Клеточные белки Ku и HMGA1 как участники транскрипции ВИЧ-1

Тип работы:
Реферат
Предмет:
Биология


Узнать стоимость

Детальная информация о работе

Выдержка из работы

УДК 578. 233. 44
Клеточные белки Ku и HMGA1 как участники транскрипции ВИЧ-1
О. А. Шадрина1, Е. С. Княжанская2, С. П. Королев2, М. Б. Готтих3*
'-Московский государственный университет им. М. В. Ломоносова, факультет биоинженерии и биоинформатики, 119 991, Москва, Ленинские горы, 1, стр. 73
2Московский государственный университет им. М. В. Ломоносова, химический факультет, 119 991, Москва, Ленинские горы, 1, стр. 3
3Московский государственный университет им. М. В. Ломоносова, Научно-исследовательский
институт физико-химической биологии им. А. Н. Белозерского, 119 991, Москва,
Ленинские горы, 1, стр. 40
*E-mail: gottikh@belozersky. msu. ru
Поступила в редакцию 17. 07. 2015
Принята к печати 28. 10. 2015
РЕФЕРАТ Вирус иммунодефицита человека первого типа (ВИЧ-1) использует транскрипционную машину клетки-хозяина для транскрипции своих генов. Единственным вирусным белком, участвующим в этом процессе, является трансактиватор транскрипции Tat. В острой фазе инфекции Tat связывается с РНК-шпилькой в начале транскрибируемой вирусной РНК и привлекает комплекс P-TEFb, который гиперфос-форилирует РНК-полимеразу II и запускает элонгацию транскрипции. Латентная фаза ВИЧ-инфекции характеризуется низким уровнем транскрипции. В латентной фазе и при выходе из нее белок Tat в клетке не детектируется, и механизм активации транскрипции в его отсутствие понятен не до конца. Актуальным остается вопрос о механизме поддержания латентности. Очевидно, что и в репрессии транскрипции в латентной фазе, и в ее активации при переходе в литическую фазу инфекции участвуют клеточные белки, роль которых еще не выяснена. Данный обзор посвящен обсуждению роли клеточных белков Ku и HMGA1 в инициации и элонгации транскрипции интегрированного генома ВИЧ-1. Представлены данные о зависимости Ku-опосредованной транскрипции ВИЧ-1 от структуры промотора и формы вирусной ДНК. Описано разнонаправленное влияние белка HMGA1 на индуцируемую транскрипцию и на базальную транскрипцию ВИЧ-1. Предложены возможные механизмы участия белков Ku и HMGA1 в регуляции транскрипции про-вируса.
КЛЮЧЕВЫЕ СЛОВА клеточные факторы транскрипции, латентная фаза, транскрипция ВИЧ-1, элонгация. СПИСОК СОКРАЩЕНИЙ ВИЧ-1 — вирус иммунодефицита человека типа 1- СПИД — синдром приобретенного иммунодефицита- TAR (trans-activation response) — элемент трансактивируемого ответа- Tat (trans-activator of transcription) — трансактиватор транскрипции- HMGA1 (high mobility group protein A1) — белок А1 группы с высокой подвижностью- DNA-PK — ДНК-зависимая протеинкиназа- DNA-PKcs — каталитическая субъединица DNA-PK- LTR — длинный концевой повтор- РНКП II — ДНК-зависимая РНК-полимераза II- СКД РНКП II — С-концевой домен РНКП II- P-TEFb (positive transcription elongation factor b) — позитивный фактор b элонгации транскрипции- HTLV-1 — Т-лимфотропный вирус человека- MMTV — вирус опухоли молочной железы мыши- NRE-1 (negative regulatory element 1) — негативный регуляторный элемент 1- ТФ — транскрипционный фактор.
ВВЕДЕНИЕ
Прошло уже более 30 лет после открытия вируса иммунодефицита человека (ВИЧ-1), но вызываемую им инфекцию до сих пор не удалось победить. Высокоактивная антиретровирусная терапия, применяемая при ВИЧ-инфекции, позволила значительно уменьшить смертность больных СПИДом, однако прерывание терапии неизбежно приводит к возобновлению репродукции вируса и повышению его титра в крови. Одной из причин этого является
присутствие в организме человека клеток, содержащих интегрированный в их геном «спящий» прови-рус. «Спящее» состояние, типичное для латентной стадии вирусной инфекции, характеризуется отсутствием полноценной транскрипции с вирусного промотора. Однако «спящий» провирус может активироваться и при отсутствии терапии вызвать развитие СПИДа [1].
В активной транскрипции с промотора ВИЧ-1 особую роль играет расположенная на 5'--конце синте-
зируемой мРНК шпилечная структура, называемая TAR (trans-activation response). После интеграции вирусной кДНК в геном клетки-хозяина элонгация транскрипции вирусного генома происходит только после связывания TAR с вирусным регулятор-ным белком Tat (trans-activator of transcription) [2]. Формирование комплекса TAR-Tat обеспечивает фосфорилирование РНК-полимеразы II, необходимое для снятия транскрипционного блока и перехода в стадию элонгации [3]. Однако в латентном состоянии вируса белок Tat в клетке не детектируется, и механизм процесса активации транскрипции «спящего» интегрированного провируса при переходе из латентной в литическую фазу жизненного цикла ВИЧ-1 понятен не до конца. Изучение белков, участвующих в активации транскрипции с промотора ВИЧ-1 по Tat-независимому механизму, очень актуально, поскольку в перспективе позволит понять механизм перехода вируса из латентной фазы в лити-ческую и найти подходы к регуляции этого процесса.
Недавние исследования показали, что в регуляции уровня транскрипции с промотора ВИЧ-1 в латентной фазе (базальной транскрипции) может принимать участие клеточный белок HMGA1 [4, 5]. Еще одним участником регуляции транскрипции может быть клеточный ДНК-связывающий белок Ku — компонент ДНК-зависимой протеинкиназы (DNA-PK)
[6−10]. В представленном обзоре суммированы данные о влиянии белков Ки и НМ^А1 на транскрипцию ВИЧ-1, приведены также возможные схемы участия этих белков на регуляцию транскрипции.
РЕГУЛЯЦИЯ ТРАНСКРИПЦИИ С ПРОМОТОРА ВИЧ-1
Вирус иммунодефицита человека первого типа принадлежит к роду лентивирусов семейства ретрови-русов. Он поражает иммунную систему организма человека и вызывает синдром приобретенного иммунодефицита (СПИД). Геном ВИЧ-1, как и у других лентивирусов, представлен молекулой РНК, на основе которой вирусный фермент обратная транскрип-таза синтезирует ДНК-копию генома, которая затем встраивается в геном клетки с образованием прови-русной ДНК. Однако большая доля вирусной ДНК остается неинтегрированной [11]. Такая ДНК существует главным образом в кольцевой форме. С кольцевых форм вирусной ДНК может осуществляться транскрипция, но основной матрицей для синтеза вирусных белков служит именно интегрированная форма провируса [12].
После интеграции в хромосому зараженной клетки вирусная ДНК может оставаться в «молчащем» состоянии или активно транскрибироваться. Иными словами, транскрипция может идти малыми темпами с образованием небольшого числа транскрип-
552
Модуляторный регион
Энхансер
Промотор
Лидерный регион
I щ «¦¦¦ ¦¦¦¦¦¦ и m ¦ il и ни ¦ I¦¦¦
& gt- & gt- ¦о тз
о п о о
ci z о 2: с:
тэ о
~Г ?? то Ti^diljco-- '-I
g Ц ^-l'-ZIS *
CT ^ -о
d
ТЗ cd
ГО

а г& gt- го H
& quot-TD Т1
& gt-
2 #
& quot-О
Рис. 1. Сайты связывания транскрипционных факторов в 5'--LTR ВИЧ-1. Схематичное представление провируса ВИЧ-1 и основных сайтов связывания факторов транскрипции. Указано положение регионов 5'--LTR: Ш (нуклеоти-ды 1−455), R (456−552), и5 (553−634). Старт транскрипции показан стрелкой и соответствует границе регионов и3 и R. По данным [13]
тов без быстрого прогрессирования инфекции — это базальная, ничем не активируемая транскрипция. Другой вариант — активное протекание транскрипции с образованием большого количества РНК и новых вирусных частиц. Регуляция транскрипции генома ВИЧ-1, лежащая в основе изменения состояния провируса, зависит от большого набора различных факторов: цис-элементов вирусной ДНК, клеточных транскрипционных факторов, вирусного трансактиватора Та!, степени конденсации хроматина.
