Экспрессия раково-тестикулярных антигенов в клетках меланомы человека

Тип работы:
Реферат
Предмет:
Медицина


Узнать стоимость

Детальная информация о работе

Выдержка из работы

лабораторные и экспериментальные исследования
УДК: 616−006. 81−097:575. 117
экспрессия раково-тестикулярных антигенов в клетках меланомы человека
и.н. Михайлова1, д.А. Ковалевский2, о.С. Бурова1, В.А. голубева1, л.Ф. Морозова1, Е.С. Воронина3, и.А. утяшев1, г. С. Аллахвердян1,
С. Субраманиан1, Т.Т. Кондратьева1, Е.А. черемушкин1, С.л. Киселев4, л.В. демидов1, А.Ю. Барышников1, р.ш. Бибилашвили2
Учреждение Российской академии медицинских наук Российский онкологический научный центр
им. н.н. Блохина РАМИ, г. Москва1 Российский кардиологический научно-производственный комплекс Росмедтехнологий, г. Москва2 Медико-генетический научный центр РАМИ, г. Москва3 Институт общей генетики им. Вавилова РАИ, г. Москва4 121 552, г. Москва, ул. 3-я Черепковская, 15А, e-mail: dmitryk@cardio. ru2
По морфологическим и генетическим (транскриптомным) параметрам нами охарактеризована 21 клеточная линия диссеминированной меланомы кожи человека. Морфологические исследования позволили разделить полученные линии на 3 группы: высоко-, умеренно- и низкодифференцированную. ОТ-ПЦР анализом мРНК выявлено неоднородное распределение раково-тестикулярных маркеров. Проведенный корреляционный анализ показал взаимосвязь между увеличением экспрессии раково-тестикулярных маркеров и атипизмом раковой клетки. Полученные данные могут быть использованы для клинического прогноза заболевания и способствовать оптимизации лечения.
Ключевые слова: раково-тестикулярные антигены, дифференцировка клеток, меланома.
EXPRESSION OF CANCER TESTIS ANTIGENS IN HUMAN MELANOMA CELLS I.N. Mikhaylova1, D.A. Kovalevsky2, O.S. Burova1, VA. Golubeva1, L.F. Morozova1, E.S. Voronina3, I.A. Utyashev1,
G.S. Allakhverdyan1, S. Subramanian1, T.T. Kondrat’eva1, E.A. Cheremushkin1, S.L. Kiselev4, L. V Demidov1,
A. Yu. Baryshnikov1, R. Sh. Beabealashvilli2 N.N. Blokhin Cancer Research Center, RAMS, Moscow1,
National Cardiology Research Center, Ministry of Health, Moscow2,
Medical Genetic Research Center, RAMS, Moscow3,
N.I. Vavilov Institute of General Genetics, RAS, Moscow4 121 552, Russia, Moscow, 15A, 3rd Cherepkovskaya str., e-mail: dmitryk@cardio. ru2
The expression of genes for 15 cancer-testis antigens and 4 melanoma differentiation antigens in 21 metastatic melanoma cell lines using a RT-PCR assay was analysed. The morphological examination allowed us to divide all analyzed cell lines into three groups with a high, intermediate, and low level of differentiation of tumour cells. Correlation analysis of gene expression and cell morphology demonstrated interrelation between increased expression of cancer-testis genes and differentiation grade of cancer cells. Data obtained can be used for the disease prognosis and promote optimization of medical treatment.
Key words: cancer testis antigens, melanoma, cellular differentiation.
Опухолевая прогрессия определяется рядом лам, отсутствие репликативного старения или
факторов, которые формируют злокачественную приобретение бессмертия (иммортализация),
клетку, к ним относятся самодостаточность ослабление индукции апоптоза, стимуляция
в пролиферативных сигналах, пониженная неоангиогенеза, изменение подвижности и
чувствительность к ростингибирующим сигна- приобретение способности к инвазии и росту
в другом микроокружении, изменение морфологии клеток, нарушение клеточной диф-ференцировки, генетическая нестабильность. Морфологически клетка становится атипичной, подвергаясь всевозможным изменениям в размере, форме и количестве ядер, соотношении между ядром, цитоплазмой и ядрышками. Им-муногеннотипически злокачественная клетка характеризуется экспрессией ряда антигенов: раково-тестикулярных (MAGE, BAGE и т. д.), дифференцировочных (дифференцировочные антигены для меланомы — тирозиназа, Melan-A/MART-1, gp100, TRP-1, TRP-2) [4], а также сниженной экспрессией антигенов гистосовместимости первого, второго класса [5]. Раково-тестикулярные антигены (РТА), которых идентифицировано более 44 семейств, состоят как из множественного количества изоформ белка (MAGEA, GAGE1 и т. д.), так и вариантов сплайсинга генов [6]. РТА кодируются генами, экспрессирующимися в герменногенных клетках, а также в опухолях различных типов. Высокий уровень РТА наблюдается при меланоме, раке мочевого пузыря, раке легкого, печени и ряде других онкологических заболеваний [3]. Некоторые авторы отмечают, что увеличение экспрессии РТА коррелирует с опухолевой прогрессией. Например, уровень экспрессии мРНК MAGE возрастает при метастатической меланоме, а экспрессия NY-ESO-1 при раке мочевого пузыря коррелирует с высоким ядерно-цитоплазматическим соотношением. Роль данных антигенов не совсем понятна. Хотя уже сейчас их функции связывают с гаметогенезом [7].
