Экспериментальные исследования в биологии и медицине

Тип работы:
Реферат
Предмет:
Медицина


Узнать стоимость

Детальная информация о работе

Выдержка из работы

ЭКСПЕРИМЕНТАЛЬНЫЕ ИССЛЕДОВАНИЯ В БИОЛОГИИ И МЕДИЦИНЕ
УДК 616. 992. 282
Е. В. Бухарова, С. М. Попкова, Е. Б. Ракова, Ю. П. Джиоев, Е. И. Иванова, Н. М. Шабанова,
У.М. Немченко
ДЕТЕКЦИЯ НЕКОТОРЫХ ГЕНЕТИЧЕСКИХ МАРКЕРОВ ФАКТОРОВ ПАТОГЕННОСТИ В АУТОШТАММАХ KLEBSIELLA SPP. У ДЕТЕЙ ПЕРВОГО ГОДА ЖИЗНИ
ФГБУ «Научный центр проблем здоровья семьи и репродукции человека» СО РАМН (Иркутск)
В работе представлены результаты детекции генетических детерминант патогенности в 44 штаммах клебсиелл (Klebsiella pneumoniae, Klebsiella oxytoca), выделенных из кишечного биотопа детей первого года жизни с дисбиозом кишечника. В аутоштаммах клебсиелл обоих видов наличие гена uge регистрировалось в 92% случаев в K. oxytoca и в 90% случаев — в K. pneumoniae. Ген kfu выявлялся в штаммах K. pneumoniae в 2 раза чаще (30%), чем в K. oxytoca (12,5%). Ген bfp обнаруживался в K. oxytoca в 5 раз чаще (25%), чем в K. pneumoniae (5%), так же, как и stx 1, — 29,2% и 15% случаев соответственно. Наличие гена stx 2 не было зарегистрировано ни в одном из образцов ДНК. Регистрация исследованных детерминант в ДНК аутоштаммов Klebsiella spp., не относящихся к клиническим изолятам, свидетельствует о циркуляции среди них факторов патогенности и, следовательно, о риске формирования дисбиоза кишечника у детей. Ключевые слова: Klebsiella spp., кишечная микробиота, гены патогенности, ПЦР
DETECTION OF CERTAIN GENETIC MARKERS OF THE PATHOGENIC FACTORS IN AUTOSTRAINS KLEBSIELLA SPP. IN INFANTS
E.V. Bukharova, S.M. Popkova, E.B. Rakova, Yu.P. Dzhioev, E.I. Ivanova, N.M. Shabanova,
U.M. Nemchenko Scientific Center of Family Health and Human Reproduction Problems SB RAMS, Irkutsk
The article presents the results of detection of genetic determinants of pathogenicity in 44 strains of Klebsiella (Klebsiella pneumoniae, Klebsiella oxytoca), isolated from the intestinal habitat of infants with intestinal dysbiosis. The presence of the uge gene was detected in 92% of cases in K. oxytoca and in 90% of K. pneumoniae. Kfu gene was detected twice as frequent (30%) in K. pneumoniae strains than in K. oxytoca (12,5%) — bfp gene was detected in K. oxytoca 5 times more frequently (25%) than in K. pneumoniae (5%), as well as stx 1 — 29,2% and 15%, correspondingly. The presence of stx 2 gene wasn'-t recorded in any of the DNA samples. Registration of investigated determinants in dNa of Klebsiella spp. autostrains which are non-clinical isolates indicates pathogenicity factors circulation among them and therefore the risk of the formation of intestinal dysbiosis in children.
Key words: Klebsiella spp., intestinal microbiota, pathogenicity genes, PCR
Спектр заболеваний, вызываемых клебсиеллами, чрезвычайно широк, но наиболее опасным проявлением клебсиеллеза являются внутригоспитальные инфекции новорожденных в родовспомогательных учреждениях [3, 5]. У грудных детей микробиоценоз кишечника характеризуется неустойчивостью, связанной с микробной сукцессией при формировании микробиоты, особенностями иммунной системы, неадекватным иммунным ответом организма на заселение кишечника условно-патогенными микроорганизмами. Обладая выраженной биологической и экологической пластичностью, Kiebsiella способна к длительному персистированию в организме человека и может явиться причиной микроэколо-гических нарушений в кишечной микробиоте [7,
15, 16]. Клебсиеллезы характеризуются тяжелым течением, высокой летальностью и многообразием клинических проявлений [2]. Kiebsiella spp. обладают различными факторами патогенности [1, 2, 3, 4, 5, 6,
8]. Однако информация о них до сих пор неполная, и малоизученными остаются вопросы, связанные с распространенностью генетических маркеров факторов патогенности клебсиелл. Особую актуальность данная проблема приобретает в связи с высокой мобильностью нуклеотидных последовательностей, детерминирующих факторы патогенности, что позволяет им распространяться среди близкородственных бактерий. Именно интеграция, стабилизация и экспрессия генов вирулентности лежат в основе формирования новых свойств, в том числе патогенных [11].