Вирусная ДНК, интегрированная в клеточный геном, содержит на своих концах длинные концевые повторы (LTR). Каждый из них состоит из трех регионов: из, R, и5 (рис. 1). Транскрипция начинается на границе из и R в 5'--LTR- в регионе из располагаются вирусный промотор, узнаваемый РНК-полимеразой II (РНКП II), и некоторые ре-гуляторные элементы. В 5'--LTR выделяют четыре функциональных региона, участвующих в регуляции транскрипции генома ВИЧ-1: модуляторный регион, энхансер, промотор и лидерный регион (рис. 1) [13]. Они содержат множество сайтов связывания клеточных факторов транскрипции, в том числе наиболее важных для регуляции транскрипции с вирусного промотора — NF-кB, NFAT, Sp1,
AP-1 (рис. 1). Эти факторы участвуют в инициации транскрипции [1, 13].
Переход провируса из молчащего состояния в активное начинается с инициации транскрипции. При этом синтезируются короткие абортивные транскрипты длиной около 60−80 нуклеотидов [14], которые образуют на 5'--конце стабильную шпильку, называемую TAR. После синтеза TAR РНК наступает пауза: РНКП II останавливается, поскольку с ней связаны факторы, репрессирующие элонгацию — NELF (negative elongation factor) и DSIF (5,6-dichloro-1-P-D-ribofuranosylbenzimidazole sensitivity-inducing factor) [15]. Для продолжения транскрипции и перехода в стадию активной элонгации необходимо гиперфосфорилирование С-концевого домена (СКД) РНКП II по остаткам Ser2 в гептапептидных повторах YSPTSPS. Оно обеспечивается фактором элонгации транскрипции P-TEFb (positive transcription elongation factor b), состоящим из циклинзависимой киназы 9 (Cdk9) и циклина Т1 (СусТ1). В клетках уровень P-TEFb регулируется связыванием с малым ядерным рибонуклеопротеи-ном 7SK (7SK мяРНП), который ингибирует киназ-ную активность фактора P-TEFb и препятствует элонгации транскрипции [16].
A
P-TEFb
P-TEFb
P-TEFb
Tat-независимая (базальная) транскрипция
Tat-зависимая транскрипция
Рис. 2. Возможные пути привлечения P-TEFb к промотору ВИЧ-1. А, Б — Tat-независимая транскрипция, при которой P-TEFb стимулирует базальную транскрипцию с промотора ВИЧ-1 в отсутствие Tat. P-TEFb может привлекаться клеточными белками Brd4, SEC (А) или NF-kB, Sp1 (Б). В — Tat-зависимая транскрипция. Tat связывается с TAR РНК, способствует освобождению P-TEFb из 7SK мяРНП и привлечению его к остановленному элонгацион-ному комплексу. По данным [14]
Главным регулятором на стадии элонгации выступает вирусный белок Tat, который на порядки увеличивает эффективность синтеза РНК [2]. Связывание Tat с синтезированной РНК TAR способствует диссоциации P-TEFb из комплекса с 7SK мяРНП и привлекает его к вирусному промотору. В результате P-TEFb обеспечивает гиперфосфори-лирование РНКП II, а также факторов NELF и DSIF [17]. Фосфорилирование DSIF превращает его в активирующий фактор элонгации, а фосфорилированная форма NELF диссоциирует из транскрипционного комплекса, позволяя РНКП II вести эффективную элонгацию и синтезировать полноразмерные мРНК (рис. 2) [3].
Однако на латентной стадии инфекции Tat не детектируется в клетке, его нет и в начале выхода провируса из «спящего» состояния. В ряде случаев формирование комплекса TAR-Tat-P-TEFb невозможно из-за мутаций, нарушающих взаимодействие между компонентами комплекса [18]. Тем не менее все же существует возможность транскрипции с промотора ВИЧ-1. Известно несколько возможных механизмов Tat-независимой активации транскрипции. Во-первых, предполагается, что P-TEFb осуществляет необходимое для элонгации транскрипции фосфорилирование СКД РНКП II в отсутствие Tat [19]. При этом в привлечении P-TEFb на вирусный промотор участвуют, по-видимому, некоторые клеточные факторы (Sp1 [20], SEC [14], Brd4 [21, 22], NF-kB [14]) (рис. 2А, Б). Другая возможность — связывание с промотором ВИЧ-1 другого клеточного белка, отличного от P-TEFb, который может фосфорилировать СКД РНКП II и репрессирующие факторы NELF и DSIF.
Несмотря на большой объем информации о регуляции транскрипции ВИЧ-1 и участии в ней различных клеточных факторов, остается много не до конца понятных моментов. В частности, есть два клеточных белка, участвующих в транскрипции ВИЧ-1, роль которых в этом процессе не вполне ясна. Это белки Ku и HMGA1. Существуют данные как об их положительной роли в регуляции транскрипции, так и об отрицательной. Тем не менее точные механизмы участия этих белков в транскрипции ВИЧ-1 до сих пор не установлены.
УЧАСТИЕ Ku В ТРАНСКРИПЦИИ ВИЧ-1
Белок Ku — это гетеродимер, состоящий из двух субъединиц массой примерно 70 и 80 кДа, известных как Ku70 (p70) и Ku80 (Ku86, p80). Эти белки кодируются генами xrcc6 (Ku70) и xrcc5 (Ku80). Большинство своих функций в клетке Ku выполняет именно в виде очень прочного гетеродимера [23]. Однако существуют исследования, показывающие,
что в некоторых процессах могут действовать изолированные субъединицы Ku70 и Ku80 [24].
Гетеродимер Ku70/Ku80 — ДНК-связывающий белок, взаимодействующий преимущественно со свободными концами двухцепочечной ДНК, биологические функции которого связаны, в основном, именно с этой его особенностью. Взаимодействие гетеродимера Ku с ДНК довольно прочное — величина Kd варьирует в пределах 1. 5−4.0×10−10 M [25]. Судя по данным рентгеноструктурного анализа [26], Ku70 и Ku80 в составе гетеродимера образуют асимметричное кольцо с широким основанием и тонким мостиком, и в образуемый белком канал помещается ДНК (рис. 3). Канал состоит преимущественно из положительно заряженных аминокислотных остатков, взаимодействующих с отрицательно заряженным сахарофосфатным остовом молекулы ДНК, что объясняет способность Ku связываться с ДНК независимо от ее нуклеотидной последовательности. После связывания с концом ДНК Ku может перемещаться («скользить») по ней, останавливаясь на некоторых последовательностях [25, 27].
Наиболее известная и изученная биологическая функция Ku — участие в репарации двухцепочечных разрывов в ДНК путем негомологичного объединения концов (nonhomologous end joining — NHEJ). Ku также участвует в таких клеточных процессах, как V (D) J-рекомбинация, перестановка мобильных элементов генома, поддержание длины теломер, апоптоз, транскрипция [28, 29]. Одна из важных функций Ku — связывание с каталитической субъединицей DNA-PKcs и формирование ДНК-зависимой протеинкина-
Рис. 3. Структура гетеродимера Ки в комплексе с ДНК по данным [26]. ДНК (показана черным) погружается в канал, образуемый петлями Ки70 (желтый) и Ки80 (коричневый). PDB Ю 1JEY
зы DNA-PK. Важно отметить, что каталитическая функция DNA-PK активируется после связывания с ДНК, за которое отвечает гетеродимер Ku [25].
Возможные механизмы Ku-опосредованной регуляции транскрипции
Одна из многих функций Ku — участие в регуляции транскрипции. Описано несколько механизмов, с помощью которых Ku может активировать или подавлять транскрипцию. Первый из них — это прямое, специфичное к нуклеотидной последовательности, взаимодействие Ku с промоторной областью генов. Предполагается, что с помощью такого механизма регулируется транскрипция клеточных генов c-Myc, Hsp70 [30], U1 мяРНК [31], а также ретровирусов HTLV-1 (Human T-lymphotropic virus) [32] и MMTV (mouse mammary tumor virus) [33]. Механизм связывания Ku с промотором без участия концов ДНК пока непонятен, однако существуют некоторые данные о возможном специфичном к последовательности взаимодействии гетеродимера c определенным Ku-связывающим сайтом в ДНК [34].