Цель работы заключалась в исследовании опухолевых клеточных линий, полученных от больных диссеминированной меланомой, для выявления корреляций между морфологическими и транскриптомными характеристиками культур, опосредованных злокачественностью клеток.
Для достижения поставленной цели необходимо было решить следующие задачи: провести морфологический анализ полученных ранее культур [1]- дополнить его кариологическими признаками (различиями), такими как соотносительная оценка размера ядер, характер их окраски, состояние хроматина и кариотипиче-
ский анализ (число хромосом, симметричные транслокации в длинных хромосомах, наличие или отсутствие идентичных перестроенных хромосом в разных метафазах, нестабильные хромосомные аберрации) — составить карты экспрессии раково-тестикулярных антигенов методом полимеразной цепной реакции, совмещенной с обратной транскрипцией в клеточных линиях, и выявить группы РТА методом кластерного анализа.
Материал и методы
Культивирование опухолевых клеток. Клеточные линии, полученные ранее [1], культивировали в среде RPMI 1640, содержащей 15% ТЭС, 2 мМ L-глутамин, 1% HEPES, пенициллин (10 ед/мл), стрептомицин (100 мкг/мл) и комплекс аминокислот и витаминов (Flow, Virginia, USA) в культуральных флаконах (Costar, Coring, USA).
Реакция поверхностной иммунофлуоресценции. 5×105 клеток инкубировали с 20 мкл моноклональных антител (МКА) в течение 30 мин при комнатной температуре, после чего 10 мин отмывали в 1 мл PBS при 1500 об/мин. К осадку клеток добавляли 20 мкл вторичных антител, конъюгированных с флюоресциин изо-тиоционатом (FITC), и инкубировали в течение 30 мин при 4 °C. После этого клетки дважды отмывали в 1 мл PBS в тех же условиях, осадок клеток ресуспендировали в 200 мкл 1% раствора формалина и анализировали на проточном цитометре FACSCalibur (Beckton Dickinson, USA). Первичные и вторичные МКА, использованные в работе, были получены в Институте клинической онкологии РОНЦ им. Н. Н. Блохина РАМН: ICO-218 (HMW — меланомодиффе-ренцировочный антиген) и F (ab)2 фрагменты иммуноглобулинов, конъюгированных с FITC. Использовали реактивы для буферов и фиксаторов компании ХимМед Москва, Россия).
Иммуноцитохимическое исследование. Фиксация материала. Из полученных клеточных линий готовили цитопрепараты — осаждением суспензии клеток на цитоцентрифуге Universal 16A (Hettich, Germany), просушивали на воздухе, хранили при -20°С. Для проведения реакции стекла прогревали до комнатной температуры, фиксировали 1−2 мин в охлажденном (-20°С)
ацетоне (ХимМед, Москва, Россия). Процедура окрашивания. Фиксированные цитопрепараты промывали в PBS 5 мин. Блокировали эндогенную пероксидазу 3% раствором перекиси водорода (ХимМед, Москва, Россия) в течение 20 мин, образцы промывали в двух сменах PBS 10 мин. Затем инкубировали с 1% раствором бычьего сывороточного альбумина (БСА) (Sigma, St. Louis, USA) 20 мин при комнатной температуре, после этого избыток раствора удаляли и, не промывая образцы, наносили первичные антитела, инкубировали в течение ночи на холоде (+4°С). Образцы промывали в трех сменах PBS. Для визуализации реакции применяли систему LSAB+Detection System (Dako, USA) согласно инструкции. Выявление ферментативной активности проводили с помощью AEC (3-amino-9-ethylcarbazole containing hydrogen peroxide, stabilizers, enhancers, and anti-microbial agent) (Dako, USA), докрашивали гематоксилином (Serva, Germany). Подсчет проводили в областях с максимальным окрашиванием на 200−300 опухолевых клеток, используя микроскоп «Axiolab» (ZEISS, Germany). Для иммуноцитохимического исследования использовали следующие МКА (Novocastra Laboratories, UK): MelanA/МART-1 (маркер дифференцировки меланоцитов клон А103, в рабочем разведении 1: 25), HMB45 (маркер дифференцировки меланоцитов, используется для идентификации меланоцитных опухолей, клон HMB45, в рабочем разведении 1: 60), Tyrosinase (маркер дифференцировки меланоцитов, определяет биосинтез меланина, клон Т311, в рабочем разведении 1: 50). Для цитологического анализа клетки меланомных линий выращивали в ростовой среде на предметных стеклах, помещенных в чашках Петри. Мазки окрашивали по методу Лейшмана.
Методика приготовления цитогенетических препаратов. Для приготовления препаратов для кариотипического анализа клетки обрабатывали колхицином в конечной концентрации 0,5 мкг/мл, вводя его в культуральные флаконы за 1,5 ч до начала фиксации. Использовались реактивы фирмы Sigma-Aldrich (St. Louis, USA). Затем клетки снимали со стенки флакона с помощью раствора Версена и 0,25% раствора трипсина. Для отмывания от трипсина добавляли среду DMEM (5 мл), полученную су-
спензию клеток центрифугировали (10 мин при 1000 об/мин), надосадочную жидкость сливали. Гипотонию проводили 0,55% раствором KCl (12 мин при 37°С), перед центрифугированием добавляли 3−5 капель фиксатора. Фиксация проводилась смесью метилового спирта и ледяной уксусной кислоты (в соотношении 3: 1) стандартным способом, с использованием 3 смен фиксатора. Клеточные суспензии раскапывали на охлажденные влажные стекла. Высушенные препараты окрашивали по методу G-окраски.