В данном исследовании были изучены штаммы клебсиелл двух видов (Klebsiella pneumoniae, Klebsiella oxytoca) на присутствие нуклеотидных последовательностей генов mag A, uge, kfu, bfp, stx 1, stx 2. Хромосомный ген mag A является частью капсульного полисахарида кластера генов серотипа K1. Этот ген кодирует структурный белок наружной мембраны, необходимый для производства экзополисахарида,
и связан с продукцией слизи повышенной вязкости [13]. Экзополисахарид обеспечивает защиту бактериальной клетки от высыхания и от факторов иммунитета, а также способствует процессу адгезии. Ген uge кодирует уридин-дифосфат-галактозо-4-эпимеразу и играет существенную роль в формировании вирулентности микроба. Ген картирован на хромосоме 1р36-р35 [17]. Ген kfu кодирует систему поглощения железа сидерофорами, белками? связывающими ионы двухвалентного железа для дальнейшего транспорта через наружную мембрану клеточной стенки внутрь клетки, и снижают их содержание в тканях, что способствуют микроорганизму в конкурентной борьбе за субстрат (железо) с хозяином [13]. Присутствие гена, кодирующего формирование связывания пилей (bfp) между бактериями, приводит к образованию бактериальных агрегаций. Ген отвечает за инициацию адгезии бактериальной клетки с клеткой хозяина (эпителиоциты кишечника) и колонизацию эпителия слизистой толстой кишки человека. Продукты экспрессии гена были найдены на поверхности энтеропатогенных кишечных палочек (EPEC). Он играет важную роль в обеспечении вирулентных свойств штаммов типичных EPEC. Шигатоксин-про-дуцирующие микроорганизмы (stx 1, stx2) являются важными пищевыми патогенами, ответственными за ряд болезней — от легкой диареи до тяжелых осложнений (заболеваний почек и центральной нервной системы) [9, 12, 14].
Ввиду того, что кишечник является резервуаром клебсиелл, а спектр изученных факторов патогенности остается узким, актуальной является проблема поиска патогенных свойств у штаммов, вегетирующих в кишечнике в качестве одного из членов нормального микробного сообщества. В свете достижений современной молекулярной биологии и генетики, которые привели к возникновению новых методов изучения генома и диагностики инфекционных заболеваний, представляет интерес использование этих методов для исследования факторов патогенности клебсиелл.
Цель работы: оценить патогенный потенциал аутоштаммов Klebsiella spp., изолированных от детей первого года жизни с дисбиозами кишечника посредством детекции генетических детерминант патогенности.
материалы и методы
Исследованы копрологические пробы 44 детей первого года жизни, у которых на основании микробиологических критериев был установлен дисбиоз кишечника с индикацией клебсиелл в диагностически значимых концентрациях (& gt- 104 КОЕ/г) [10]. Бактериологическое исследование содержимого толстой кишки производили, согласно Отраслевому стандарту ОСТ 91 500. 11. 0004−2003 [10] и в соответствии с утвержденными методическими рекомендациями. Выделенные микроорганизмы идентифицировали общепринятыми методами [2].
Для выделения ДНК бактерий из культуральной среды использовали комплект реагентов «ДНК-сорб-В» (ФГУН ЦНИИЭ Роспотребнадзора, Россия). Типирование проводили с 6 парами специфичных для клебсиелл праймеров (табл. 1), отобранных согласно рекомендациям [11, 12, 14].
Для ПЦР-амплификации использовали коммерческий набор AmpliSens-200−1 (ФГУН ЦНИИЭ Роспотребнадзора, Россия). ПЦР проводили с ДНК-матрицы (3 мкл), прямого и обратного праймеров (1 мкл). ДНК амплифицировали в соответствии с протоколом (табл. 2).