В районе LTR ретровируса MMTV в области NRE-1 (negative regulatory element 1) идентифицирована последовательность, связывание Ku с которой считается истинно специфичным к последовательности и более предпочтительным, чем связывание с концами ДНК (рис. 4) [34]. Взаимодействие Ku с этой последовательностью снижает эффективность транскрипции с вирусного LTR. Предполагается, что в этой регуляции участвует каталитическая субъединица DNA-PKcs [33, 35]. Показано, что два фактора транскрипции, связывающиеся с 5'--LTR MMTV и активирующие его транскрипцию, могут быть фосфорилированы DNA-PK in vitro: GR (глюкокортикоидный рецептор) [34] и Oct-1 [36]. Возможно, специфичное привлечение DNA-PK на промотор и последующее фосфорилирование факторов транскрипции представляют собой один из механизмов регуляции транскрипции.
-396 — CTGAGAAAGAGAAAGACGACA — -376 GR MMTV LTR
-396 — CTcAagAASaaAAAtSACGACA — -376 C3E MMTV LTR
-292 — ta с AGAAA. G gGAAAGgg a i: ta — -268 с -my: '- PRE
292 — gaatGAAAGgGAnAGggGtgg — 269 U5 HTLV LTR
Рис. 4. Предполагаемые Ки-связывающие сайты в промоторах генов. Ки-связывающие сайты, гомологичные последовательности NRE-1, находящейся в LTR GR-штамма ММ^. Цветом выделена последовательность прямого повтора. Несовпадения показаны строчными буквами. По данным [34]
В работе [34] указаны все предложенные на тот момент участки связывания Ku в промоторах, гомологичные последовательности NRE-1 в промоторе GR-штамма вируса MMTV (рис. 4). Сообщается, что только эти последовательности способны прямо и специфически взаимодействовать с гетеродимером Ku в отсутствие свободных концов ДНК.
Второй механизм, с помощью которого Ku влияет на транскрипцию, это его непосредственное взаимодействие с транскрипционными факторами, включая Oct-1, Oct-2 [36], NF45/NF90 [37], AP-1 [38], Ese-1 [39], YY1 [40], p53 [41]. Некоторые из этих факторов вовлечены в регуляцию транскрипции ВИЧ-1. Кроме того, как уже упоминалось, некоторые транскрипционные факторы могут служить субстратом для DNA-PK in vitro. Способность DNA-PK взаимодействовать как с транскрипционными факторами, так и с целым рядом ядерных рецепторов (AR [42], GR [34], PR [43], ER-a [44]), возможно, предполагает существование некого общего пути участия Ku в передаче клеточных сигналов и регуляции транскрипции.
Ku может опосредованно регулировать транскрипцию генов, влияя на экспрессию других факторов транскрипции. Так, в клеточной линии AGS Ku действует как положительный регулятор экспрессии гена субъединицы p50 фактора NF-kB [45]. Ku80 стимулирует также экспрессию гена c-jun, компонента транскрипционного фактора AP-1 [38]. Стоит заметить, что NF-kB и AP-1 являются важнейшими регуляторами транскрипции генов ВИЧ-1.
Субъединицы Ku70 и Ku80 могут по-разному влиять на транскрипцию. Так, показано, что субъединицы гетеродимера Ku динамически связываются с промотором гена интерлейкина 2 (IL-2) и взаимодействуют c фактором NF45/NF90 в ответ на активацию Т-лимфоцитов [37]. Эта активация приводила к повышению количества комплекса Ku80/NF90, связанного с последовательностью ARRE (antigen receptor response element) в промоторе гена IL-2, а количество субъединицы Ku70, связанной с этим участком, при этом снижалось [37]. Однако в другой работе репрессирующую роль Ku в транскрипции гена Hsp70 связывают с субъединицей Ku70, но не Ku80 [30].
Третий механизм транскрипционной регуляции — прямое взаимодействие гетеродимера Ku или его субъединицы Ku80 с холоферментом РНКП II. Обнаружено, что в ядре Ku80 колокализуется с сайтами элонгации транскрипции [46, 47]. В экспериментах по коиммунопреципитации показано взаимодействие Ku с элонгационной формой РНКП II, а также с факторами транскрипции, специфичными для стадии элонгации, в частности DSIF. Также установлено, что во взаимодействии с этими белками ключевую роль играет С-концевой домен Ku80
[48]. Отметим, что in vitro РНКП II может служить субстратом для DNA-PK [49], однако роль фосфори-лирования в регуляции транскрипции пока неясна.
Четвертый способ участия Ku в регуляции транскрипции связан с его основной функцией в репарации двухцепочечных разрывов ДНК [50]. Для успешной инициации транскрипции с ряда промоторов, регулируемых связыванием с AP-1 и ядерными рецепторами (среди которых есть и взаимодействующие с Ku), необходимо внесение двухцепочеч-ных разрывов с помощью ДНК-топоизомеразы Пр. Тогда в присутствии комплекса белков PARP-1 (poly[adenosinediphosphate (ADP)-ribose]-polymerase-1), DNA-PKcs и Ku70/Ku80 происходит репарация этих разрывов и локальные изменения в структуре хроматина.
Таким образом, в регуляции транскрипции могут участвовать разные субъединицы гетеродиме-ра по отдельности, гетеродимер в целом, а также его комплекс с каталитической субъединицей DNA-PKcs. Общего механизма действия Ku не выявлено, скорее всего, для каждого конкретного гена существует свой способ Ku-зависимой регуляции. Стоит отметить еще раз, что Ku может выступать и как активатор, и как супрессор- его действие часто зависит от набора субъединиц, вовлеченных в регуляцию. Очевидно, в Ku-зависимой регуляции транскрипции не всегда участвует каталитическая субъединица DNA-PK, однако в определенных случаях ее способность к ДНК-зависимому фосфорилированию факторов транскрипции и самой РНКП II может быть ключевым элементом регуляции.
Роль Ku в транскрипции ВИЧ-1
Важность Ku для поддержания жизненного цикла ВИЧ-1 показана в многочисленных исследованиях. Субъединица Ku70 является частью предынтегра-ционного комплекса и взаимодействует с интегразой ВИЧ-1 [51, 52]. Субъединица Ku80 обнаружена в составе вириона [53], куда может включаться на стадии формирования новой вирусной частицы в ранее зараженной клетке. Известно, что для успешной интеграции вирусной кДНК в геном клетки-хозяина необходимо репарировать одноцепочечные разрывы, которые образуются при встраивании вирусной ДНК в клеточную. Считается, что в этом процессе могут участвовать белки из системы NHEJ, в частности, гетеродимер Ku70/Ku80 [54]. Так, в клетках, дефектных по Ku80, DNA-PKcs, Xrcc4 (X-ray repair cross-complementing protein 4) и ДНК-лигазе IV, существенно снижена эффективность трансдукции лентивирусных векторов [55, 56]. Ku участвует также в формировании кольцевой формы вирусной ДНК из неинтегрированной линейной ДНК [57−59].
Первые сведения об участии Ku в регуляции транскрипции ВИЧ-1 были получены в начале 2000-х гг. Однако до сих пор нет четкой картины того, как осуществляется эта регуляция. Получены данные в пользу как положительного, так и отрицательного влияния Ku на транскрипцию генома ВИЧ-1.
Впервые роль Ku в транскрипции с вирусного 5'--LTR начали изучать на линии клеток xrs-6, варианте клеток CHO-K1 (клетки яичников китайских хомячков), в которых не экспрессируется ген Ku80. В этих клетках наблюдали повышение экспрессии с плазмиды, содержащей ген CAT (хлорамфени-кол-ацетилтрансфераза) под контролем вирусного промотора из 5'--LTR [6]. Стабильная трансфекция клеток xrs-6 вектором, несущим ген Ku80 человека, приводила к снижению экспрессии CAT. Таким образом, Ku80 негативно влияет на транскрипцию с 5'--LTR-промотора ВИЧ-1. Отрицательная роль Ku80 подтверждена на линии клеток U1 человека, содержащей в геноме интегрированный провирус и служащей моделью латентного состояния ВИЧ-1. Оказалось, что снижение количества эндогенного Ku80 в клетке приводит к повышению уровня транскрипции генов ВИЧ-1 — как базального, так и индуцированного воздействием TNFa.
