10Х ПЦР-буфера, 0,1 мкл Taq-полимеразы (5 ед/мкл) и 4,1 мкл воды. Полимеразную цепную реакцию проводили по следующей схеме: начальная денатурация — 2 минуты при температуре 94 °C, затем 35 циклов (94 °С — 10 с, отжиг праймеров — 10 с, 72 °C — 30 с) и конечная элонгация 3 минуты при температуре 72 °C.
Следует отметить, что среди условий ПЦР большое значение имеет температура отжига праймеров. Согласно рекомендациям разработчиков используемых праймеров, оптимальная температура отжига составляет 55 и 59 °C (табл. 2). Однако при использовании рекомендуемых температур ПЦР-продукты ожидаемых размеров были получены только для трех из шести исследуемых локусов, а именно Llo1, Llo11 и Llo12. В этой связи, для улучшения результатов ПЦР, эмпирическим путем были подобраны значения температуры отжига с использованием температурного градиента от 50 до 65 °C. Применение технологии температурного градиента позволяет одновременно проводить инкубацию при восьми различных значениях температуры, что оптимизирует проведение реакций за одну процедуру.
Таблица 2
Состав реакционной смеси и условия для проведения ПЦР с микросателлитными праймерами, разработанными для налима из европейских и китайских популяций
Состав реакционной смеси
Компонент Локус
Llol, Llo11, Llo12, Llo32, Llo34 EF139390
Вода До 10 мкл До 25 мкл
Смесь дезокси-рибонуклеотидов 200 mkM each dNTP — 0,8 мкл 2 mM each dNTP
ПЦР-буфер 10xBuffer (100mM Tris-HCl, 500 mM KCl, 15 mM MgCl2) — 1 мкл 1xBuffer (Shanghai Sangon Company, China)
Mga2 — 1,5 мМ
Праймер Б 0,2 mkM — 1 мкл 0,1 mkM
Праймер R 0,2 mkM — 1 мкл 0,1 mkM
ДНК- полимераза 0,2 U Sigma RedTaq 1 U Taq
ДНК Около 5 нг Около 100 нг
Условия ПЦР
Процесс Llo1, Llo11, Llo12, Llo32, Llo34 EF139390
Температура Время Температура Время
Начальная денатурация 94 °C 2 мин 94 °C 3 мин
Денатурация 94 °C 10 с 35 циклов 94 °C 30 с 30 циклов
Отжиг праймера 55 °C 10 с 59 °C 30 с
Достройка цепи 72 °C 30 с 72 °C 30 с
Конечная элонгация 72 °C 60 мин 72 °C 7 мин
Результаты ПЦР с применением температурного градиента представлены на рис. 2, на котором видно, что оптимальной температурой отжига для праймеров Llo1, Llo 11 и Llo 12 является температура 62 °C. Праймеры Llo 32, Llo 34 и EF139390 не дали ожидаемого результата, несмотря на варьирование температуры отжига, при этом для праймеров Llo 32 и Llo 34 наблюдалось наибольшее количество ожидаемого ПЦР-продукта при температуре отжига 51 °C, а для праймера EF139390 — при температуре 62 °C.
Рис. 2. Результаты ПЦР с применением температурного градиента: А — Llo1- Б — LloП- В — Llo12 (дорожки 17−24) и Llo32 (дорожки 25−32) — Г — Llo34 (дорожки 33−40) и EF139390 (дорожки 41−48). Значения температуры отжига праймеров при амплификации ДНК налима по каждому исследуемому локусу варьировали в диапазоне от 65 до 50 °C (курсив под каждой дорожкой).
Для электрофоретического анализа ПЦР-продуктов использовали ДНК-маркер100 Ьр.
