Экспрессия генов ферментов i и II фаз метаболизма ксенобиотиков при применении антимикробных средств

Тип работы:
Реферат
Предмет:
Медицина


Узнать стоимость

Детальная информация о работе

Выдержка из работы

3. Рецкий М. И., Бузлама В. С., Шахов А. Г. Значение антиоксидантного статуса в адаптивной гетерогенности и иммунологической резистентности животных// Ветеринарная патология. — 2003. — № 2. — С. 63−65.
4. Шакуров М. Ш. Этиопатогенетическая терапия при бронхопневмонии //Ветеринария. — 1983. — № 8. — С. 54−57.
5. Шахов А. Г., Ануфриев А. И., Сулейманов С. М. и др. Респираторные болезни телят// Комплексная экологически безопасная система ветеринарной защиты здоровья животных: методические рекомендации. — М.: ФГНУ Росинформагротех, 2000. — С. 163−186.
6. Методика определения экономической эффективности ветеринарных мероприятий. — М.: МГАВМиБ им. К. И. Скрябина, 1997. — 36 с.
7. Бузлама В. С., Рецкий М. И., Мещеряков Н. П. и др. Методическое пособие по изучению процессов перекисного окисления липидов и системы антиоксидантной защиты организма у животных. — Воронеж, 1997. — 35 с.
8. Гребнева О. Л., Ткачук Е. А., Чубейко В. О. Способ подсчета показателя веществ низкой и средней молекулярной массы плазмы крови // Клин. лаб. диагностика. — 2006. — № 2. — С. 17−18.
9. Тогайбаев А. А., Кургузкин А. В., Рикун И. В. и др. Способ диагностики эндогенной интоксикации // Лаб. дело — 1988. -№ 9. — С. 22−24.
10. Близнецова Г. Н., Ермакова Н. В., Мохаммед З. Д. и др. Спектрофотометрический метод определения метаболитов оксида азота // Вестник ВГУ. Серия химия, биология. — 2002. — № 1. — С. 1−5.
11. Гельцер Б. И., Кривенко Л. Е., Невзорова В. А. и др. Респираторное влаговыделение и значение его исследования в пульмонологии // Тер. арх. — 2000. — № 3. — С. 46−50.
12. Анаев Э. Х., Чучалин А. Г. Конденсат выдыхаемого воздуха в диагностике и оценке эффективности лечения болезней органов дыхания // Пульмонология. — 2006. — № 4. — С. 12−20.
13. Хасина М. А., Двинская С. А., Белоглазова С. И. и др. Конденсат паров выдыхаемого воздуха в оценке степени нарушения метаболизма бронхолегочной системы при неспецифических заболеваниях легких // Клин. лаб. диагн. — 2004. — № 5. — С. 15−17.
SHAKUROV NOVOCAINE BLOCK EFFECT ON BIOCHEMICAL PARAMETERS OF EXHALED BREATH CONDENSATE AND BLOOD IN CALVES WITH BRONCHOPNEUMONIA A.E. Chernitskiy, A.I. Zolotarev
Summary. Our object was to study the effect of Shakurov novocaine block on biochemical parameters of exhaled breath condensate (ЕВС) and blood in calves with bronchopneumonia, and the therapeutic efficiency. It was determined that Shakurov novocaine block in addition to antibiotic and substitution treatment of calves with bronchopneumonia allows to recover some biochemical parameters of exhaled breath condensate, increase functional activity of the organism antioxidant protection system, reduce lipid peroxidation products in blood and endogenous intoxication level. So, after this treatment of calves with bronchopneumonia the activity of gamma-glutamyltransferase in EBC and the content of EBC calcium reduced by 41.0 and 14. 7% (p& lt-0. 05) accordingly in comparison with the initial level (before treatment) — the activity of glutathione peroxidase increased by 40. 2% (p& lt-0. 05), the content of plasma malonic dialdehyde and substances with low and average molecular weight in calves reduced by 31.3 and 7. 5% respectively in comparison with the initial level. After this complex treatment the minute volume of EBC decreased by 18.5 (p& lt-0. 05) and reached the level like in a healthy calves. This helped to reduce the recovery period by 0.6 days (p& lt-0. 01) and to increase the number of animals recovered after treatment by 8. 4% (p& lt-0. 05) in comparison with calves treated with means of causal and substitution therapy. In conclusion, in the present study we identified that Shakurov novocaine block in addition to common treatment of calves with bronchopneumonia not only allows shorten calves recuperation period and to improve treatment efficiency in general but also promotes to recover the respiratory water release and metabolic lung function.