Учитывая, что Ku негативно влияет на транскрипцию с других ретровирусных промоторов (MMTV, HTLV-1) [32, 33], провели поиск Ku-связывающего сайта в 5'--LTR ВИЧ-1 и обнаружили в области NRE-1 участок (-217/-197), который обладает достаточно высоким сходством с Ku-связывающим сайтом в NRE-1 MMTV (рис. 5) [6]. Были предложены несколько вариантов подавления транскрипции ВИЧ-1 с помощью Ku. Принимая во внимание, что Ku может связываться с факторами транскрипции Oct-1 и Oct-2 [36], которые репрессируют и базальную, и Tat-активированную транскрипцию ВИЧ-1, предположили [6], что связывание Ku в модуляторном регионе (рис. 5А) способствует привлечению этих факторов к промотору ВИЧ-1. Не исключена также возможность участия Ku в регуляции структуры хроматина. NRE-1 содержит сайт связывания ядерного матрикса [60], который перекрывается с предсказанным Ku-связывающим сайтом. Возможно, взаимодействие Ku и ядерного матрикса на этом участке препятствует транскрипции, активируемой NF-kB.
В следующей работе этой же группы [7] сообщалось об отрицательном влиянии Ku80 на транскрипцию с ретровирусных векторов. При этом оказалось, что независимо от использованного в лентивирусной системе промотора, транскрипция с него была активнее в отсутствие Ku80. Иными словами, влияние Ku80 на экспрессию ретровирусных векторов оказалось неспецифичным к последовательности и, сле-
А
из
+
+
U5
4-
Модуляторный регион Энхансер
I 1
-340
i
-105
455 552 634
Пром°т°р Лидерный регион -iraa--
В +1 +60
ут
-217 ¦197 Ku-связывающий сайт
GR MMTV LTR C3H MMTV LTR U5 HTLV LTR c-myc PRE COL3A1-промотор HIV-1 LTR
gaaagacJaca
AAAAGACIACA
gaaa. ggg|tgs
G A A A G G G, А С T A T GGGT GClGCT A G T G T T A-GA G T
Рис. 5. Схема генома ВИЧ-1 и положение Ки-связывающего сайта в 5'--LTR. А — указано положение регионов 5'--LTR: и3 (нуклеотиды 1−455), R (456−552), и5 (553−638). Отсчет от начала генома. Показаны основные регуляторные регионы 5'--LTR. +1 — отсчет от старта транскрипции, указанного стрелкой. Показан предсказанный в [6] Ки-связывающий сайт. Б — выравнивание между предполагаемыми Ки-связывающими сайтами в регионе NRE-1 ВИЧ-1 и ММ^, а также некоторыми другими последовательностями, похожими на NRE-1 ММ^. По данным [6]
Б
довательно, Ku-связывающий сайт, предложенный в [6], не мог полностью объяснить механизм отрицательной регуляции транскрипции. Отмечено также, что Ku80 не влияет на эффективность трансдукции и интеграции лентивирусных векторов. Вместе с тем, Ku-зависимая регуляция не наблюдалась при использовании в качестве матрицы не псевдотипиро-ванного вируса, а плазмидных векторов с теми же промоторами. Предполагается, что Ku80 не прямо влияет на транскрипцию, а направляет интеграцию лентивирусных векторов в транскрипционно неактивные регионы.
В противоположность результатам, приведенным выше, в линиях клеток MAGI и CEM-T4 человека Ku играет положительную роль в регуляции транскрипции с промотора ВИЧ-1 [8]. Более того, введение в клетки siPHK, направленных против Ku80, приводило к снижению эффективности интеграции вирусного генома в ДНК зараженной клетки, а также к нарушению Tat-TAR-трансактивации.
Положительное влияние гетеродимера Ku на транскрипцию генома ВИЧ-1 отмечено и в работе [9], в которой использовали клетки человека линии HCT 116 дикого типа и их вариант Ku80+/~, трансду-цированные лентивирусными векторами на основе ВИЧ-1. Предварительно было показано, что в клетках HCT 116 Ku80+/~, содержание Ku80 в которых снижено в 2 раза, понижен также уровень Ku70. Оказалось, что двукратное снижение уровня эндогенного Ku в клетках приводит к снижению эффективности вирусной транскрипции. Важно отметить, что, в отличие от данных [7], этот эффект был специфичен для вирусного LTR, поскольку изменение уровня гетеродимера Ku не влияло на транскрипцию с других промоторов. Кроме того, оказалось, что в опосредованной Ku регуляции транскрипции не участвуют вирусные белки, и эффект Ku не за-
висит от Tat-трансактивации. Влияние Ku на транскрипцию было заметно и в присутствии Tat, однако более ярко эффект Ku проявлялся при базальном уровне транскрипции с неактивированного провиру-са, когда Tat в клетке не детектируется. Интересно, что Ku влияет на базальную транскрипцию ВИЧ-1 только на начальных сроках после интеграции вирусного генома, и снижение уровня Ku в клетках способствует установлению и поддержанию латентности вируса.
Известно, что Ku80 включается в вирион при его сборке [53]. Следовательно, на транскрипцию про-вируса в зараженной клетке может влиять как эндогенный Ku80, так и Ku80, пришедший из вирио-на, поэтому, чтобы исключить влияние последнего, лентивирус собирали в клеточной линии с пониженным содержанием гетеродимера Ku [9]. Оказалось, что на транскрипцию в клетке-мишени влияет именно эндогенный Ku.
Стоит отметить, что участие предсказанного ранее Ku-связывающего сайта в 5'--LTR ВИЧ-1 в Ku-опосредованной регуляции транскрипции провируса было опровергнуто также в работе [9]. Замена этого сайта на случайную последовательность не влияла на Ku-зависимую регуляцию транскрипции.
Еще один важный момент данной работы — отсутствие влияния Ku на транскрипцию с кольцевых форм вирусной ДНК. Учитывая, что согласно [7], Ku не влиял на транскрипцию с промотора ВИЧ-1 в составе плазмидного вектора, можно сделать вывод, что Ku стимулирует транскрипцию только с прови-руса, интегрированного в геном.
Необходимо отдельно отметить работу [10], в которой изучено возможное участие в регуляции транскрипции ВИЧ-1 не только гетеродимера Ku70/Ku80, а всей ДНК-зависимой протеинкиназы DNA-PK. Эксперименты проводили на клетках ли-
нии Jurkat-E4, ДНК которых несла интегрированный геном ВИЧ-1 и служила моделью лимфоцитов в латентной фазе инфекции. Оказалось, что на промоторе ВИЧ-1 присутствует DNA-PK, причем ее расположение коррелирует с положением РНКП II. Также установлено, что при активации транскрипции значительно повышается количество DNA-PK и РНКП II не только на промоторе, но и в большей степени на транскрибируемой области генома.
Показано также [10], что DNA-PK может фосфо-рилировать С-концевой домен РНКП II. Более того, в экспериментах in vitro установлено, что DNA-PK фосфорилирует преимущественно Ser2, а не Ser5 или Ser7 в гептапептидных повторах YSPTSPS. Учитывая, что именно фосфорилирование Ser2 необходимо для активации элонгации, предположили, что участие DNA-PK может быть важным, в первую очередь, на стадии элонгации транскрипции. Возможно, на промоторе ВИЧ-1 DNA-PK взаимодействует непосредственно с РНКП II, и именно DNA-PK может действовать как фактор, который фос-форилирует полимеразу и снимает элонгационный блок. Так или иначе, параллельное распределение DNA-PK и РНКП II вдоль провируса и их одновременное рекрутирование в ответ на активацию транскрипции позволяют предположить, что DNA-PK (и Ku как ее составная часть) входит в состав большого транскрипционного комплекса, вовлеченного в экспрессию генов ВИЧ-1.
Помимо этого, показано, что DNA-PK положительно влияет на транскрипцию с 5'--LTR ВИЧ-1 и лен-тивирусных векторов [10]. Нокдаун каталитической субъединицы DNA-PK в клетках Jurkat приводит к значительному снижению экспрессии генов, находящихся под контролем LTR, и незначительно влияет на экспрессию с другого промотора (CMV). Таким образом, нокдаун как DNA-PKcs [10], так и Ku80 [9] приводит к снижению уровня транскрипции именно с промотора LTR.