Электрофорез ПЦР-фрагментов ДНК клебсиелл проводили с использованием 1,0% агарозного геля в 1% трис-ацетатном буфере в течение 60 мин при 100 В, окрашивали бромистым этидием (1%) и просматривали с помощью УФ-просвечивания. Выделенные гены были идентифицированы и определены на основе размера фрагмента (приведены в таблице 1).
Исследования проводили с аутоштаммами клебсиелл, выделенными у детей первого года жизни в течение 2012−2013 гг. (всего 44 аутоштамма). Для статистической обработки результатов использовали пакеты прикладных программ «STATISTICA», Microsoft Excel.
результаты и обсуждения
У детей был выявлен микроэкологический дисбаланс который характеризовался тем, что на фоне высокой плотности бактерий рода Klebsiella (& gt- 104 КОЕ/г) наблюдался дефицит бифидобактерий (63,6%), лактобацилл (4,2%), нормальной кишечной палочки (6,8%). По результатам биохимического
Таблица 1
Нуклеотидные структуры праймеров, используемых для определения наличия генов патогенности клебсиелл
[10]
Ген патогенности Праймеры Нуклеотидная последовательность праймера (5−3) Размер ампликона (п.н.)
mag A mag A-F mag A-R GGT GCT CTT TAC ATC ATT GC GCA ATG GCC ATT TGC GTT AG 1280
uge uge-F uge-R TCT TCA CGC CTT CCT TCA CT GAT CAT CCG GTC TCC CTG TA 534
kfu kfu-F kfu-R GAA GTG ACG CTG TTT CTG GC TTT CGT GTG GCC AGT GAC TC 797
bfp EP 1-F EP 2-R AAT GGT GCT TGC GCT TGC TGC GCC GCT TTA TCC AAC CTG GTA 326
stx 1 VT 1-F VT 1-R CGC TGA ATG TCA TTC GCT CTGC CGT GGT ATA GCT ACT GTC ACC 302
stx 2 VT 2-F VT 2-R CTT CGG TAT CCT ATT CCC GG CTGCTGTGACAGTGACAAAACGC 516
Таблица 2
Протокол исследований ПЦР
ПЦР-мишень Название Условия для ПЦР
праймера Первичная денатурация Денатурация Отжиг Элонгация Заключительная элонгация
mag A Mag A-F 9 -Ь. С 94 °C 59 °С 74 °C 72 °С
Mag A-R 1 мин ЗО сек 45 сек 2 мин б мин
30 циклов
uge Uge-F 94 °C 94 °С 54 °C °С 7 72 °С
Uge-R 5 мин 1мин 45 сек 1 мин 7 мин
35 циклов
kfu Kfu-F 94 °C °С 4 9 °C 4 5 72 °C 72 °С
Kfu-R 5 мин 1 мин 45 сек 1 мин 7 мин
35 циклов
bfp EP 1-F 94 °C 94 °С °С б 5 72 °C 72 °С
EP 2-R 2 мин ЗО сек 1 мин 2 мин З мин
29 циклов
stx 1 VT 1-F 94 °C °С 4 9 55 °C 72 °С 72 °С
VT 1-R 2 мин 1 мин 1 мин 1 мин З мин
35 циклов
stx 2 VT 2 F 94 °C 94 °С 55 °C 72 °С 72 °С
VT 2 R 2 мин 1 мин 1 мин 1 мин З мин
35 циклов
типирования изоляты были отнесены к 2 видам -Klebsiella pneumoniae и Klebsiella oxytoca.
Был произведён скрининг изолятов Klebsiella spp. на наличие нуклеотидных последовательностей генов, контролирующих синтез факторов патогенности mag A, uge, kfu, bfp, stx 1, stx 2 методом ПЦР с использованием специфических праймеров (см. таблицу 1).
Таблица 3
Видовая характеристика изолятов Klebsiella spp. по признаку детекции генов патогенности
Как показано в таблице 3, ген mag A встречался в 5% случаев в Klebsiella pneumoniae, что свидетельствовало о редкой встречаемости штаммов, способных продуцировать слизистую субстанцию повышенной вязкости. В аутоштаммах клебсиелл обоих видов частота встречаемости гена uge, кодирующего уридин-дифосфат-галактозо-4-эпимеразу и оказывающего
существенное влияние на вирулентность, регистрировалась примерно на одном уровне (92% случаев в K. oxytoca и 90% случаев в K. pneumonia). Ген kfu, кодирующий систему поглощения железа, выявлялся в штаммах K. pneumoniae в 2 раза чаще (30%), чем в K. oxytoca (12,5%). Ген bfp, кодирующий образование связки пилей, обнаруживался в K. oxytoca в 5 раз чаще (25%), чем в K. pneumoniae (5%). Ген, кодирующий шига-подобный токсин (stx 1) был обнаружен в 29,2% и 15,0% случаев соответственно. Маркер гена stx 2 не был зарегистрирован ни в одном из исследованных аутоштаммов.