Key words: Shakurov novocaine block, bronchopneumonia, calves, exhaled breath condensate, system of organism antioxidant protection, endogenous intoxication.
УДК 619: 577. 121:615. 28
ЭКСПРЕССИЯ ГЕНОВ ФЕРМЕНТОВ I И II ФАЗ МЕТАБОЛИЗМА КСЕНОБИОТИКОВ ПРИ ПРИМЕНЕНИИ АНТИМИКРОБНЫХ СРЕДСТВ
Э.В. БРАТЧЕНКО, аспирант
О.Ю. ФОМЕНКО, кандидат биологических наук, зав. лабораторией
ВНИВИ патологии, фармакологии и терапии Россель-хозакадемии
E-mail: fomenych@rambler. ru
Резюме. Цель нашей работы — изучение относительного уровня экспрессии генов, кодирующих ферменты I и II фаз метаболизма ксенобиотиков в печени крыс при использовании антимикробных средств различных фармакологических групп (тилозина и цими-наля). Эксперимент проводили на трех группах крыс по 3 гол. в каждой. Животным двух опытных групп препараты вводили в 10-и кратной терапевтической дозе: крысам II группы — «цидисепт-О» (пероральная форма циминаля) внутрижелудочно 0,5 мл/100 г массы тела, особям III группы — тилозин (антибиотик) подкожно 2,4 мг/100 г массы тела, I группа была контрольной.
Уровень экспрессии изучаемых генов (CYP1A1, CYP1A2, CYP2B1, CYP3A1 и GST) определяли методом полимеразной цепной
реакции в реальном времени. В качестве гена-нормализатора использовался ген GAPDH. Достоверность различий определяли методом парных сравнений с использованием 1-критерия Стью-дента, при уровне значимости р& lt-0,05.
Применение тилозина в дозе 2,4 мг/100 г массы тела вызывало резкую индукцию генов CYP1A1 и CYP1A2. Уровень их транскриптов в клетках печени возрастал, по сравнению с контролем, в 3,16±0,12 и 8,06±0,4 раза. Одновременно наблюдалось незначительное повышение уровня экспрессии генов CYP2B1 и CYP3A1 (в 1,46±0,04 и 1,82±0,09 соответственно). В группе животных, получавших циминаль, статистически достоверных отличий уровней экспрессии от контроля не обнаружено.
Таким образом, использование антимикробных средств на основе циминаля не оказывает индуцирующего действия на экспрессию генов метаболизма ксенобиотиков и не вызывает нарушения равновесия в системах микросомального и свободно-радикального окисления.
Ключевые слова: экспрессия, антимикробные средства, печень, цитохром Р450, глутатион-Б-трансфераза.
Огромное разнообразие ксенобиотиков, включая лекарственные вещества, попадая в организм животных и человека, включаются в процессы метаболизма с участием специализированных ферментных систем. Наиболее важной из них считают суперсемейство цитохромов Р450 [1], экспрессию которых регулирует взаимодействие цитозольных рецепторов со строго специфичными для каждого члена суперсемейства лигандами низкой молекулярной массы. Такое взаимодействие вызывает изменение конформации рецептора, после чего лиганд попадает в ядро, где связывается со специфическим регионом (элемент ответа на ксенобиотик, ХЯЕ), расположенным выше соответствующего гена, и изменяет структуру ДНК таким образом, что она становится более доступной для ферментов транскрипции [2].
На генах цитохромов Р450 обычно расположены сайты связывания для множества факторов, соответственно их экспрессию контролируют несколько систем ответа. Индукция Р450 — нежелательный эффект действия фармакологических субстанций, так как это может приводить к ускоренному метаболизму совместно принимаемых лекарств, которые могут быть субстратами для активированных форм цитохромов Р450. Кроме того, из-за активации или подавления экспрессии генов других микросомальных ферментов (в первую очередь глутатион^-трансферазы) может происходить синтез более токсичных метаболитов поступающих в организм ксенобиотиков или замедление их детоксикации [3]. Поэтому крайне важно выяснить может ли действующее вещество служить индуктором ферментов метаболизма ксенобиотиков. Такого рода исследования особенно актуальны на начальной стадии разработки новых терапевтических агентов.