Подводя итог описанию роли белка Ku в регуляции транскрипции ВИЧ-1, необходимо отметить, что полученные к настоящему времени данные достаточно противоречивы. Возможно, это связано с использованием разных клеточных линий и разных вирусных систем. Так, большинство данных о негативной регуляции получены на клетках грызунов, которые, очевидно, не могут служить полноценной моделью процессов, происходящих в клетках человека, инфицированных ВИЧ-1. Тем не менее данные, полученные на клетках человека, позволяют сделать несколько достоверных выводов.
Первое общее наблюдение — зависимость Ku-опосредованной регуляции транскрипции от вирусного LTR. Механизм этой регуляции пока не понятен,
но нельзя исключить возможности прямого связывания гетеродимера и LTR, хотя предполагаемый в работе [6] Ku-связывающий сайт в составе LTR, по-видимому, не является ключевым элементом в Ku-зависимой регуляции транскрипции ВИЧ-1, в отличие от MMTV и HTLV-1.
Во-вторых, для Ku-опосредованной регуляции транскрипции ВИЧ-1 и лентивирусных векторов на его основе важен именно интегрированный про-вирус. Хотя транскрипция ВИЧ-1 может осуществляться и с кольцевых ДНК, очевидно, что Ku не участвует в ее регуляции. Возможно, это объясняется тем, что привлечение гетеродимера к провирусу происходит в процессе интеграции или непосредственно после нее.
Отметим еще раз, что остается много вопросов о механизме участия Ku в регуляции транскрипции ВИЧ-1. Так или иначе, даже если считать включение гетеродимера Ku70/Ku80 или целой DNA-PK в состав транскрипционного комплекса установленным фактом, способ их влияния на экспрессию генов ВИЧ-1 не выяснен, и выяснение их роли в транскрипции ВИЧ-1 остается важным и актуальным.
РОЛЬ HMGA1 В ТРАНСКРИПЦИИ ВИЧ-1
Еще один клеточный белок, роль которого в жизненном цикле ВИЧ-1 мало изучена, — это HMGA1 (high mobility group protein A1, прежнее название — HMG I[Y]), ДНК-связывающий белок хроматина негистоновой природы. HMGA1 имеет три ДНК-связывающих мотива, которые предпочтительно связываются с малой бороздкой ДНК в AT-богатых участках (A/T hook) [61]. Вместе с тем, HMGA1 скорее распознает пространственную структуру ДНК, нежели нуклеотидную последовательность: он предпочтительнее взаимодействует с изогнутыми и су-перскрученными ДНК, с ДНК, структура которых отличается от классической В-формы. Этот белок в свободном состоянии имеет неупорядоченную пространственную структуру. При взаимодействии с ДНК он претерпевает конформационные изменения, способствуя АТР-независимому расплетанию, суперскручиванию и изгибанию ДНК [62, 63]. Эта способность изменять структуру хроматина определяет широкий спектр функций, выполняемых HMGA1 в ядре клетки.
Вообще, все белки, входящие в семейство группы с высокой подвижностью («high mobility group»), обладают способностью хорошо связывать как ДНК, так и белки, что позволяет им участвовать в большом количестве процессов [64]. Изменение структуры хроматина, вызываемое связыванием HMGA, стимулирует или подавляет такие ДНК-зависимые процессы, как транскрипция, репликация, репара-
А
JMLjJJffil
РНКП II
А
ТФ ТФ& lt-
Рис. 6. Возможная модель опосредованной HMGAI-активации транскрипции. Предположительный механизм регуляции транскрипции HMGA1: HMGA1 способствует реорганизации хроматина, открывая сайты ДНК для посадки факторов, запускающих транскрипцию. А — HMGA1 конкурирует с гистоном H1, вытесняя его с ДНК. Б -декомпактизация хроматина с помощью хроматинремоделирующих комплексов (CRC — chromatin remodeling complexes). Связывание CRC с хроматином повышается при его взаимодействии с HMGA1. В — высвобождение ДНК для связывания с транскрипционными факторами. Г — инициация транскрипции: HMGA1 может взаимодействовать с транскрипционными факторами (ТФ), привлекая их к промотору. По данным [62]
Б
В
ция. НМ^А1 считается архитектурным фактором транскрипции, что подчеркивает его значение в организации мультибелковых комплексов, собирающихся на промоторе [62−64]. Способность НМ^А1 взаимодействовать с коровыми гистонами и вытеснять с ДНК линкерный гистон Н1 приводит к реорганизации хроматина и открытию сайтов посадки транскрипционных факторов (рис. 6). НМ^А1 играет важную роль в регуляции сборки или разборки энханосомы, тем самым влияя на транскрипцию. Неоднократно показано прямое взаимодействие НМ^А1 с другими хроматинремоделирующими белками и факторами транскрипциир1, TFIID, ОТ-кВ, ATF-2, SRF, Ой2, с^е1). [62, 63]. Способность НМ^А1 изгибать ДНК при связывании, возможно, облегчает пространственное сближение энхансерного и промоторного участков генов.
Участие НМ^А1 в жизненном цикле ВИЧ-1 показано неоднократно. Этот белок обнаружен в составе предынтеграционного комплекса [65]. Установлено, что НМ^А1 стимулирует интеграцию ДНК ВИЧ-1 в клеточный геном [66, 67]. Предполагается, что НМ^А1 связывает и изгибает вирусную ДНК, что приводит к сближению ее концов и способству-
ет их связыванию с интегразой. При этом не наблюдали прямого взаимодействия НМ^А1 и интегразы ВИЧ-1. Однако в других работах оспаривается участие НМ^А1 в интеграции ретровируса, поскольку отсутствие НМ^А1 в инфицированных клетках не влияло на встраивание вирусного генома [68].
К настоящему времени получены некоторые, также неоднозначные, свидетельства в пользу участия НМ^А1 в транскрипции ВИЧ-1.
С помощью футпринтинга ДНКазой I в области -187/+230 в составе 5'--LTR ВИЧ-1 обнаружены возможные сайты связывания HMGA1 (R1-R5 на рис. 7) [69]. Изучено также взаимодействие HMGA1 и фактора транскрипции АР-1, которые, как оказалось, имеют общий сайт связывания5 на рис. 7). Этот сайт находится на границе репрессирующей нукле-осомы пис-1, которая существует на провирусе рядом с местом старта транскрипции в латентной фазе и разрушается при активации транскрипции вирусного генома (рис. 7). Оказалось, что HMGA1 способствует связыванию АР-1, важного индуцируемого активатора транскрипции ВИЧ-1, с вирусной ДНК в ответ на внешние стимулы, активирующие экспрессию вируса. Вероятно, HMGA1 участвует в ре-
5'--LTR
Модуляторный регион
из
Энхансер
К
U5
455 552 634
Промотор Лидерный регион
Рис. 7. Положение предсказанных сайтов связывания HMGA1 на 5'--LTR ВИЧ-1. Указано положение районов 5'--LTR: и3 (нуклеотиды 1−455), R (456−552), и5 (553−634). Отсчет нуклеотидов от начала генома. Показаны основные регуляторные регионы 5'--LTR. +1 — отсчет от старта транскрипции, указанного стрелкой. Показаны сайты связывания HMGA1, определенные в [69]. Снизу показано положение нуклеосом на промоторе ВИЧ-1, отмечены три сайта связывания с транскрипционным фактором АР-1
организации nuc-1, конкурируя за этот сайт и тем самым освобождая его для AP-1. Таким образом, предполагается, что HMGA1 может быть положительным регулятором транскрипции ВИЧ-1 [69].
Подтверждена роль HMGA1 как архитектурного фактора транскрипции, участвующего в реорганизации нуклеосомы nuc-1 [70]. Оказалось, что в ответ на индукцию вирусной транскрипции с помощью PMA (phorbol myristate acetate — активатор NF-kB) HMGA1 способствует связыванию субъединицы ATF-3 фактора AP-1 с сайтом R3 на границе nuc-1 (рис. 7). Это позволяет привлечь к репрессирующей нуклеосоме АТР-зависимый хроматинремоделирую-щий комплекс SWI/SNF, что необходимо для эффективной активации вирусной транскрипции.