Сочетания двух генов патогенности наблюдались достаточно часто (рис. 1), и, как правило, в основном они определялись с геном uge, который присутствовал практически в каждом аутоштамме. В штаммах в K. oxytoca было выявлено одновременное присутствие генов uge и kfu (8,3% случаев), что в 2 раза реже чем в K. pneumoniae. Также встречались сочетания генов uge и bfp, uge и stx 1 — в 25% случаев соответственно. В 5% случаев в изолятах K. pneumoniae регистрировалось сочетание генов magA и uge. Присутствие трех генов патогенности (uge + kfu + stx 1) в 3 раза чаще наблюдалось в K. pneumoniae (15%). В 9,1% случаев (4 изолята) гены патогенности не были обнаружены. Одновременное присутствие генов, ответственных за патогенные свойства, усиливает вирулентность бактерий и способствует развитию инфекционных осложнений.
В исследовании показано, что у детей первого года жизни в кишечном биотопе которых регистри-
Ген патогенности Klebsiella oxytoca (n = 24) Klebsiella pneumonia (n = 20)
mag A 0 1 / 5,0 ± 4,8
uge 22 / 92,0 ± 5,5 18 / 90,0 ± 6,7
kfu 3 / 12,5 ± 6,7 6 / 30,0 ± 10,2
bfp 6 / 25,0 ± 8,8 1 / 5,0 ± 4,9
stx 1 7 / 29,2 ± 9,3 3 / 15,0 ± 8,0
stx 2 0 0
Примечание: количество изолятов I частота встречаемости (%).
25
20
15
10
5
0
25
UKlebsiella oxytoca (n = 24) UKlebsiella pneumonia (n=20)



5
uge+ mag A uge+ kfu uge+ bfp
Рис. 1. Сочетаемость генов у двух видов клебсиелл (%).
uge + stx 1
uge+ kfu+ stx 1
руется высокая популяционная плотность двух видов клебсиелл, вегетируют штаммы с наличием генов патогенности. Наибольшее распространение (90% и более) имеет ген uge, который с одинаковой частотой присутствует в генетическом материале обоих исследуемых видов (K. oxytoca, K. pneumoniae). Этот же ген в силу своего доминирования чаще регистрировался и в сочетаниях с другими определяемыми нами генами. Однако в аутоштаммах K. oxytoca он регистрировался в парах с bfp и stx1 в каждом четвертом аутоштамме (25%), тогда как в штаммах K. pneumoniae он чаще сочетался в паре с kfu (15%), по сравнению с другим видом (8,3%). Случаи тройного сочетания генов зарегистрированы в трех штаммах K. pneumoniae (15%) и только в одном штамме K. oxytoca (4,2%).
Таким образом, полученные результаты свидетельствуют о том, что среди штаммов клебсиелл, не являющихся клиническими, а вегетирующих в кишечнике детей в качестве составляющей аллохтонной микробиоты, может быть сосредоточен достаточно заметный патогенный потенциал. Дети первого года жизни наиболее уязвимы в связи с незрелостью иммунной системы и процессами сукцессии микроорганизмов в кишечнике. Поэтому детекция генов патогенности клебсиелл с помощью молекулярногенетических методов позволит решить вопрос о правомерности эрадикационной терапии и повысит эффективность диспансеризации. Для выяснения роли клебсиелл с набором генов патогенности, вегетирующих в кишечнике детей, необходимы дальнейшие исследования.
литература
REFERENCE
1. Бондаренко В. М. Генетические маркеры вирулентности условно патогенных бактерий // Журнал микробиологии, эпидемиологии и иммунобиологии. — 2011. — № 3. — С. 94−99.
Bondarenko V.M. Genetic markers virulence of pathogenic bacteria // Journal of Microbiology, Epidemiology and Immune Biology. — 2011. — № 3. — Р. 94−99. (in Russian)
2. Бондаренко В. М., Мацулевич Т. В. Дисбактериоз кишечника как клинико-лабораторный синдром: современное состояние проблемы. — М.: ГЭОТАР-медиа, 2007. — С. 300.