Концентрация ионов Mg2+ - 1,5 мМ
В дальнейшем был проведен электорофорез в 6%-м полиакриламидном денатурирующем геле с серебряным окрашиванием, при этом в анализе использовали только те фрагменты, которые наиболее легко визуализировались на агарозном геле (Ыо1, Ыо11, Ь1о12). Как видно на рис. 3, у всех восьми тестируемых особей налима присутствует ПЦР-продукт по двум из трех исследуемых локусов (Ь1о1 и Ь1о11), при этом размер фрагментов укладывается в диапазон размеров аллелей, наблюдаемых в европейской популяции налима [29]. По локусу Ь1о12 не удалось получить ПЦР-продукт для половины анализируемых образцов, поэтому он не может быть рекомендован для дальнейшей работы. Тем не менее все три локуса оказались в разной степени полиморфными.
Рис. 3. Электрофорез в ПААГ ПЦР-продуктов трех локусов (Ь1о1, Ыо11 и Ь1о12) налима из двух популяций (1−4 — 4 особи налима из р. Собь- 5−8 — 4 особи налима с участка р. Иртыш). Разными геометрическими фигурами обозначены отдельные аллели. Концентрация ионов М§ 2+ - 1,5 мМ
Для оптимизации ПЦР с праймерами Ь1о32, Ь1о34 и EF139390 помимо технологии темпе-
2+ 2+
ратурного градиента использовали варьирование концентраций ионов Mg. Ионы Mg являются необходимым кофактором для ДНК-полимеразы в ПЦР. Многие компоненты реакционной смеси связывают эти ионы, в том числе ДНК-матрица, праймеры, ампликоны и дНТФ. При увеличении концентрации Mg2+, как правило, происходит и увеличение концентрации специфического продукта, однако избыток концентрации ионов магния может приводить к появлению
неспецифичных продуктов реакции. На рис. 4 представлены результаты ПЦР, проведенной с
2+
использованием градиентов температуры и концентрации ионов Mg.
Рис. 4. Результаты ПЦР с применением температурного градиента и варьированием концентрации ионов Mg2+:
Увеличение концентрации ионов Mg2+ до 2,5 мМ (на рис. 2 и 3 представлены результаты ПЦР для всех шести исследованных пар праймеров с концентрацией в реакционной смеси Mg2+
1,5 мМ) при проведении ПЦР с праймером Llo32 позволило увеличить эффективность накопления специфического ПЦР-продукта при температуре отжига равной 51 °C. Однако при дальнейшем увеличении концентрации Mg2+ до 3,5 мМ, как это видно на рис. 4, интенсивность специфической полосы уступала таковой при концентрации 2,5 мМ. Увеличение концентрации Mg2+ для праймеров Llo34 и EF139390 не принесло желаемого результата — интенсивность специфической полосы не увеличилась, а для локуса EF139390, наоборот, понизилась, при этом на электрофореграмме наблюдаются дополнительные полосы неспецифичных продуктов реакции. Таким образом, оптимальными концентрациями Mg2+ при проведении ПЦР для праймеров Llo1, Llo11 и Llo12 следует признать концентрацию 1,5 мМ, а для Llo32 — 2,5 мМ, которые обеспечивают высокий выход специфического продукта реакции без дополнительных неспецифических фрагментов. Однако результаты ПЦР с LLo32 не всегда хорошо воспроизводились в повторных реакциях, что не позволяет рекомендовать его для массового генотипирования исследуемых выборок налима.
Заключение
Таким образом, нами было апробировано шесть микросателлитных локусов, разработанных для европейской и китайской популяций налима, из которых два1о1 и Llo 11) уверенно можно рекомендовать для дальнейшей работы. Для этих локусов были подобраны оптимальные условия проведения ПЦР (табл. 3).