Полимеразная цепная реакция, совмещенная с обратной транскрипцией. Суммарную РНК из культур опухолевых клеток меланомы выделяли методом с применением кислого фенола, гуанидина тиоционата (NH2C (=NH) NH2 х HSCn) и аммония тиоционата (NH4SCN) в соответствии с рекомендациями фирмы (Protocol № PT3231−1, CLONTECH, Mountain View, USA). Использованы реактивы фирмы Sigma-Aldrich (St. Louis, USA). Для выделения суммарной РНК использовали 1*106 опухолевых адгезивных клеток или такое же количество суспензионных клеток (Mel min — 15). Опухолевые клетки разрушали добавлением денатурирующего буфера непосредственно в культуральном флаконе с клетками, но без культуральной среды, или добавлением к осадку, полученному после центрифугирования, суспензионных клеток. РНК из гомогената экстрагировали последовательным добавлением кислого фенола (pH 4,0) и хлороформа и изопропанолом. Описанную процедуру выполняли дважды. Последовательности нуклеотидов ген-специфических праймеров (табл. 1) были выбраны при помощи программы Oli99 фирмы «Техноген» (Москва, Россия) и синтезированы на фирме «Синтол» (Москва, Россия). Последовательность мРНК была получена из баз данных UniGene (http: //www. ncbi. nlm. nih. gov/ entrez/query. fcgi? db=unigene) и AceView (http: // www. ncbi. nlm. nih. gov/IEB/Re search/Acembly/ index. html) Национального центра для биотехнологической информации (Bethesda, USA, ncbi. nlm. nih. gov). Определение степени гомологии нуклеотидных последовательностей полученных ампликонов против геномной и мРНК последовательностей проводили при помощи программы BLAST на сервере http: //www. ncbi.
Таблица 1
последовательность нуклеотидов ген-специфических праймеров
Семей- ство генов Название ампликона Символ гена ^^)*** мРНК**** F R* Последовательность нуклеотидов (5'- - & gt-3'-) Размер ампли- кона Кластер генов**
1 2 3 4 5 6 7 8
РТА Антигены (раково-тестикулярные), кодируемые этими генами, узнаются аутологичными цитотоксическими лейкоцитами. Экспрессируются в разнообразных опухолях, но не в нормальных тканях, за исключением тестикул, плаценты и незрелых (бластных) клеток различной природы.
MAGE-B1 MAGEB1 NM_2 363.3 F TAAGTTCATCACCCAAGATCTGGTGC 346 G1a
R AACAAAGTGAACAATCTGCCTGAGTTC
MAGE-B2 MAGEB2 NM_2 364.3 F CAGTGTTGTCTTTGGCCTTGAGCTG 217 G1a
R GACTCCCAACATATTCAGGAATTCCC
MAGE-A4 MAGEA4 NM_2 362.3 F TTCCTGTGATCTTCGGCAAAGCCTC 204 G1b
R TGTCGCCCTCCATTGCAATTGTGC
GAGE-1−8 GAGE1, GAGE2, GAGE4, GAGE5, NM_1 468.1 F GGCCTAGACCAAGACGCTACGTAG 212 G1b
GAGE6, GAGE7, GAGE8 R GTGACCCTGTTCCTGGCTATCAGC
GAGE3 GAGE3 и19 144 F AGATGAGTTGGCGAGGAAGA 223 G1b
R TTCCCCTTCTTCAGGTGTTG
GAGE-4−7 GAGE4, GAGE5, NM_2 045 F GGCCTAGACCAAGGCGCTATGTAC 212 G1b
GAGE6, GAGE7 R GTGACCCTGTTCCTGGCTATCAGC
MAGE-A1 MAGEA1 NM_4 988.3 F GGGCCAAGCACCTCTTGTATCCTG 212 G1c
R ATGCCAAAGACCAGCTGCAAGGAC
MAGE-A10 MAGEA10 NM_21 048.3 F GTTTAGTGAAGCCTCCGAGTGCATG 192 G1c
R TAGCCCTCTATGAAGATTATGCTTAGG
MAGE-C1 MAGEC1 NM_5 462.2 F AGTGGACCCTGATGACTCCTATGTC 271 G1c
R CCGGTACTCTAGGTAATGTTCCTGC
BAGE BAGE NM_1 187 F GCCAATTTAGGGTCTCCGGTATCTC 211 G1c
R TCTGGCCGCCATCTTACTGCTCC
MAGEA2, MAGEA3, MAGEA6, MAGEA12 F CCCACTACCATGAACTACCCTCTC 223
MG-A3 NM_5 362.3 R AATACTGCCAATTTCCGACGACACTC G2a
MAGEA2, MAGEA3, MAGEA6, MAGEA12 F TCCAAGGGCCCTCATTGAAACCAG 233
MG-A2 NM_175 743.1 R GGAATGGGCCTCATATCACACGAG G2a
MAGEA2, MAGEA3, MAGEA6, MAGEA12 F TCCAAGGGCCCTCATTGAAACCAG 233
MG-A6 NM_5 363.2 R GAATGGGCCTCACGTCACAGGAG G2a
MG_ MAGEA2, MAGEA3, NM 5 367.3 F GAAATGCTGGGGAGTGTCAT 197 G2a
А12−236 MAGEA6, MAGEA12 R GTCTTGGGCACGATCTGATT
CTAG1 Меланоцитный дифференцирующий антиген. Белки этих генов являются специфичными для опухолей и узнаются аутологичными цитотоксичными Т-лимфоцитами. (CTAG1)