Bondarenko V.M., Matsulevitch T.V. Disbacteriosis of the intestine as a clinical and laboratory syndrome: current status of the problem. — M.: GEOTAR-media, 2007. -Р. 300. (in Russian)
3. Бурганова Р. Ф. Изменение патогенности Klebsiella pneumoniae при дисбиозе кишечника, вызванного бластоцистной инвазией: автореф. дис. … канд. биол. наук. — Челябинск, 2011. — 21 с.
Burganova R.F. Change of pathogenicity of Klebsiella pneumoniae at intestinal dysbiosis caused by blastocyte invasion: synopsis of a candidate’s thesis in biology. -Chelyabinsk, 2011. — 21 p. (in Russian)
4. Бухарова Е. В. и др. Оценка патогенного потенциала штаммов Klebsiella spp., изолированных из кишечного биотопа детей, на основе молекулярно-генетических маркеров // Матер. III междунар. науч. -практ. конф. «Человек: здоровье и экология» -Иркутск: НЦРВХ СО РАМН, 2013. — С. 31−39.
Bukharova E.V. et al. Assessment of pathogenic potential of Klebsiella spp. Strains isolated from the intestinal biotope of children on the basis of molecular-genetic markers // Materials of the III International Research-to-Practice Conference & quot-Human: health and ecology". — Irkutsk: SCRRS SB RAMS, 2013. — P. 31−39. (in Russian)
5. Егорова С. А., Кафтырева Л. А., Макарова М. А. Патогенный потенциал микроорганизмов рода Klebsiella как возбудителей острых кишечных инфекций // Вестник Военно-медицинской академии. — 2008. -Прил. 2 (22). — С. 535−536.
Egorova S.A. Kaftyreva L.A., Makarova M.A. Pathogenic potential of Klebsiella microorganisms as causative pathogens of acute intestinal infections // Herald of the Military Medical Academy. — 2008. — App. 2 (22). — P. 535−536. (in Russian)
6. Жеребцова Н. Ю., Баймиев А. Х., Валишин Д. А., Мавзютов А. Р. Генетические маркеры патогенности условно патогенных энтеробактерий, выделенных у
детей и подростков при острых кишечных инфекциях // Журн. микробиол. — 2007. — № 2. — С. 3.
Zherebtsova N.U., Baidaev A.H., Valishin D.A., Maksutov A.R. Genetic markers of pathogenicity of opportunistic enterobacteria allocated in children and adolescents with acute intestinal infections // J. Microbiol. — 2007. — N 2. -P. 3. (in Russian)
7. Мавзютов А. Р., Фиалкина С. В., Бондаренко В. М. «Острова» патогенности условно патогенных энтеробактерий // Журн. микробиол. — 2002. — № 6. — С. 5−9.
Mavzyutov A.R., Fialkina S.V., Bondarenko V.M. «Islands» of pathogenicity conditionally pathogenic enterobacteria // J. Microbiol. — 2002. — N 6. — P. 5−9. (in Russian)
8. Мавзютов А. Р. Факторы патогенности оппортунистических энтеробактерий и их роль в развитии диареи // Журн. микробиол. — 2007. — № 1. — С. 89−97.
Mavzyutov A.R. Pathogenicity factors of opportunistic enterobacteria and their role in the development of diarrhea // J. Microbiol. — 2007. — N 1. — P. 89−97. (in Russian)
9. Иванова Е. И., Попкова С. М., Джиоев Ю. П., Ракова Е. Б. Выявление генов патогенности, кодирующих способность к токсинообразованию, у штаммов Escherichia coli, выделенных из кишечного биотопа детей // Бюл. ВСНЦ СО РАМН. — 2013. -№ 2 (90). — С. 111−114.
Ivanova E.I., Popkova S.M., Dzhioev Yu.P., Rakova E.B. Detection of pathogenicity genes encoding the ability to toxin production in Escherichia coli strains isolated from intestinal biotope of children / / Bul. ESSC SB RAMS. -2013. — N 1 (90). — P. 111−114. (in Russian)
10. Отраслевой стандарт ОСТ 91 500. 11. 0004-
2003. Протокол ведения больных. Дисбактериоз кишечника. Утв. 09. 06. 03.