В связи с тем, что широкое использование антибиотиков приводит к возникновению и распространению устойчивых штаммов микроорганизмов, нарушению состава микрофлоры желудочно-кишечного тракта и, как следствие, дисбактериозам, сегодня повышенное внимание уделяют разработке новых лекарственных средств, не являющихся антибиотиками, к числу которых относится — циминаль — пара-нитро-а-хлоркоричный альдегид, обладающий подавляющим действием на грамположительную и грамотрицатель-ную микрофлору.
Целью нашей работы — изучение относительного уровня экспрессии генов, кодирующих ферменты I и II фаз метаболизма ксенобиотиков в печени при использовании антимикробных средств.
Условия, материалы и методы. Исследования проводили на половозрелых самцах белых беспородных лабораторных крыс в возрасте 6 мес. с массой тела 300… 350 г. Животных содержали на общевиварном рационе при свободном доступе к воде. Для изучения уровня экспрессии генов ми-кросомального окисления по принципу пар-аналогов было сформировано 3 группы по 3 гол. в каждой. I группа была контрольной — в нее входили интактные животные.
Особям остальных опытных групп в течение 5 дней вводили препараты в 10-и кратной терапевтической дозе.
Крысам II группы — «цидисепт-О» (пероральная форма циминаля), внутрижелудочно, 0,5 мл/100 г массы тела, животным III группы — тилозин (антибиотик), подкожно 2,4 мг/100 г массы тела По окончании курса введения препаратов крыс забивали декапитацией и внутренние органы использовали в дальнейшей работе.
Суммарную клеточную РНК из образцов тканей печени массой 100 мг выделяли методом фенол-хлороформной экстракции с использованием гуани-динтиоцианата. Очистку РНК проводили при помощи осаждения хлоридом лития [4]. Концентрацию определяли спектрофотометрически при длине волны 260 нм. О степени чистоты полученных препаратов судили по соотношению А260/А280.
Обратную транскрипцию осуществляли с использованием 2 мкг суммарной клеточной РНК при помощи ревертазы M-MuLV, RNase H- (СибЭнзим) в течение 60 мин. при 42 °C. В качестве затравки использовали олигонуклеотид (dT)18. Для предотвращения деградации матриц РНК в реакционную смесь вносили 20 ед. ингибитора РНКаз IRNasine.
Количественный ПЦР-анализ выполняли с применением флуоресцентного красителя SYBR Green I [5] и использованием набора реактивов фирмы «Синтол» на приборе Rotor Gene 6000. Для проведения реакции брали кДНК, полученную с использованием 200 нг суммарной клеточной РНК. Определяли относительный уровень экспрессии генов CYP1A1, CYP1A2, CYP2B1, CYP3A1 и GST. Нормирование проводили по гену GAPDH. Представленность транскриптов в контрольной группе принимали за единицу. Праймеры для проведения полимеразной цепной реакции в реальном времени разработаны с использованием программного обеспечения Primer3 [6]. Амплификацию фрагментов генов метаболизации ксенобиотиков проводили по схеме двухшаговой полимеразной цепной реакции по программе: денатурация 95 °C — 5 мин- циклирование: отжиг праймеров и элонгация цепей 60 °C — 45 сек., денатурация 95° - 15 сек. Число циклов — 45.
Значения пороговых циклов определяли автоматически при помощи программного обеспечения Rotor Gene 6000 Series Software 1.8. 17.5. Определение относительного уровня экспрессии исследуемых генов осуществляли с применением 2-ААа-метода [7].
Поиск последовательностей, гомологичных генам ферментов I и II фаз метаболизма ксенобиотиков, и их анализ проводили с использованием программы BLAST [8].
Для статистической обработки полученных результатов применяли пакет программного обеспечения Statistica 6.0. Достоверность различий относительно контрольной группы определяли методом парных
сравнений с использованием t-критерия Стьюдента, при уровне значимости p& lt-0,05.
Таблица 1. Праймеры для мРНК ферментов метаболизма ксенобиотиков
Ген 1 5' ^ 3' последовательность Ампликон, п.о.