NY-ESO-1 CTAG1A, CTAG1B, NM_1 327 F CTCCATCAGCTCCTGTCTCC 209 G1c
CTAG2 R CTCCTCCAGCGACAAACAAT
Окончание табл. 1
1 2 3 4 5 6 7 8
ДАМ Дифференцировочные антигены меланомы. Компоненты меланосомы участвуют в меланогенезе. Незрелые меланосомы характерны для меланомы и фетальных клеток и распознаются моноклональными антителами НМВ45. В зрелых меланосо-мах, преобладающих в меланоцитах, антиген gp100 (PMEL17) продукт гена SILV экранирован от НМВ45
SILV SILV NM_6 928 F GGGCCAATACTGGCAAGTTCTAGG 375 G2c
R AGGTAAGTATGAGTGACCACAAGTGC
MLANA MLANA NM_5 511.1 F GCTCATCGGCTGTTGGTATT 190 G2c
R ATAAGCAGGTGGAGCATTGG
TYR TYR NM_372.3 F AGCTTTCAGGCAGAGGTTCCTGTC 290 G2c
R GGTATGCTTTGCTAAAGTGAGGTAGG
S100 Са-связывающий белок из семейства S100. Белок вовлечен в регулирование развития клеточного цикла и дифференцировки. Маркер меланомы
S100B S100B NM_6 272.1 F AGCCCGCCATGGCCGTGTAGAC 257
R CCAGCGCTGAGCGTTCACCTGG
HLA Гены, кодирующие белки главного комплекса гистосовместимости
HLA-E HLA-E, HLA-A, HLA-C, HLA-G NM_2 127.3 F GTGACTCACCACCCCATCTC 215
R TGGCACGTGTATCTCTGCTC
HLA-G HLA-G NM_2 127.3 F TATGAACAGTATGCCTACGATGGCAAG 306
R TATGATCTCCGCAGGGTAGAAGCC
ГДХ Ген «домашнего хозяйства». Ген глицеральдегидфосфодегидрогеназы
G3PDH GAPDH NM_2 046.3 F ACCACAGTCCATGCCATCAC 452
R TCCACCACCCTGTTGCTGTA
Примечание: * - F — прямой праймер, R — обратный праймер- ** - см. рис. 3- ***- приведены названия всех генов, хотя бы одна из альтернативных версий мРНК которых амплифицируется использованной парой праймеров- **** - описание каталожного номера мРНК: http: //www. ncbi. nlm. nih. gov/genome/guide/human/release_notes. html,
nlm. nih. gov/BLAST/. Для гена глицеральдегид-3 фосфат дегидрогеназы использовались праймеры G3PDH 0. 45 kb Control Amplimer Set фирмы CLONTECH (Mountain View, USA). Для реакции обратной транскрипции (ОТ) использовали обратную транскриптазу M-MLV и реактивы фирмы (Promega, Madison, USA). Объём пробы составлял 25 мкл. Сначала смешивали 1 мкг РНК с 25 пмолями смеси, случайных наномеров (Синтол, Москва, Россия) в 5 мкл воды. Смесь прогревали при 70oC 5 мин и охлаждали во льду. Затем добавляли 20 мкл смеси, содержащей 5x M-MLV буфер, 3 мкМ MgCl2, смесь дезок-синуклеотидтрифосфатов в концентрации 0,2 мМ каждого, 200 ед. обратной транскриптазы. Реакционную смесь инкубировали при 37 °C 60 мин. Реакцию останавливали прогреванием (95°C, 5 мин). Полученную одноцепочечную кДНК хранили при -20°C. Полимеразную цепную реакцию (ПЦР) проводили в программируемом термостате фирмы Hybaid, (Waltham, USA). кДНК (1/100 часть) амплифицировали с 0,5 мкМ ген-специфических олигонуклеотидов и 2,0 ед. ДНК-полимеразы Thermus Aquaticus
(БиоМастер, Москва, Россия). Амплификацию проводили в 20 мкл смеси, содержащей 0,01 М Трис-HCl (pH 8,5 при 25°C), 0,05 M KCl, 0,002 M MgCl2, 10 мкг/мл желатина, 200 мкМ каждого dNTP, 200 мкг/мл антител «TaqStart» (CLONTECH, Mountain View, USA). Для всех опытов ПЦР проводили по схеме: 94оС — 30 сек, 60оС — 60 сек, 72оС — 1 мин — 35 циклов. 72оС — 7 мин. Результаты анализировали электрофорезом 5 мкл реакционной смеси в 1,0% или 1,5% агарозном геле в TAE буфере с 0,002% бромистого этидия. В качестве положительного контроля ОТ-ПЦР использовали ген GAPDH (относящийся к группе «генов домашнего хозяйства»). В качестве маркёра длин использовали GeneRuler™ 1kb DNA Ladder (Fermentas, Glen Burnie, USA, http: //www. fermentas. com/catalog/ markers/marksm0311. htm). Специфичность выявляемого сигнала подтверждали отсутствием продукта амплификации ожидаемого размера в параллельных пробах, где на стадии обратной транскрипции фермент не добавлялся.