Таблица 3
Оптимизированный состав реакционной смеси и условия проведения ПЦР с микросателлитными праймерами Llo1 и Llo11 для налима из Обь-Иртышского бассейна
Компонент Состав реакционной смеси
Вода До 10 мкл
Смесь дезоксирибонуклеотидов 10 mM each dNTP — 0,2 мкл
ПЦР-буфер 10x Taq Buffer with KCl — 1 мкл
MgCl2 25 mM — 0,6 мкл
Праймер F 2 mkM — 1 мкл
Праймер R 2 mkM — 1 мкл
ДНК-полимераза 5 U/mkl Taq — 0,1 мкл
ДНК 40−100 нг — 2 мкл
Условия ПЦР
Процесс Температура Время
Начальная денатурация 94 °C 2 мин
Денатурация 94 °C 10 с 35 циклов
Отжиг праймера 62 °C 10 с
Достройка цепи 72 °C 30 с
Конечная элонгация 72 °C 3 мин
Исследования по тестированию праймеров и оптимизации ПЦР для двух данных микросателлитных локусов позволят в будущем успешно использовать их для выяснения особенностей внутривидовой дифференциации налима Обь-Иртышского бассейна. В дальнейшем планируется тестирование и разработка новых праймеров для создания панели из 8−10 микросател-литных локусов, необходимой для формирования референтной базы популяционногенетических данных по налиму, которая не только поможет оценить историю формирования современного ареала, процессы расселения и изоляции его локальных популяций, но и определять принадлежность особей к тем или иным конкретным группировкам.
Работа выполнена при финансовой поддержке Программы «Оценка состояния биологических ресурсов животного и растительного мира Урала и Ямала» 12-П-4−1043 и Проекта «Изучение структурных преобразований биоценозов полярной части Урала и прилегающих территорий в условиях промышленного освоения"12−4-3012-Арктика.
СПИСОК ЛИТЕРАТУРЫ
1. Стрелков П. П. Кризис политипической концепции вида на примере рода Plecotus / Стрелков П. П. // Plecotus et al. 2006. N 9. P. 3−7.
2. Сычев М. М. Внутривидовая дифференциация, способы видообразования в пределах «группы Bigut-tulus» (Orthoptera: Acrididae) и их таксономическое отражение / М. М. Сычев // Четвертая Междунар. теле-конф. «Фундаментальные науки и практика». Томск, 2011. Т. 3, № 1: http: //tele-conf. ru/zhiznedeyatelnost-rasteniy-i-zhivotnyih/vnutrividovaya-differentsiatsiya-sposobyi-vidoobrazovaniya-v-predelah-gruppyi-biguttulus-orthoptera-acrididae-i-ih-taksonomicheskoe-otrazhenie. html.
3. Северцов А. Н. Морфологические закономерности эволюции / А. Н. Северцов. М.- Л.: Изд-во АН СССР, 1939. 610 с.
4. Поздняков А. А. О сохранении «традиционной парадигмы систематики» / А. А. Поздняков // Журнал общей биологии. 1996. Т. 57, № 4. С. 513−527.
5. Майр Э. Принципы и методы зоологической систематики / Э. М. Майр. Мир, 1971. 454 c.
6. Шварц С. С. Экологические закономерности эволюции / С. С. Шварц. М.: Наука, 1980. 278 с.
7. Атлас пресноводных рыб России. Т. 2 / Под ред. Ю. С. Решетникова. М.: Наука, 2002. 253 с.
8. Van Houdt J. K. Phylogenetic relationships among Palearctic and Nearctic burbot (Lota lota): Pleistocene extinctions and recolonization / J. K. van Houdt, B. Hellemans, F. A. M. Volckaert // Molecular Phylogenetics and Evolution. 2003. Vol. 29, N 3. P. 599−612.
9. Stapanian M. A. Worldwide status of burbot and conservation measures / M. A. Stapanian, V. I. Paragamian, Ch. P. Madenjian, J. R. Jackson, J. Lappalainen, M. J. Evenson // Fish and fisheries. 2010. Vol. 11. P. 34−56.
10. Маркун М. Н. К систематике и биологии налима р. Камы / М. Н. Маркун // Изв. биол. НИИ реч. рыб. хоз-ва при Перм. ун-те. 1936. Т. 10, вып. 6. С. 211−237.
11. Мельянцев В. Г. Налим Нового Выгозера / В. Г. Мельянцев // Учен. зап. Карело-Фин. ун-та. 1948. Т. 2, вып. 3. С. 90−106.