Недавно был предложен еще один возможный способ участия HMGA1 в регуляции транскрипции [71]. Оказалось, что HMGA1 связывается с РНК-петлей L2 в 7SK мяРНП. Как отмечалось выше, главная функция 7SK РНК — регуляция количества свободного фактора P-TEFb, активирующего элонгацию транскрипции [17]. Этот фактор взаимодействует с петлей L1 и белком HEXIM1 в составе 7SK мяРНП. В результате может образоваться сложный комплекс HMGA1 с 7SK мяРНП и P-TEFb. Роль этого комплекса в регуляции транскрипции может быть двоякой
(рис. 8) [72]. Во-первых, НМ^А1 может связываться непосредственно с ДНК или каким-либо транскрипционным фактором на промоторе и привлекать P-TEFb к приостановленному элонгационному комплексу РНКП II (рис. 8А). Во-вторых, связывание 7SK с НМ^А1 регулирует количество свободного НМ^А1, способного взаимодействовать с ДНК и выполнять свои функции в разных процессах (рис. 8Б). Предполагается, что реализуемый механизм зависит от конкретного гена.
В случае регуляции транскрипции ВИЧ-1 фактором, взаимодействующим с НМ^А1 и привлекаемым за счет этого к элонгационному комплексу, может быть Sp1. Известно, что этот фактор, с одной стороны, участвует в транскрипции ВИЧ-1 [1, 13], а с другой, взаимодействует непосредственно с НМ^А1 [62]. Таким образом, при транскрипции с 5'--LTR ВИЧ-1 НМ^А1 может участвовать в P-TEFb-зависимой активации элонгации по схеме, приведенной на рис. 8А [72], и, следовательно, проявлять стимулирующий эффект.
Еще один механизм влияния НМ^А1 на транскрипцию ВИЧ-1 был найден при изучении экспрессии репортерного белка с плазмиды, в которой его ген контролировался вирусным 5'--LTR [4]. В этом случае оказалось, что НМ^А1 обладает репрессирующим
Рис. 8. Механизм регуляции транскрипции комплексом HMGA1−7SK-P-TEFb. А — HMGA1 за счет взаимодействия с ДНК или с некоторым транскрипционным фактором может привлекать P-TEFb в комплексе с 7SK мяРНП к приостановленному транскрипционному комплексу. Б — количество свободного HMGA1 в ядре регулируется его связыванием с 7SK мяРНП. Диссоциации HMGA1 из комплекса с 7SK мяРНП возможна под действием пока не идентифицированного фактора. По данным [4, 72]
действием. Детальное исследование механизма действия HMGA1 показало, что HMGA1 способен связываться с TAR РНК, структура концевого участка которой похожа на структуру петли L2 в 7SK РНК в составе мяРНП (рис. 9), причем HMGA1 может конкурировать с вирусным белком Tat за связывание с TAR РНК. Это обуславливает отрицательное влияние HMGA1 на транскрипцию ВИЧ-1 как в при-
сутствии Tat, так и в его отсутствие. Изучено влияние сверхэкспрессии и нокдауна гена HMGA1 и петли L2 из 7SK РНК на транскрипцию с промотора ВИЧ-1 в присутствии и в отсутствие Tat. Оказалось, что HMGA1 снижает и базальную, и активированную Tat транскрипцию с промотора ВИЧ-1, которая частично восстанавливается при сверхэкспрессии петли L2. На основании этого эксперимента предложена
модель репрессии, опосредованной HMGA1 (рис. 10) [4]. Согласно этой модели, HMGA1 мешает связыванию TAR РНК с Tat, а при отсутствии Tat с неким, пока не описанным, клеточным кофактором вирусной транскрипции. Петля L2 в 7SK РНК конкурирует с TAR за HMGA1, разрушая их комплекс и забирая белок с промотора ВИЧ-1. Это способствует активации транскрипции. Однако вопрос о существовании и природе клеточного кофактора, участвующего в этом процессе, остается открытым.
Предложена и другая модель репрессирующего действия HMGA1 на транскрипцию с промотора ВИЧ-1 [5]. В регуляции транскрипции ВИЧ-1 важное место занимают факторы, связанные с реорганизацией хроматина и среди них такой белок, как CTIP2. Присутствие CTIP2 на промоторе приводит к репрессии транскрипции интегрированного генома ВИЧ-1 и характерно для латентного состояния вируса. CTIP2 осуществляет привлечение гистон-деацети-лаз и гистон-метилтрансфераз и участвует таким
образом в конденсации хроматина [73]. Кроме этого, CTIP2 взаимодействует с факторами Sp1 и COUP-TF, репрессируя начальные стадии транскрипции ВИЧ-1 [74], а также участвует в делокализации
Рис. 9. Структуры участков 7SK-L2 и TAR РНК, взаимодействующие с HMGA1. Зеленым выделен сайт связывания HMGA1 в обеих РНК. Серым цветом показан участок TAR, ответственный за взаимодействие с Tat и CycTI. По данным [4]
G G U С С-G G-С

С-G
С-Ga и-А С I С-G С-G U-А G-С 5'- 3'-
G А
G G U G С А
С-G G-С A-U
iM
С
UA-i G-С A-U С-G С-G, А I G-С 5'- 3'-
7SK-L2
TAR ВИЧ-1
Рис. 10. Модель HMGAI-опосредованной репрессии транскрипции ВИЧ-1. А — конкуренция HMGA1 с Tat за TAR приводит к снижению активности вирусного промотора. Tat высвобождает 7SK из связанного на промоторе комплекса с P-TEFb. 7SK связывается с HMGA1, освобождая TAR для взаимодействия с Tat-P-TEFb. Б — в отсутствие Tat HMGA1 препятствует связыванию с TAR РНК некоторого клеточного кофактора, необходимого для TAR-опосредованной транскрипции ВИЧ-1. 7SK связывается с HMGA1, освобождая TAR для взаимодействия с этим кофактором. По данным [4]
ч & lt-Р
Рис. 11. Модель кооперативной регуляции транскрипции HMGA1 и СТ1Р2. СТ1Р2-репрессированный 7SK/P-TEFb-комплекс привлекается к промотору через взаимодействие с HMGA1, связанным с L2-петлей 7SK, с ДНК либо с транскрипционным фактором, находящимся на промоторе. По данным [5]
Tat и связывании его с белком HP1, ассоциированным с гетерохроматином [75]. Недавно показали, что CTIP2 взаимодействует с 7SK мяРНП, связываясь с петлей L2 и белком HEXIM1. В составе этого комплекса CTIP2 участвует в репрессии киназы Cdk9, входящей в состав P-TEFb [76]. Установлено, что HMGA1 может связываться с CTIP2 [5]. Более того, транскрипция ряда клеточных генов негативно регулируется обоими белками, при этом часть генов транскрибируется по P-TEFb^SK-зависимому механизму [5]. Предложена модель совместной регуляции транскрипции этих генов белками HMGA1 и CTIP2. Предполагается, что HMGA1 может привлекать к промоторам регулируемых генов сам CTIP2 или комплекс CTIP2/P-TEFb/7SK мяРНП (рис. 11) [5].
Показано, что HMGA1 и CTIP2, взаимодействуя с промотором ВИЧ-1, синергически репрессируют базальную транскрипцию [5]. Нокдаун гена HMGA1 приводит к значительному снижению количества CTIP2 и P-TEFb/7SK мяРНП, привлеченного на вирусный промотор, и, таким образом, восстанавливает уровень транскрипции с него. Таким образом, предполагается, что на 5'--LTR запускается механизм опосредованной HMGA1 отрицательной регуляции транскрипции, подобный приведенному на рис. 11. Тем не менее в случае ВИЧ-1 остается непонятным, какой участок ДНК или фактор, связанный c LTR, участвует в привлечении комплекса HMGA1/ CTIP2/7SK мяРНП. Не ясна и роль связывания TAR
и HMGA1 в опосредованной HMGA1/CTIP2 репрессии базальной транскрипции. Не изучено также, влияет ли HMGA1 непосредственно на связывание CTIP2 с вирусной ДНК, как в случае с активатором транскрипции AP-1 [69].