CYP1A1 прямой: GAAGAAGCTAATCAAAGAGCACTACAGG
обратный: CAATGCTCAATGAGGCTGTCTG 81
CYP1A2 прямой: TCCACATTCCCAAGGAGTGCT
обратный: TAAGAAACCGCTCTGGGCG 105
CYP2B1 прямой: GGCTCACACCGGCTACCAA
обратный: TGAAAACCTCTGAATCTCGTGGATA 84
CYP3A1 прямой: GTAAAATACTTGAGGCAAGAGAAAGGC
обратный: TCGGGTTGTTGAGGGAATCA 124
GST прямой: GCGTGGTATCACCCAAACAGGGACC
обратный: ACTCCATTCTACCCCGGGCCTCA 120
GAPDH прямой: TGCCCGTGACAGCCAACACAGGAGC
обратный: TCTGAGGTCGGGTCCGTCGCCC 104
Результаты и обсуждение. Для амплификации фрагментов соответствующих мРНК мы использовали специфические праймеры, разработанные на основе публично доступных баз нуклеотидных последовательностей (см. табл.).
При внутрижелудочном введении «Цидисепта-О» усиления экспрессии всех изученных генов не наблюдали (см. рисунок). Наоборот, отмечено незначительное снижение их активности, кроме СУР1Д1. Это может свидетельствовать о стабилизации процессов свободно-радикального и микросомального окисления в печени. Наблюдаемый эффект, вероятно, обусловлен химическим составом препарата. Известно, что фосфолипидные компоненты мембран сорбируют пара-нитро-а-хлоркоричный альдегид, что снижает их биодоступность для активных форм кислорода, а следовательно, и интенсивность свободно-радикального окисления.
9 1
CYP1A1 CYP1A2 CYP2B1 CYP3A1 GST
Рисунок. Экспрессия генов метаболизма ксенобиотиков в печени крыс:? — контроль- ¦ - цидисепт-О- Ш — тилозин.
Введение тилозина вызывало резкую индукцию генов СУР1Д1 и СУР1Д2. Уровень их транскриптов в клетках печени увеличивался, по сравнению с контролем, в 3,16±0,12 и 8,06±0,4 раза соответственно. В норме экспрессия гена СУР1Д1 в клетках печени практически отсутствует. Однако при воздействии на организм таких полициклических планарных углево-
дородов, как диоксины и бензопирен его активность резко возрастает [9]. Индукция транскрипции этого гена опосредована через цитозольный арилуглево-дородный рецептор (AhR) и вовлекает в себя диссоциацию белка теплового шока hsp90 AhR, ассоциацию с ядерный фактором транскрипции arnt и последующее связывание образовавшегося гетеродимерного комплекса с элементами ответа на ксенобиотики, фланкирующими ген CYP1A1 [10]. Ген CYP1A2 — конститутивно экспрессирующийся, повышение уровня его транскриптов в клетке может свидетельствовать об усилении процессов I фазы метаболизма ксенобиотиков. Цитохром CYP2B1 метаболизирует разнообразные липофильные лекарственные средства и стероиды. Его экспрессию индуцирует фенобарбитал [11]. В нашем опыте тилозин вызвал увеличение количества транскриптов этого гена, по сравнению с контрольной группой, в 1,46±0,04 раза. Механизмы регуляции экспрессии гена CYP3A1 еще во многом не ясны, но известно, что его индукцию вызывают синтетические глюкокортикоиды. Обнаруженное увеличение уровня экспрессии этого гена в 1,82±0,09 раза может быть связано с активацией элементов ответа на ксенобиотики либо непосредственно молекулами тилозина, либо его метаболитами. Статистически достоверных различий в уровнях экспрессии гена GST, который кодирует глутатион^-трансферазу, между животными I и III групп не обнаружено. Это, вероятно, свидетельствует о том, что препарат в использованных дозах не вызывает активации процессов II фазы утилизации ксенобиотиков.
Выводы. Применение тилозина в дозе 2,4 мг/100 г массы тела вызывает резкую индукцию экспрессии цитохромов CYP1A1 и CYP1A2 (в 3,16±0,12 и 8,06±0,4 раза соответственно) и незначительное повышение уровней транскриптов CYP2B1 и CYP3A1 (в 1,46±0,04 и 1,82±0,09 раза соответственно), что может приводить к развитию патологий печени при ошибочном использовании повышенных доз препарата.