Industrial standard OST 91 500. 11. 0004−2003. Protocol of management of patient. Intestinal dysbacteriosis. Approved 09. 06. 03. (in Russian)
11. Aher T., Roy A., Kumar P. Molecular detection of virulence genes associated with pathogenicity of Klebsiella spp. isolated from the respiratory tract of apparently healthy as well as sick goats // Israel Journal of Veterinary Medicine. — 2012. — Vol. 67 (4). — P. 249−252.
12. Blanco M., Blanco J.E., Mora A., Rey J. Et al. Serotypes, virulence genes, and intimin types of shiga toxin (verotoxin) — producing Escherichia coli isolates from healthy in Spain // J. Clin. Microbiol. — 2003. — Vol. 41, N 4. — P. 1351−1356.
13. Fang C.T., Chuang Y.P., Shun C.T. et al. A novel virulence gene in K. pneumoniae strains causing primary liver abscess and septic metastatic complications // J. Exp. Med. — 2004. — Vol. 199. — P. 697−705.
14. Gunzburg S.T., Tornieporth N.G., Riley L.W. Identification of enteropathogenic Escherichia coli by PCR-based detection of the bundle-forming Pilus gene // J. Clin. Microbiol. 1995. — Vol. 33, N 5. — P. 1375−1377.
15. Maroncle N., Balestrino D., Rich C. Et al. Identification of Klebsiella pneumoniae genes involved in intestinal colonization and adhesion using signature-tagged mutagenesis // Infect. Immun. — 2002. — Vol. 70 (8). -P. 4729−4734.
16. Niyogi S.K., Pal A., Mitra U. Et al. Enteroaggrega-tive Klebsiella pneumoniae in association with childhood diarrhea // Indian J. Med. Res. — 2000. — Vol. 112. -P. 133−134.
17. Regue M., Hita B., Pique A. et al. Gene uge is essential for K. pneumoniae virulence // Infect. Immun. -
2004. — P. 54−61.
Сведения об авторах
Бухарова Екатерина Владимировна — младший научный сотрудник ФГБУ «Научный центр проблем здоровья семьи и репродукции человека» СО РАМН (664 003, г. Иркутск, ул. Тимирязева, 16- тел.: 8 (3952) 33-34-41- е-таіі: buxarowa. ekate-rina@yandex. ru)
Попкова София Марковна — доктор биологических наук, руководитель лаборатории микроэкологии ФГБУ «Научный центр проблем здоровья семьи и репродукции человека» СО РАМН
Ракова Елена Борисовна — научный сотрудник ФГБУ «Научный центр проблем здоровья семьи и репродукции человека» СО РАМН
Джиоев Юрий Павлович — кандидат биологических наук, старший научный сотрудник ФГБУ «Научный центр проблем здоровья семьи и репродукции человека» СО РАМН (е-таіі: alanir07@mail. ru)
Иванова Елена Иннокентьевна — младший научный сотрудник ФГБУ «Научный центр проблем здоровья семьи и репродукции человека» СО РАМН
Шабанова Наталья Михайловна — младший научный сотрудник ФГБУ «Научный центр проблем здоровья семьи и репродукции человека» СО РАМН
Немченко Ульяна Михайловна — младший научный сотрудник ФГБУ «Научный центр проблем здоровья семьи и репродукции человека» СО РАМН
Information about the authors
Bukharova Ekaterina Vladimirovna — junior research officer of Scientific Centre of Family Health and Human Reproduction Problems SB RAMS (Karl Marks str., 3, Irkutsk, 664 025- tel.: 8 (3952) 33-39-52- e-mail: buxarowa. ekaterina@yandex. ru)
Popkova Sofia Markovna — M.S. in biology, head of the laboratory of microecology of Scientific Centre of Family Health and Human Reproduction Problems SB RAMS
Rakova Elena Borisovna — scientific officer of Scientific Centre of Family Health and Human Reproduction Problems SB RAMS Dhzioev Yuriy Pavlovich — candidate of biological science, senior research officer of Scientific Centre of Family Health and Human Reproduction Problems SB RAMS (e-mail: alanir07@mail. ru)
Ivanova Elena Innokentjevna — junior research officer of Scientific Centre of Family Health and Human Reproduction Problems SB RAMS
Shabanova Natalya Mikhaylovna — junior research officer of Scientific Centre of Family Health and Human Reproduction Problems SB RAMS
Nemchenko Ulyana Mikhaylovna — junior research officer of Scientific Centre of Family Health and Human Reproduction Problems SB RAMS

ПоказатьСвернуть
Заполнить форму текущей работой