12. Кириллов Ф. Н. Ихтиофауна бассейна реки Вилюй / Ф. Н. Кириллов // Фауна рыб и беспозвоночных бассейна Вилюя. М.: Изд-во АН СССР, 1962. С. 5−71.
13. Кириллов Ф. Н. Рыбы Якутии. М.: Наука, 1972. 360 с.
14. Сорокин В. Н. Налим озера Байкал / В. Н. Сорокин. Новосибирск: Наука, 1976. 144 с.
15. Богданов В. Д. Воспроизводство полупроходного налима р. Оби / В. Д. Богданов, А. Р. Копори-ков. Екатеринбург: УрО РАН, 2011. 156 с.
16. Elmer K. R. Population genetic structure of North American burbot (Lota lota maculosa) across the Nearctic and at its contact zone with Eurasian burbot (Lota lota lota) / K. R. Elmer, J. K. J. van Houdt, A. Meyer, F. A. M. Volckaert // Canadian Journal of Fisheries and Aquatic Sciences. 2008. Vol. 65, N 11. P. 2412−2426.
17. Elmer K. R. Asymmetric admixture and morphological variability at a suture zone parapatric burbot subspecies Pisces in the Mackenzie River basin, Canada / K. R. Elmer, H. Recknagel, A. Thompson, A. Meyer // Hydrobiologia. 2012. Vol. 683, N 1. P. 217−229.
18. Barluenga M. Genetic admixture of burbot (Teleostei: Lota lota) in Lake Constance from two European glacial refugia / M. Barluenga, M. Sanetra, A. Meyer // Molecular Ecology. 2006. Vol. 15. P. 3583−3600.
19. Zhao Ying Y. Isolation and characterization of new microsatellite markers from the burbot (Lota lota) / Zhao Ying Y., Li Jiao, Sun Xiao W., Liang Li Q., Zhu Xiao D., Ou-yang Hong S. // Conservation Genetics. 2009. Vol. 10, N 4. P. 1005−1007.
20. Рубцова Г. А. Дифференциация популяций кеты (Oncorhynchus keta Walbaum) по микросателлит-ным и аллозимным маркерам: сравнительный анализ / Г. А. Рубцова, К. И. Афанасьев, Т. В. Малинина, М. В. Шитова, Т. А. Ракицкая, В. Д. Прохоровская, Л. А. Животовский // Генетика. 2008. Т. 44, № 7. С. 964−971.
21. Животовский Л. А. Микросателлитная изменчивость в популяциях человека и методы её изучения // Вестн. Вавилов. об-ва генетиков и селекционеров. 2006. Т. 10. С. 74−96.
22. Алтухов Ю. П. Полиморфизм ДНК в популяционной генетике / Ю. П. Алтухов, Е. А. Салменкова // Генетика. 2002. Т. 38, № 9. С. 1173−1195.
23. Li Y. Microsatellites: genomic distribution, putative functions, and mutational mechanisms: a review / Y. Li, A. B. Korol, T. Fahima, A. Beiles, E. Nevo // Molecular Ecology. 2002. Vol. 11, N 12. P. 2453−2465.
24. Wright J. M. DNA fingerprinting in fishes / J. M. Wright // Biochemistry and Molecular Biology of Fishes. Amsterdam: Elsevier, 1993. Vol. 2. P. 58−91.
25. Selkoe K. A. Microsatellites for ecologists: A practical guide to using and evaluating microsatellite markers / K. A. Selkoe, R. J. Toonen // Ecology Letters. 2006. Vol. 9, N 5. P. 615−629.
26. Schlotterer C. Evolutionary dynamics of microsatellite DNA / C. Schlotterer // Chromosoma. 2000. Vol. 109. P. 365−371.
27. Ellegren H. Microsatellite mutations in the germline: implications for evolutionary inference / H. Elle-gren // Trends in genetics. 2000. Vol. 16, N 12. P. 551−558.