Применение антимикробных средств неантибиотической природы на основе циминаля не оказывает индуцирующего действия на экспрессию генов метаболизма ксенобиотиков и таким образом, не вызывает нарушения равновесия в системах микросомального и свободно-радикального окисления.
Литература.
1. Guengerich F.P. Reactions and significance of cytochrome P-450 enzymes // The Journal of Biological Chemistry. — 1991. -v. 266. — p. 10 019−10 022.
2. Zhu B.T. On the general mechanism of selective induction of cytochrome P450 enzymes by chemicals: some theoretical considerations // Expert opinion on drug metabolism and toxicology. — 2010. — v. 6, № 4. — p. 483−494.
3. Hayes J.D., Pulford D.J. The glutathione S-transferase supergene family: regulation of GST and the contribution of the izoen-zymes to cancer chemoprotection and drug resistance // Clinical Reviews in Biochemistry and Molecular Biology. — 1995. — v. 30. -p. 445−600.
4. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction //Analytical Biochemistry. — 1987. — vol. 162. — pp. 156−159.
5. Karlsen F., Steen H.B., Nesland J.M. SYBR green IDNA staining increases the detection sensitivity of viruses by polymerase
chain reaction // Journal of virological methods. — 1995. — v. 55, № 1. — p. 153−156.
6. Rozen S., Skaletsky H. Primer3 on the WWW for general users and for biologist programmers //Methods in Molecular Biology.
— 2000. — vol. 132. — pp. 365−386.
7. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-AACt method// Methods. — 2001. — v. 25. — p. 402−408.
8. Gapped BLAST and PSI-BLAST: a new generation of protein database search /S.F. Altschul, T.L. Madden, A.A. Schaffer, J.
Zhang, Z. Zhang, W. Miller, D.J. Lipman // Nucleic Acids Research. — 1997. -v. 25.- p. 3389−3402.
9. Purification and characterization of liver microsomal cytochromes P450: electrophoretic, spectral, catalytic and immunochemical properties and inducibility of eight isozymes isolated from rats treated with Phenobarbital or в-naphtoflavone / F.P. Guengerich [et al.] //Biochemistry. — 1982. — v. 21. — p. 6019−6030.
10. OkeyA.B., Riddick D.S., Harper P.A. Molecular biology of the aromatic hydrocarbon (dioxin) receptor// Trends in Pharmacological sciences. — 1994. — v. 15, № 7. — p. 226−232.
11. Waxman D.J., Azaroff L. Phenobarbital induction of cytochrome P-450 gene expression // The Biochemical Journal. — 1992.
— v. 281. — p. 577−592.
EXPRESSION OF XENOBIOTIC METABOLISM PHASES I AND II ENZYMES DURING ANTIVICROBIAL DRUGS ADMINISTRATION E.V. Bratchenko, O. Yu. Fomenko
Summary. The aim of this work was to study the relative expression levels of xenobiotic metabolism phases I and II enzymes in rat liver during administration of antimicrobial agents of different pharmacological groups (tylosin and tsiminal).
Expression level of the genes of interest was determined using real time polymerase chain reaction. GAPDH was used as house-keeping gene. Differences reliability was determined by pairwise comparisons using Student’s t-test (p & lt- 0,05).
It was shown that the usage of tylosin at a dose of 2.4 mg per 100 g of body weight cause a significant induction of CYP1A1 and CYP1A2 genes. The level of their transcripts in the liver was 3,16 ± 0,12 and 8,06 ± 0,4 fold than in the control group. In this case also there was a slight increase in expression of CYP2B1 and CYP3A1 genes (in 1,46 ± 0,04 and 1,82 ± 0,09, respectively). There were no statistically significant differences in expression levels between control group and rats treated with «Tsidisept-O».
We can conclude that in contrast to tylosin, the administration of antimicrobial agents based on tsiminal did not exert an inducing effect on xenobiotics metabolism gene expression patterns and did not lead to imbalance in microsomal and free radical oxidation systems. Key words: expression, antimicrobial drugs, liver, cytochrome P450, glutathione-S-transferase.