Фотографии гель-электрофореза продуктов ПЦР были оцифрованы при помощи программы
ImageQuant (Molecular Dynamics, Sunnyvale, USA) и результаты представлены в произвольных единицах. Иерархическое двухмерное кластерирование данных ОТ-ПЦР проводили при помощи программы Майкла Эйзена «Gene Cluster v3». Результаты визуализировали с помощью программы «Tree View» [2].
Результаты и обсуждение
Проведено исследование клеточных линий, полученных от больных с диссеминированной меланомой [1]. Исследована экспрессия опухолевыми клетками четырех дифференци-ровочных антигенов меланомы (ДАМ) и 15 раково-тестикулярных генов (РТА), а также контрольные гены — HLA-G, HLA-E, GAPDH. На рис. 1 приведены электрофореграммы продуктов ОТ-ПЦР анализа ряда генов, по два представителя от каждой группы генов, выявленных с помощью кластерного анализа.
Изучение цитоморфологических особенностей меланомных клеток и определение степени дифференцировки были осуществлены для 16 из этих клеточных культур. Для этого определяли тип и размер клеток, форму и контур ядра, характер ядерной мембраны, строение хроматина и его окрашиваемость, наличие ядрышек, количество гигантских многоядерных клеток и
долю клеток, находящихся в митозе. При цитологической верификации выделено 9 культур, состоящих из эпителиоподобных клеток (E), различного уровня дифференцировки, три культуры из невусоподобных клеток (N), одна культура из веретенообразных клеток (V) и три культуры смешанного клеточного состава.
При цитоморфологическом исследовании выделено три группы, классифицированные как высокодифференцированные (H), умереннодифференцированные (I) и низкодифференцированные (L) (табл. 2). Высокодифференцированные (H, 1) клеточные линии Mel min-12, Mel min-11 (рис. 2а) представлены относительно мономорфными клетками небольшого размера, с небольшим количеством гигантских многоядерных клеток- митозы практически отсутствуют. Модальное число хромосом в обеих клеточных линиях соответствовало околодиплоидному набору (46−49 хромосом в клетках культуры Mel min-11 и 47−50 хромосом в Mel min-12). Общее число хромосомных повреждений на 1 клетку составило в одной культуре 4, а во второй — 5. Умереннодифференцированные (I, 2^ клеточные линии Mel min-9, Mel IL, Mel P, Mel min-10 (рис. 2б.) представлены полиморфными клетками: мелкими, средними и крупными- с интенсивно
Рис. 1. Электрофореграммы продуктов OT-ПЦР анализа генов.
OT-ПЦР анализ уровня транскрипции 22 генов в 6 клеточных линиях меланомы: Mel min-12, Mel min-10, Mel IL, Mel min-14. Mel min-1, Mel Ibr. Уровень экспрессии анализировался для генов: 1 — BAGE- 2 — GAGE2- 3 — GAGE3- 4 — GAGE4- 5 — HLA-E-
6 — MAGEA2- 7 — MAGEA4- 8 — MAGEA6- 9 — MAGEA10- 10 — MAGEA12- 11 — MAGEB1- 12 — MAGEB2- 13 — MAGEC1-
14 — MLANA- 15 — CTAG1B- 16 — TYR- 17 — SILV- 18 — S100B- 19 — MAGEA1- 20 — MAGEA3- 21 — HLA-G- 22 — GAPDH.
23 — контрольный OT-ПЦР без добавления праймеров — T — обратная транскрипция с ферментом, N — обратная транскрипция без фермента. M — маркёр длиныHK, длины фрагментов даны в парах нуклеотидов
базофильной цитоплазмой, без четких контуров или с фестончатыми краями с эксцентрично или центрально расположенными ядрами с грубоглыбчатым гиперхромным хроматином и одним, редко двумя-тремя ядрышками. Гигантские многоядерные клетки немногочисленны- умеренное количество клеток в митозе. Число хромосомных аномалий в культурах было от 5 до 8 на 1 клетку.
Низкодифференцированные (L, З) клеточные линии (Mel Kor, Mel min-2, Mel min-1, Mel min-3, Mel min-4, Mel Ibr, Mel min-5, Mel min-б, Mel min-7, Mel min-8) представлены резкополиморфными клетками, с множеством гигантских уродливых клеток и ядер. Выявлено большое количество округлых, овальных, удлиненных, неправильных ядер с неровными контурами. Хроматин грубоглыбчатый, ядерная оболочка утолщена и неровная- ядрышки в количестве от одного до шести в ядре- выраженная гипер-хромия. Отмечены атипичные многочисленные митозы. В пяти культурах модальное число хромосом соответствовало триплоидному набору, в двух — тетраплоидному и две были околодиплоидными. Число хромосомных аномалий во всех низкодифференцированных культурах было больше 5 на 1 клетку, в частности, в диплоидной культуре Mel min-2 оно достигло 11. Обнаружен также высокий уровень нестабильных хромосомных аберраций: хроматидные обмены, ди- и трицентрические хромосомы, кольцевые хромосомы, клетки с множественными аберрациями. Среди крайне разнообразных числовых и структурных хромосомных нарушений (транслокации, делеции, дупликации, инверсии, кольцевые хромосомы, изохромосомы, маркерные хромосомы) некоторые встречались с высоким постоянством, в том числе трисомия по хромосоме 7 или по ее короткому плечу, трисомия по короткому плечу хромосомы б, моносомия по короткому плечу хромосомы 9, различные транслокации с участием хромосомы 1. Пример культуры клеток Mel min-5, состоящей приблизительно поровну из веретенообразных и эпителиальных клеток, показан на рис. 2 В.