28. Aljanabi S. M. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques / S. M. Aljanabi, I. Martinez. // Nucleic Acids Research. 1997. Vol. 25, N 22. P. 4692−4693.
29. Sanetra M. Microsatellites from the burbot (Lota lota), a freshwater gadoid fish (Teleostei) / M. Sanetra, A. Meyer // Molecular Ecology Notes. 2005. Vol 5, N 2. P. 390−392.
REFERENCES
1. Strelkov P. P. Krizis politipicheskoj koncepcii vida na primere roda Plecotus [Crisis of polytypical concept of species by the example of gender Plecotus]. Plecotus et al. 2006, no. 9, pp. 3−7.
2. Sychev M. M. Vnutrividovaja differenciacija, sposoby vidoobrazovanija v predelah «gruppy Biguttulus» (Orthoptera: Acrididae) i ih taksonomicheskoe otrazhenie [Intraspecific differentiation, ways of species formation within & quot-group Biguttulus& quot- (Orthoptera: Acrididae) and their taxonomic reflection]. Chetvertaja Mezhdunarodnaja telekonferencija «Fundamental'-nye nauki i praktika». Tomsk, 2011. Vol. 3, no. 1: http: //tele-conf. ru/zhiznedeya telnost-rasteniy-i-zhivotnyih/vnutrividovaya-differentsiatsiya-sposobyi-vidoobrazovaniya-v-predelah-gruppyi-biguttulus-orthoptera-acrididae-i-ih-taksonomicheskoe-otrazhenie. html.
3. Severcov A. N. Morfologicheskie zakonomernosti jevoljucii [Morphological regularities of evolution]. Moscow- Leningrad, Izd-vo AN SSSR, 1939. 610 p.
4. Pozdnjakov A. A. O sohranenii «tradicionnoj paradigmy sistematiki» [On conservation of & quot-traditional paradigm of systematics& quot-]. Zhurnal obshhej biologii, 1996, vol. 57, no. 4, pp. 513−527.
5. Majr Je. Principy i metody zoologicheskoj sistematiki [Principles and methods of zoological systematics]. Moscow, Mir Publ., 1971. 454 p.
6. Shvarc S. S. Jekologicheskie zakonomernosti jevoljucii [Ecological regularities of evolution]. Moscow, Nauka Publ., 1980. 278 p.
7. Atlaspresnovodnyh ryb Rossii [Atlas of freshwater fish in Russia]. Vol. 2 / Pod redaktsiei Ju. S. Reshet-nikova. Moscow, Nauka Publ., 2002. 253 p.
8. Van Houdt J. K., Hellemans B., Volckaert F. A. M. Phylogenetic relationships among Palearctic and Nearctic burbot (Lota lota): Pleistocene extinctions and recolonization. Molecular Phylogenetics and Evolution, 2003, vol. 29, no. 3, pp. 599−612.
9. Stapanian M. A., Paragamian V. L., Madenjian Ch. P., Jackson J. R., Lappalainen J., Evenson M. J., Neu-feld M. D. Worldwide status of burbot and conservation measures. Fish andfisheries, 2010, vol. 11, pp. 34−56.
10. Markun M. N. K sistematike i biologii nalima r. Kamy [To the systematics and biology of burbot from the Kama river]. Izvestija Biologicheskogo nauchno-issledovatel'-skogo instituta rechnogo rybnogo hozjajstva pri Permskom universitete, 1936, vol. 10, iss. 6, pp. 211−237.
11. Mel'-jancev V. G. Nalim Novogo Vygozera [Burbot of the New Vygozer]. Uchenye zapiski Karelo-Finskogo universiteta, 1948, vol. 2, iss. 3, pp. 90−106.
12. Kirillov F. N. Ihtiofauna bassejna reki Viljuj [Ichthyofauna of the basin of the Vilyuy river]. Fauna ryb i bespozvonochnyh bassejna Viljuja. Moscow, Izd-vo AN SSSR, 1962, pp. 5−71.