Таким образом, HMGA1 может служить как активатором, так и репрессором транскрипции ВИЧ-1. При этом показано его положительное действие на индуцируемую транскрипцию, в то время как отрицательное — на базальную. Возможно, действие внешних индукторов запускает смену белков-партнеров HMGA1 и последующее изменение пути HMGA1-опосредованной регуляции транскрипции.
ЗАКЛЮЧЕНИЕ
Несмотря на активное изучение особенностей транскрипции ВИЧ-1, многие моменты остаются не до конца понятными. Хорошо известно, что элонгация транскрипции вирусного генома происходит после связывания TAR РНК с вирусным регуляторным белком Tat, который, взаимодействуя с мультибел-ковым фактором элонгации транскрипции P-TEFb, привлекает его на вирусный промотор. Входящая в состав P-TEFb циклинзависимая киназа Cdk9 осуществляет необходимое для элонгации фосфорили-рование РНКП II. Однако возникает вопрос, каким образом активируется транскрипция «спящего» интегрированного вируса, когда в клетке отсутствует белок Tat? Тем не менее провирус способен транскрибироваться на базальном уровне. Предполагается,
что в таких случаях фосфорилирование РНКП II, необходимое для снятия транскрипционного блока и перехода в стадию элонгации, может активироваться с помощью клеточных факторов. Возможно также, что какие-то клеточные факторы привлекают P-TEFb на промотор.
Регуляция транскрипции ВИЧ-1 — процесс, в котором участвует множество клеточных белков, однако роль не всех из них полностью понятна. К числу таких «непонятых» факторов относятся два клеточных белка — Ки и НМ^А1, описанные в настоящем обзоре. Получены данные и о стимулирующем, и о репрессирующем влиянии обоих белков на экспрессию генов ВИЧ-1. Зачастую их роль особенно заметна при базальной транскрипции.
Большая часть исследований, выполненных на клетках человека, показывает, что гетеродимер Ки активирует транскрипцию с промотора ВИЧ-1. В ряде работ описана важность каталитической субъединицы DNA-PK для активации транскрипции. Предложена гипотеза об участии DNA-PK на стадии элонгации транскрипции [10]. Отметим, что способность DNA-PK фосфорилировать РНКП II делает эту киназу привлекательным кандидатом на роль белкового фактора, активирующего элон-
гацию транскрипции вирусных генов в отсутствие Tat.
В процессе регуляции транскрипции ВИЧ-1 архитектурный фактор HMGA1 может воздействовать на состояние хроматина. В этом случае наблюдается положительное действие HMGA1. С другой стороны, показанное in vitro взаимодействие HMGA1 и TAR, по-видимому, приводит к подавлению базальной транскрипции генов ВИЧ-1 и важно для поддержания латентности [4]. Еще одним способом HMGA1-опосредованного подавления транскрипции может быть привлечение к промотору репрессирующего транскрипционного фактора, входящего в состав 7SK мяРНП, с которым способен связываться HMGA1. Возможно, не существует единого механизма участия HMGA1 в регуляции транскрипции генов ВИЧ-1, а функция этого белка зависит от фазы инфекции и активности других клеточных белков. Так или иначе, выяснение механизмов влияния Ku и HMGA1 на транскрипцию ВИЧ-1 может привести к созданию новых путей воздействия на репликацию этого опасного вируса. *
Работа поддержана Российским научным фондом (грант № 14−24−61).
СПИСОК ЛИТЕРАТУРЫ
1. van Lint C., Bouchat S., Marcello A. // Retrovirology. 2013. V. 10. P. 67.
2. Ruelas D.S., Greene W.C. // Cell. 2013. V. 155. № 3. P. 519−529.
3. Zhou M., Halanski M.A., Radonovich M.F., Kashanchi F., Peng J., Price D.H., Brady J.N. // Mol. Cell. Biol. 2000. V. 20. № 14.
P. 5077−5086.
4. Eilebrecht S., Wilhelm E., Benecke B. -J., Bell B., Benecke A.G. // RNA Biol. 2013. V. 10. № 3. P. 436−444.
5. Eilebrecht S., Le Douce V., Riclet R., Targat B., Hallay H., van Driessche B., Schwartz C., Robette G., van Lint C., Rohr O., et al. // Nucl. Acids Res. 2014. V. 42. № 8. P. 4962−4971.
6. Jeanson L., Mouscadet J.F. // J. Biol. Chem. 2002. V. 277. № 7. P. 4918−4924.
7. Masson C., Bury-Mone S., Guiot E., Saez-Cirion A., Scho8va8rt-Brossault D., Brachet-Ducos C., Delelis O., Subra F., Jeanson-Leh L., Mouscadet J.F. // J. Virol. 2007. V. 81. № 15. P. 7924−7932.
8. Waninger S., Kuhen K., Hu X., Chatterton J.E., Wong-Staal F., Tang H. // J. Virol. 2004. V. 78. № 23. P. 12 829−12 837.
9. Manic G., Maurin-Marlin A., Laurent F., Vitale I., Thierry S., Delelis O., Dessen P., Vincendeau M., Leib-Mosch C., Hazan U., et al. // PLoS One. 2013. V. 8. № 7. P. 69 691.
10. Tyagi S., Ochem A., Tyagi M. // J. Gen. Virol. 2011. V. 92. № 7. P. 1710−1720.
11. Meyerhans A., Breinig T., Vartanian J. -P., Wain-Hobson S. HIV Sequence Compendium 2003. Los Alamos National Laboratory: Theoretical Biology and Biophysics Group, 2003. 420 р.
12. Sloan R.D., Wainberg M.A. // Retrovirology. 2011. V. 8. P. 52.
13. Colin L., Verdin E., van Lint C. // Meth. Mol. Biol. 2014. V. 1087. P. 85−101.
14. Taube R., Peterlin M. // Viruses. 2013. V. 5. № 3. P. 902−927.
15. Kwak H., Lis J.T. // Annu. Rev. Genet. 2013. V. 47. P. 483−508.
16. Nguyen V.T., Kiss T., Michels A.A., Bensaude O. // Nature. 2001. V. 414. № 6861. P. 322−325.
17. Peterlin B.M., Price D.H. // Mol. Cell. 2006. V. 23. № 3. P. 297−305.
18. Emiliani S., van Lint C., Fischle W., Paras P. Jr., Ott M., Brady J., Verdin E. // Proc. Natl. Acad. Sci. USA. 1996. V. 93. № 13. P. 6377−6381.
19. Bieniasz P.D., Grdina T.A., Bogerd H.P., Cullen B.R. // Proc. Natl. Acad. Sci. USA. 1999. V. 96. № 14. P. 7791−7796.
20. Yedavalli V.S., Benkirane M., Jeang K.T. // J. Biol. Chem. 2003. V. 278. № 8. P. 6404−6410.
21. Itzen F., Greifenberg A.K., Bosken C.A., Geyer M. // Nucl. Acids Res. 2014. V. 42. № 12. P. 7577−7590.
22. Patel M.C., Debrosse M., Smith M., Dey A., Huynh W., Sarai N., Heightman T.D., Tamura T., Ozato K. // Mol. Cell. Biol. 2013. V. 33. № 12. P. 2497−2507.
23. Jin S., Weaver D.T. // EMBO J. 1997. V. 16. № 22. P. 6874−6885.
24. Ochem A.E., Skopac D., Costa M., Rabilloud T., Vuillard L., Simoncsits A., Giacca M., Falaschi A. // J. Biol. Chem. 1997. V. 272. № 47. P. 29 919−29 926.
25. Dynan W.S., Yoo S. // Nucl. Acids Res. 1998. V. 26. № 7. P. 1551−1559.
26. Walker J.R., Corpina R.A., Goldberg J. // Nature. 2001. V. 412. № 6847. P. 607−614.
27. Postow L. // FEBS Lett. 2011. V. 585. № 18. P. 2876−2882.
28. Hill R., Lee P.W. // Cell Cycle. 2010. V. 9. № 17. P. 3460−3469.
29. Fell V.L., Schild-Poulter C. // Mutat. Res. Rev. Mutat. Res. 2015. V. 763. P. 15−29.
30. Yang S.H., Nussenzweig A., Li L., Kim D., Ouyang H., Burgman P., Li G.C. // Mol. Cell. Biol. 1996. V. 16. № 7. P. 37 993 806.