Исследования экспрессии генов РТА и ДАМ и последующий двумерный иерархический кластерный анализ данных ОТ-ПЦР позволили
Рис. 2. Морфологические типы культур меланомы:
а) высокодифференцированная клеточная линия Mel min-11, х400-
б) умереннодифференцированная клеточная линия Mel IL, х400-
в) низкодифференцированная клеточная линия Mel min-5, х400
Таблица 2
морфогенетическая характеристика клеточных линий метастатической меланомы
человека
Степень дифференцировки опухолевых клеток Число линий Имя линии Тип* линии F* № кла- стера Экспрессия генов кластера. Среднее по кластеру **
G1a G1b G1c G2a G2c
Высокодифференцирован- ные 2 Mel min-11 H 1 E 1 70 37 б9 18б 1б90
Mel min-12 H 1 V, E 1 бб 24 Зб 19 1374
Умереннодиффференциро- ванные 4 Mel min-10 I 2 E 2 11б б0б 1бЗ 4б8 б4
Mel IL I 2 V 3 7б 447 бЗ 881 12б9
Mel P I 2 E 3 27 207 118 1429 13б0
Mel min- 9 I 2 N
Низкодифференцированные 10 Mel min- б L 3 V, E 4 937 37 82б 14б9 б89
Mel min- 8 L 3 E 4 99 1204 1328 1б8б 1427
Mel Kor L 3 E б 48 30б 1100 1078 947
Mel min- 1 L 3 V б 1б 1211 99б 1бб9 1б70
Mel min- 2 L 3 E б бб8 99б 342 1201 1413
Mel min- 3 L 3 E б 20 782 573 1300 149б
Mel Ibr L 3 N б б11 940 111б 1397 123
Mel min- 4 L 3 E б бб б8б 104б 119б бб
Mel min- б L 3 E б 22 б0б 583 120б Зб
Mel min- 7 L 3 E б 220 744 848 1б9б б0
Коэффициент корреляции по Спирману по отношению к морфологическому типу клеток Х № кла- стера G1a G1b G1c G2a G2c
0. 92 0. 31 0. бб 0. 79 0. 87 -0. 34
Коэффициент корреляции по Пирсону по отношению к экспрессии ДАМ генов ^2с).
-0. 19 -0. 09 -0. 2б -0. 14 Х
Примечание: тип * - морфологический тип клеточных линий ранжирован в порядке убывания степени дифференцированности клеток, используя буквенный и цифровой коды: Н=1 — мономорфные клетки- небольшое количество клеток в митозе- небольшое количество гигантских, многоядерных клеток- 1=2 — клетки мелких, средних и крупных размеров- с интенсивно-базофильной цитоплазмой, без четких контуров или с фистончатыми краями с эксцентрично или центрально расположенными ядрами с грубоглыбчатым гиперхромным хроматином и одним, редко двумя-тремя ядрышками. Гигантские многоядерные клетки немногочисленны- умеренное количество клеток в митозе- L=3 — округлые, овальные, удлиненные, неправильные ядра с неровными контурами. Хроматин грубоглыбчатый, ядерная оболочка утолщена и неровная- ядрышки в количестве от одного до 6 в ядре- выраженная гиперхромия и много гигантских уродливых клеток и ядер. Отмечаются атипичные относительно многочисленные митозы. F* - форма основной части клеток линии: е — эпителиоподобная, V — веретенообразная, п — невусоподобная.
** - произвольные единицы (см. раздел «Материал и методы»)
выделить шесть групп клеточных линий (рис. 3). Культуры клеток, отнесенные к кластеру 1, являются высокодифференцированными, к кластерам 2 и 3 — умереннодифференцированными, тогда как к кластерам 4, 5 и 6 — низкодифференцированными. Сопоставление «морфологических» и «генетических» групп, представленных в табл. 2, указывает на отчетливую корреляцию
между делением клеточных культур в соответствии с экспрессий РТА и ДАМ генов и классификацией культур по степени их диффе-ренцировки. Коэффициент корреляции между морфологическими ранжироваными данными и кластерным ранжировнием экспрессионных данных составляет 0,92. Степень дифференци-ровки клеток, как графически отображено на
экспрессия раково-тестикулярных Антигенов в клеткАх меллномы человекА
0. 25 5 а.
а
11iii=±1111llllllll клетки
О 0.2 5 0.5 0. 75 1.0 50& lt- 450 g50 & gt-12s
коэффициент корреляции уровень экспрессии
Рис. 3. Двумерный кластерный анализ экспрессии генов РТА и ДМА методом ОТ-ПЦР в культурах клеток меланомы. Представлены результаты полносвязного кластерирования (по обоим направлениям) данных по экспрессии 22 генов в 21 культуре клеток, полученных от пациентов с диссеминированной меланомой. Кластерированию подвергался весь набор логарифмированных по основанию 2 данных ОТ-ПЦР, нормированных для каждой культуры на среднюю величину интенсивности полос ОТ-ПЦР генов HLA-G1, HLA-E и GAPDH для каждой клеточной линии. Никакой последующей центровки или нормировки данных не производилось. Для расчета меры несходства узлов дендрограмм использовалась корреляция по Спирману или эвклидово расстояние и коэффициент корреляции Пирсона, с одинаковым результатом. Цветовая шкала, приведенная на двумерной кластерной картине и на врезке, соответствует исходной интенсивности полос на электрофореграммах, а не их логарифмированному преобразованию, использованному для расчета связности при кластерировании. Гены обозначены символами в соответствии с табл. 1, культуры клеток — с табл. 2. Шкалы коэффициентов корреляции генов (слева) и культур клеток (сверху) отвечают корреляции для узлов дерева. Для дендрограмм использованы коэффициенты корреляции по Пирсону.