13. Kirillov F. N. Ryby Jakutii [Yakutia fish]. Moscow, Nauka Publ., 1972. 360 p.
14. Sorokin V. N. Nalim ozera Bajkal [Baikal burbot]. Novosibirsk, Nauka Publ., 1976. 144 p.
15. Bogdanov V. D., Koporikov A. R. Vosproizvodstvo poluprohodnogo nalima r. Obi [Reproduction of semi-anadromous burbot of the Ob river]. Yekaterinburg, UrO RAN, 2011. 156 p.
16. Elmer K. R., Van Houdt J. K. J., Meyer A., Volckaert F. A. M. Population genetic structure of North American burbot (Lota lota maculosa) across the Nearctic and at its contact zone with Eurasian burbot (Lota lota lota). Canadian Journal of Fisheries and Aquatic Sciences, 2008, vol. 65, no. 11, pp. 2412−2426.
17. Elmer K. R., Recknagel H., Thompson A., Meyer A. Asymmetric admixture and morphological variability at a suture zone parapatric burbot subspecies Pisces in the Mackenzie River basin, Canada. Hydrobiologia, 2012, vol. 683, no. 1, pp. 217−229.
18. Barluenga M., Sanetra M., Meyer A. Genetic admixture of burbot (Teleostei: Lota lota) in Lake Constance from two European glacial refugia. Molecular Ecology, 2006, vol. 15, pp. 3583−3600.
19. Zhao Ying Y., Li Jiao, Sun Xiao W., Liang Li Q., Zhu Xiao D., Ou-yang Hong S. Isolation and characterization of new microsatellite markers from the burbot (Lota lota). Conservation Genetics, 2009, vol. 10, no. 4, pp. 1005−1007.
20. Rubcova G. A., Afanas'-ev K. I., Malinina T. V., Shitova M. V., Rakickaja T. A., Prohorovskaja V. D., Zhi-votovskij L. A. Differenciacija populjacij kety (Oncorhynchus keta Walbaum) po mikrosatellitnym i allozimnym markeram: sravnitel'-nyj analiz [Differentiation of population of Siberian salmon (Oncorhynchus keta Walbaum) by microsatellite and allozyme markers: comparative analysis]. Genetika, 2008, vol. 44, no. 7, pp. 964−971.
21. Zhivotovskij L. A. Mikrosatellitnaja izmenchivost'- v populjacijah cheloveka i metody ejo izuchenija [Microsatellite variability in human population and methods of its studying]. Vestnik Vavilovskogo obshhestva genetikov i selekcionerov, 2006, vol. 10, pp. 74−96.
22. Altuhov Ju. P., Salmenkova E. A. Polimorfizm DNK v populjacionnoj genetike [Polymorphism of DNA in population genetics]. Genetika, 2002, vol. 38, no. 9, pp. 1173−1195.
23. Li Y., Korol A. B., Fahima T., Beiles A, Nevo E. Microsatellites: genomic distribution, putative functions, and mutational mechanisms: a review. Molecular Ecology, 2002, vol. 11, no. 12, pp. 2453−2465.
24. Wright J. M. DNA fingerprinting in fishes. Biochemistry and Molecular Biology of Fishes. Amsterdam: Elsevier, 1993, vol. 2, pp. 58−91.
25. Selkoe K. A., Toonen R. J. Microsatellites for ecologists: A practical guide to using and evaluating microsatellite markers. Ecology Letters, 2006, vol. 9, no. 5, pp. 615−629.
26. Schlotterer C. Evolutionary dynamics of microsatellite DNA. Chromosoma, 2000, vol. 109, pp. 365−371.
27. Ellegren H. Microsatellite mutations in the germline: implications for evolutionary inference. Trends in genetics, 2000, vol. 16, no. 12, pp. 551−558.
28. Aljanabi S. M., Martinez I. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques. Nucleic Acids Research, 1997, vol. 25, no. 22, pp. 4692−4693.