УДК619: 579. 252. 55:578. 81: 615. 28
ФОРМИРОВАНИЕ РЕЗИСТЕНТНОСТИ И ВОССТАНОВЛЕНИЕ ЧУВСТВИТЕЛЬНОСТИ БАКТЕРИЙ К КОМПЛЕКСНОМУ АНТИМИКРОБНОМУ ПРЕПАРАТУ ДИОКСИНОР
Л.Ю. САШНИНА, кандидат ветеринарных наук, ведущий научный сотрудник
ВНИВИ патологии, фармакологии и терапии Рос-сельхозакадемии
E-mail: vnivipat@mail. ru
Резюме. Одно из направлений предотвращения формирования устойчивости микроорганизмов к антибиотикам или снижения степени ее развития — применение при бактериальных инфекциях комплексных препаратов. Цель наших исследований — изучение формирования резистентности и восстановления чувствительности у эшерихий, сальмонелл, золотистого стафилококка и пастерелл к препарату диоксинор, разработанному на основе ди-оксидина и норфлоксацина и рекомендованному для применения в качестве этиотропного средства прижелудочно-кишечныхи респираторных болезнях молодняка сельскохозяйственных животных. Исследования проводили путем культивирования перечисленных микроорганизмов в мясо-пептонном бульоне (МПБ), содержащем возрастающие суббактериостатические концентрации препарата. У пассируемых культур степень устойчивости кпрепарату оценивали по коэффициенту резистентности (отношению максимальной, не препятствующей росту бактерий концентрации, к исходной). Стабильность приобретенной устойчивости и восстановление чувствительности кдиоксинору изучали путем последовательных пассажей микроорганизмов в МПБ, не содержащем препарат. Минимальная бактериостатическая концентрация диоксинора для эшерихий и сальмонелл составила 0,39 мкг/мл, золотистого стафилококка — 1,56 мкг/мл, пастерелл — 0,78 мкг/мл. Формирование резистентности микроорганизмов к препарату происходило медленно, ее коэффициент у эшерихий и сальмонелл был равен 8 (через 40 пассажей), золотистого стафилококка и пастерелл
— 4 (через 30 пассажей). Приобретенная микроорганизмами устойчивость нестабильна, и восстановление их чувствительности к препарату происходит относительно быстро: у эшерихий и сальмонелл через 60 пассажей, у золотистого стафилококка и пастерелл — после 50 пассажей. Полученные результаты обосновывают целесообразность включения диоксидина и норфлоксацина в состав комплексного препарата диоксинор.
Ключевые слова: диоксинор, диоксидин, норфлоксацин, резистентность, эшерихии, сальмонеллы, золотистый стафилококк, пастереллы.
На крупных животноводческих комплексах желудочно-кишечные и респираторные болезни мо-
лодняка, как правило, протекают по типу смешанных инфекций, в возникновении и развитии которых принимают участие несколько возбудителей, в том числе антибиотикорезистентные бактерии [3, 7, 9].
В связи с этим для терапии больных животных разрабатывают комплексные препараты с широким спектром антимикробного действия [1, 6, 8].
Добиться такого эффекта можно при рациональном подборе сочетаний антибактериальных веществ, которые одновременно позволяют снизить минимальную ингибирующую концентрацию благодаря синергизму, уменьшить побочный эффект, по сравнению с монопрепаратами, и при наличии разных механизмов воздействия на микроорганизмы уменьшить вероятность развития резистентности [2, 4].
В качестве этиотропного средства при желудочнокишечных и респираторных болезнях молодняка сельскохозяйственных животных перспективно использование комплексного препарата диоксинор, созданного на основе норфлоксацина и диоксидина [5].
Цель нашего исследования — изучить формирование резистентности и восстановления чувствительности у эшерихий, сальмонелл, золотистого стафилококка и пастерелл к диоксинору.
Условия, материалы и методы. Материалом для исследования служили референтные штаммы микроорганизмов Escherichia coli 866, Salmonella cholerae suis, Staphylococcus aureus 209 Р, Pasteurella multocida В14, комплексный препарат диоксинор и его составляющие — норфлоксацин и диоксидин. Изучение формирования резистентности у микроорганизмов проводили путем культивирования их в мясо-пептонном бульоне (МПБ), содержащем возрастающие суббактериостатические концентрации перечисленных препаратов. После каждых десяти пассажей определяли антимикробную активность диоксинора, норфлоксацина и диоксидина в отношении указанных микроорганизмов.
При изучении антимикробной активности препаратов минимальную бактериостатическую концентрацию

ПоказатьСвернуть
Заполнить форму текущей работой