При кластерировании для зондов генов с вырожденной специфичностью использованы весовые коэффициенты, обратно пропорциональные числу зондов, соответствующих их вырожденности: для GAGE-1−8 и GAGE-4−7 — 0,5- для MG-A3, MG-A2, MG-A6, MG-A12−236 — 0,25- ^А^ иА-А — 0,5. Дендрограмма культур клеток однозначно разбивает все клеточные линии на 6 групп, отсеченных по коэффициенту корреляции 0,75
рис. 3, падает слева направо, сопровождается ростом числа и степени экспрессии генов РТА. При этом форма клеток, эпителиальная, веретенообразная или невусоподобная, не коррелирует ни со степенью дифференцированности клеток, ни с экспрессией РТА (табл. 2.). Интересно отметить, что экспрессия ДАМ генов, в значительной степени изменяющаяся от кластера к кластеру (например, 1 и 2 или 5 и 6), не коррелирует ни со степенью дифференцировки клеток, ни с их формой, ни с активностью генов РТА.
Дендрограмма коэффициента корреляции групп генов (рис. 3, левая сторона) показывает распределение всех исследованных генов на 6 основных групп: G1a, Gib, G1c и G2a принадлежат раково-тестикулярным генам, G2b — генам главного комплекса гистосовместимости и генам домашнего хозяйства, а G2c — дифференцировоч-ным генам. Отдельного внимания заслуживают гены S100B, показывающие менее чем 75% корреляцию с другими ДАМ генами, и ген CTAG1B (NY-ESO1), также отличающийся по экспрессии от ближайшего к нему семейства РТА генов (MAGEA1, MAGE-A10, MAGE-C1 & amp- BAGE). Как видно из рис. 3, высокодифференцированные клетки практически не экспрессируют никаких РТА, крайне низка экспрессия РТА и в клеточных культурах 16 и 10, принадлежащих кластеру 2, полностью утративших активность генов ДАМ и отнесенных к группе умереннодифференцированных клеток. У этой группы клеточных культур, утратившей способность к синтезу мРНК генов ДАМ, наблюдается некоторая невысокая активность кластера генов G2a (ампликоны MG-A2, MG-A3, MG-A6 и MG-A12−236, отражающие экспрессию группы высокогомологичных генов MAGE-A2, MAGE-A3, MAGE-A6, MAGE-A12), но она все же заметна и проявляется систематически. В кластерах 3, 4, 5 и 6 активность этой группы генов очень велика (рис. 3). Активность группы генов Gib и Gic систематически проявляется только в низкодифференцированных культурах. Тогда как активность генов MAGE-B1 и MAGE-B2, принадлежащих группе Gia, проявляется только спорадически во всех клеточных линиях. Корреляции между морфологическими данными и уровнем экспрессии генов всех обсуждаемых групп генов суммированы в табл. 2. Видно, что активность генов в группах Gia и
Таблица 3
Корреляция между экспрессией генов, определенной от-пЦр и иммунологически
Экспрессия антигенов Экспрессия ДАМ генов** Усредненная по кластерам экспрессия генов**
Имя линии О ^ w 5 о ч 0 a & amp- p a 1 Кластер клеточных линий # I 1 el /Tyrosinase 0 0 P м у j? T § оо m 0 о оо 3 см a S 3 см 1b О 3 см о S 3 см a 2 О 2 о 2 о
Mel min-18 1 1534 1093 1800 86 60 27 23 40 1476
Mel min-12 H 1 1 1 0 1 10.5 1305 1333 1483 971 55 24 35 19 1374
Mel min-11 H 1 1 0 1 1 62.0 1548 1705 1516 921 70 37 59 185 1590
Mel min-16 2 55 27 39 36 227 45 74 285 40
Mel min-10 I 2 2 0 0 0 11.7 20 16 156 101 115 606 163 468 64
Mel Il I 2 3 1 1 1 46.9 1150 1374 1255 556 76 447 53 881 1259
Mel P I 2 3 0 0 1 89.5 1121 1537 1421 925 27 207 118 1429 1360
Mel min- 9 I 2 1 0 1 4. 8
Mel min-17 3 110 1632 1829 589 31 454 224 1257 1190
Mel min- 8 L 3 4 0 0 0 67.6 522 1246 1074 1354 48 306 1100 1078 947
Mel min-15 4 18.0 1576 1687 1314 636 94 66 586 1228 1526
Mel min- 5 L 3 4 0 1 1 3.8 255 531 1280 172 937 37 826 1459 689
Mel min-14 4 0 85 401 114 45 250 189 359 1527 200
Mel min- 2 L 3 5 1429 1353 1457 785 668 995 342 1201 1413
Mel min- 3 L 3 5 1551 1519 1419 1011 20 782 573 1300 1496
Mel min- 1 L 3 5 0 0 1 35.7 1579 1565 1565 702 16 1211 995 1569 1570
Mel Kor L 3 5 1 1 1 64.8 1503 1438 1340 997 99 1204 1328 1585 1427
Mel Ibr L 3 6 0 0 0 25.3 27 90 251 864 511 940 1115 1397 123
Mel min-13 6 0 0 0 91.8 15 76 106 809 114 885 1076 1264 66
Mel min- 4 L 3 6 30 30 104 1006 56 686 1046 1196 55
Mel min- 7 L 3 6 0 0 0 74 35 40 12 220 744 848 1595 50
Mel min- 6 L 3 6 0 0 0 27 31 50 395 22 605 583 1206 36
KK * х 0. 92 -0. 35 -0. 12 -0. 45 0. 04 -0. 33 -0. 36 -0. 32 -0. 08 0. 31 0. 65 0. 79 0. 87 -0. 34
х 0. 54 0. 45 0. 44 0. 27 -0. 23 0. 03 -0. 17 -0. 30 0. 49
х 0. 43 0. 41 0. 50 -0. 024 0. 31 -0. 21 -0.1 -0. 08 0. 45
х 0. 85 0. 81 0. 91 0. 21 0. 02 -0. 28 -0. 35 -0. 14 0. 88
х 0. 08 0. 19 -0. 019 0. 59 -0. 47 0. 22 0. 16 0. 24 0. 09
Примечание: КК* - коэффициент корреляции между отмеченным крестом столбцом и уровнем экспрессии гена или кластера генов. ** - произвольные единицы (см. раздел «Материал и методы»)
G2c не коррелирует с морфологической классификацией линий клеток, тогда как активность РТА генов групп G1b G1c и G2a имеет высокую степень корреляции с морфологической классификацией.