29. Sanetra M., Meyer A. Microsatellites from the burbot (Lota lota), a freshwater gadoid fish (Teleostei). Molecular Ecology Notes, 2005, vol. 5, no. 2, pp. 390−392.
Статья поступила в редакцию 5. 09. 2013
ИНФОРМАЦИЯ ОБ АВТОРАХ
Ракитин Сергей Борисович — Институт экологии растений и животных Уральского отделения Российской академии наук, Екатеринбург- младший научный сотрудник лаборатории филогенетики и биохронологии- raserge@yandex. ru.
Rakitin Sergey Borisovich — Institute of Plant and Animal Ecology of Oral Department of Russian Academy of Sciences, Yekaterinburg- Junior Researcher of the Laboratory of Phylogenetics and Biochronology- raserge@yandex. ru.
Копориков Александр Ростиславович — Институт экологии растений и животных Уральского отделения Российской академии наук, Екатеринбург- научный сотрудник лаборатории экологии рыб и биоразнообразия водных экосистем- Koporikov@mail. ru.
Koporikov Alexander Rostislavovich — Institute of Plant and Animal Ecology of Oral Department of Russian Academy of Sciences, Yekaterinburg- Researcher of the Laboratory of Fish Ecology and Biodiversity in Aquatic Ecosystems- Koporikov@mail. ru.
Богданов Владимир Дмитриевич — Институт экологии растений и животных Уральского отделения Российской академии наук, Екатеринбург- д-р биол. наук, профессор, член-корреспондент Российской академии наук- директор- bogdanov@ipae. uran. ru.
Bogdanov Vladimir Dmitrievich — Institute of Plant and Animal Ecology of Oral Department of Russian Academy of Sciences, Yekaterinburg- Doctor of Biology, Professor, Corresponding Member of Russian Academy of Sciences- Director, bogdanov@ipae. uran. ru.
Хрунык Юлия Ярославовна — Институт экологии растений и животных Уральского отделения Российской академии наук, Екатеринбург- канд. биол. наук- научный сотрудник лаборатории филогенетики и биохронологии- juliakhrunyk@yahoo. co. uk.
Khrunyk Yuliya Yaroslavovna — Institute of Plant and Animal Ecology of Oral Department of Russian Academy of Sciences, Yekaterinburg- Candidate of Biology- Researcher of the Laboratory of Phylogenetics and Biochronology- juliakhrunyk@yahoo. co. uk.
Ялковская Лидия Эдуардовна — Институт экологии растений и животных Уральского отделения Российской академии наук, Екатеринбург- канд. биол. наук- старший научный сотрудник лаборатории филогенетики и биохронологии- lida@ipae. uran. ru.
Yalkovskaya Lidiya Eduardovna — Institute of Plant and Animal Ecology of Oral Department of Russian Academy of Sciences, Yekaterinburg- Candidate of Biology- Senior Researcher of the Laboratory of Phylogenetics and Biochronology- juliakhrunyk@yahoo. co. uk.
Семериков Владимир Леонидович — Институт экологии растений и животных Уральского отделения Российской академии наук, Екатеринбург- д-р биол. наук- зав. лабораторией молекулярной экологии растений, semerikov@ipae. uran. ru.
Semerikov Vladimir Leonidovich — Institute of Plant and Animal Ecology of Oral Department of Russian Academy of Sciences, Yekaterinburg- Doctor of Biology- Head of the Laboratory Molecular Ecology of Plants- semerikov@ipae. uran. ru.
Бородин Александр Васильевич — Институт экологии растений и животных Уральского отделения Российской академии наук, Екатеринбург- д-р биол. наук, доцент- зав. лабораторией филогенетики и биохронологии- bor@ipae. uran. ru.
Borodin Alexander Vasilievich — Institute of Plant and Animal Ecology of Oral Department of Russian Academy of Sciences, Yekaterinburg- Doctor of Biology, Assistant Professor- Head of the Laboratory of Phylogenetics and Biochronology- bor@ipae. uran. ru.

ПоказатьСвернуть
Заполнить форму текущей работой