31. Knuth M.W., Gunderson S.I., Thompson N.E., Strasheim L.A., Burgess R.R. // J. Biol. Chem. 1990. V. 265. № 29. P. 1 791 117 920.
32. Okumura K., Takagi S., Sakaguchi G., Naito K., Minoura-Tada N., Kobayashi H., Mimori T., Hinuma Y., Igarashi H. // FEBS Lett. 1994. V. 356. № 1. P. 94−100.
33. Giffin W., Torrance H., Rodda D.J., Prefontaine G.G., Pope L., Hache R.J. // Nature. 1996. V. 380. № 6571. P. 265−268.
34. Giffin W., Kwast-Welfeld J, Rodda D.J., Prefontaine G.G., Traykova-Andonova M., Zhang Y., Weigel N.L., Lefebvre Y.A., Hache R.J. // J. Biol. Chem. 1997. V. 272. № 9. P. 5647−5658.
35. Giffin W., Gong W., Schild-Poulter C., Hache R.J. // Mol. Cell. Biol. 1999. V. 19. № 6. P. 4065−4078.
36. Shi L., Qiu D., Zhao G., Corthesy B., Lees-Miller S., Reeves W.H., Kao P.N. // Nucl. Acids Res. 2007. V. 35. № 7. P. 2302−2310.
37. Schild-Poulter C., Shih A., Yarymowich N.C., Hache R.J. // Cancer Res. 2003. V. 63. № 21. P. 7197−7205.
38. Jiang D., Zhou Y., Moxley R.A., Jarrett H.W. // Biochemistry. 2008. V. 47. № 35. P. 9318−9334.
39. Wang H., Fang R., Cho J.Y., Libermann T.A., Oettgen P. // J. Biol. Chem. 2004. V. 279. № 24. P. 25 241−25 250.
40. Sucharov C.C., Helmke S.M., Langer S.J., Perryman M.B., Bristow M., Leinwand L. // Mol. Cell. Biol. 2004. V. 24. № 19. P. 8705−8715.
41. Hill R., Madureira P.A., Waisman D.M., Lee P.W. // Oncotarget. 2011. V. 2. № 12. P. 1094−1108.
42. Mayeur G.L., Kung W.J., Martinez A., Izumiya C., Chen D.J., Kung H.J. // J. Biol. Chem. 2005. V. 280. № 11. P. 10 827−10 833.
43. Sartorius C.A., Takimoto G.S., Richer J.K., Tung L., Horwitz K.B. // J. Mol. Endocrinol. 2000. V. 24. № 2. P. 165−182.
44. Medunjanin S., Weinert S., Schmeisser A., Mayer D., Braun-Dullaeus R.C. // Mol. Biol. Cell. 2010. V. 21. № 9. P. 1620−1628.
45. Lim J.W., Kim H., Kim K.H. // J. Biol. Chem. 2004. V. 279. № 1. P. 231−237.
46. Dvir A., Stein L.Y., Calore B.L., Dynan W. S // J. Biol. Chem. 1993. V. 268. № 14. P. 10 440−10 447.
47. Maldonado E., Shiekhattar R., Sheldon M., Cho H., Drapkin R., Rickert P., Lees E., Anderson C.W., Linn S., Reinberg D. // Nature. 1996. V. 381. № 6577. P. 86−89.
48. Mo X., Dynan W.S. // Mol. Cell. Biol. 2002. V. 22. № 22. P. 8088−8099.
49. Peterson S.R., Dvir A., Anderson C.W., Dynan W.S. // Genes Dev. 1992. V. 6. № 3. P. 426−438.
50. Ju B.G., Lunyak V.V., Perissi V., Garcia-Bassets I., Rose D.W., Glass C.K., Rosenfeld M.G. // Science. 2006. V. 312. № 5781.
P. 1798−1802.
51. Studamire B., Goff S.P. // Retrovirology. 2008. V. 5. P. 48.
52. Zheng Y., Ao Z., Wang B., Jayappa K.D., Yao X. // J. Biol. Chem. 2011. V. 286. № 20. P. 17 722−17 735.
53. Santos S., Obukhov Y., Nekhai S., Bukrinsky M., Iordanskiy S. // Retrovirology. 2012. V. 9. P. 65.
54. Skalka A.M., Katz R.A. // Cell Death Differ. 2005. V. 12. P. 971−978.
55. Daniel R., Greger J.G., Katz R.A., Taganov K.D., Wu X., Kappes J.C., Skalka A.M. // J. Virol. 2004. V. 78. № 16. P. 8573−8581.
56. Daniel R., Katz R.A., Merkel G., Hittle J.C., Yen T.J., Skalka A.M. // Mol. Cell. Biol. 2001. V. 21. № 4. P. 1164−1172.
57. Jeanson L., Subra F., Vaganay S., Hervy M., Marangoni
E., Bourhis J., Mouscadet J.F. // Virology. 2002. V. 300. № 1. P. 100−108.
58. Li L., Olvera J.M., Yoder K.E., Mitchell R.S., Butler S.L., Lieber M., Martin S.L., Bushman F.D. // EMBO J. 2001. V. 20. № 12. P. 3272−3281.
59. Kilzer J.M., Stracker T., Beitzel B., Meek K., Weitzman M., Bushman F.D. // Virology. 2003. V. 314. № 1. P. 460−467.
60. Hoover T., Mikovits J., Court D., Liu Y.L., Kung H. F., Raziuddin // Nucl. Acids Res. 1996. V. 24. № 10. P. 1895−1900.
61. Reeves R., Nissen M.S. // J. Biol. Chem. 1990. V. 265. № 15. P. 8573−8582.
62. Ozturk N., Singh I., Mehta A., Braun T., Barreto G. // Front. Cell. Dev. Biol. 2014. V. 2. P. 5.
63. Reeves R. // Meth. Enzymol. 2004. V. 375. P. 297−322.
64. Cleynen I., van de Ven W.J. // Int. J. Oncol. 2008. V. 32. № 2. P. 289−305.
65. Farnet C.M., Bushman F.D. // Cell. 1997. V. 88. № 4. P. 483 492.
66. Hindmarsh P., Ridky T., Reeves R., Andrake M., Skalka
A.M., Leis J. // J. Virol. 1999. V. 73. № 4. P. 2994−3003.
67. Li L., Yoder K., Hansen M.S., Olvera J., Miller M.D., Bushman
F.D. // J. Virol. 2000. V. 74. № 23. P. 10 965−10 974.
68. Beitzel B., Bushman F. // Nucl. Acids Res. 2003. V. 31. № 17. P. 5025−5032.
69. Henderson A., Bunce M., Siddon N., Reeves R., Tremethick D.J. // J. Virol. 2000. V. 74. № 22. P. 10 523−10 534.
70. Henderson A., Holloway A., Reeves R., Tremethick D.J. // Mol. Cell. Biol. 2004. V. 24. № 1. P. 389−397.
71. Eilebrecht S., Brysbaert G., Wegert T., Urlaub H., Benecke
B. -J., Benecke A. // Nucl. Acids Res. 2011. V. 39. № 6. P. 20 572 072.
72. Eilebrecht S., Benecke B.J., Benecke A. // RNA Biol. 2011. V. 8. № 6. 1084−1093.
73. Marban C., Suzanne S., Dequiedt F., de Walque S., Redel L., van Lint C., Aunis D., Rohr O. // EMBO J. 2007. V. 26. № 2. P. 412−423.
74. Marban C., Redel L., Suzanne S., van Lint C., Lecestre D., Chasserot-Golaz S., Leid M., Aunis D., Schaeffer E., Rohr O. // Nucl. Acids Res. 2005. V. 33. № 7. P. 2318−2331.
75. Rohr O., Lecestre D., Chasserot-Golaz S., Marban C., Avram D., Aunis D., Leid M., Schaeffer E. // J. Virol. 2003. V. 77. № 9. P. 5415−5427.
76. Cherrier T., Le Douce V., Eilebrecht S., Riclet R., Marban C., Dequiedt F., Goumon Y., Paillart J.C., Mericskay M., Parlakian A., et al. // Proc. Natl. Acad. Sci. USA. 2013. V. 110. № 31.
P. 12 655−12 660.

ПоказатьСвернуть
Заполнить форму текущей работой