Ранее клеточные линии были охарактеризованы по экспрессии дифференцировочных антигенов меланомы [1]. Для этого использовались следующие маркеры меланомы: моноклональные антитела к HMB45 и HMW, -распознающие соответственно в незрелых меланоцитах белок gp100/PMEL17, продукт гена SILV, и MCSP — высокомолекулярный ме-ланомный хондроитин-сульфатный протеогли-кан (melanoma chondroitin sulfate proteoglycan). Также были использованы антитела к Tyrosinase и MelanA/MART-1 — продуктам генов TYR и MLANA соответственно, которые, так же как и продукт гена SILV, являются компонентами меланосом. В табл. 3 продемонстрированы результаты сравнения иммунологических данных с результатами измерения концентрации мРНК. Отмечено отсутствие корреляции между результатами морфологического исследования и любыми иммунологическими измерениями- наиболее значимая величина получается для антикорреляции HMW антител и не превышает 0,45. Соответственно, и активность ни одного из ДАМ генов, ни РТА генов группы G1a не коррелирует с морфологическими данными. Напротив, активность генов групп G1c и G2a коррелирует с морфологическими данными с коэффициентом более 0,75. Иммунологические данные для MelanA не имеют высокой корреляции с экспрессией гена MLANA (0,54), тогда как иммунологические данные для НМВ45 имеют высокую степень корреляции с активностью гена SILV (0,91). Необходимо также отметить высокую степень корреляции данных для НМВ45 с экспрессией других компонент меланосом, которые почти синхронно проявляются в различных линиях (рис. 3). Неожиданно высоким оказался коэффициент корреляции экспрессии гена S100B и антигена HMW.
Полученные результаты свидетельствуют о том, что между степенью дифференцировки клеточной культуры и уровнем экспрессии РТА генов существует корреляция, определяемая, вероятно, частотой митозов. Соответствующие коэффициенты корреляции между степенью дифференцированности, уровнем экспрессии генов групп G1a, G1e, G1c, G2a, G2c и морфологическим типом равны соответственно 0,3, 0,65, 0,79, 0,87 и — 0,34 (табл. 3). Следует также отметить отсутствие корреляции между экспрессией генов ДАМ и РТА (коэффициент корреляции варьирует между 0,25 и 0,09) (табл. 2), а также между экспрессией генов ДАМ и степенью дифференцировки клеток в культуре (коэффициент корреляции — 0,34).
Таким образом, наличие корреляции между уровнем экспрессии раково-тестикулярных генов и степенью дифференцировки клеток предоставляет возможность количественно оценить степень злокачественности опухолевых клеток меланомы и дать более точный клинический прогноз течения заболевания и дальнейший выбор лечения.
Работа выполнена при финансовой поддержке Правительства г. Москвы в рамках научно-технической программы «Разработка и внедрение в медицинскую практику новых методов и средств диагностики и лечения онкологических и других заболеваний».
ЛИТЕРАТУРА
1. Михайлова И. Н., Лукашина М. И., Барышников А. Ю. и др. // Вестник Российской АМН. 2005. № 7. С. 37−40.
2. Eisen M.B., Spellman P.T., Brown P.O. et at. // Proc. Natl. Acad. Sci. USA. 1998. Vol. 95 (25). P. 14 863−14 868.
3. Gure A.O., Chua R., Williamson B. et al. // Clin. Cancer Res. 2005. Vol. 11 (22). P. 8055−8062.
4. Kirkin A.F., Dzhandzhugazyan K., Zeuthen J. // APMIS. 1998. Vol. 106 (7). P. 665−679.
5. Restifo N.P., Esquivel F, Kawakami Y. et al. // J. Exp. Med. 1993. Vol. 177 (2). P. 265−272.
6. Scanlan M.J., Simpson A.J., Old LJ. // Cancer Immun. 2004. Vol. 4. P. 1−15.
7. Simpson A.J., Caballero O.L., Jungbluth A. et al. // Nat. Rev. Cancer. 2005. Vol. 5 (8). P. 615−625.
Поступила 16. 11. 09

ПоказатьСвернуть
Заполнить форму текущей работой