Количественная оценка мутации V617F гена JAK2 при хронических миелопролиферативных заболеваниях

Тип работы:
Реферат
Предмет:
Медицина


Узнать стоимость

Детальная информация о работе

Выдержка из работы

9. Павлов А. Д., Морщакова Е. Ф., Румянцев А. Г. // Соврем. онкол. — 2002. — Т. 4, № 2. — С. 50−54.
10. Павлов А. Д., Морщакова Е. Ф., Румянцев А. Г. Эритропоэтин: биологические свойства, возрастная регуляция эритропоэза, клиническое применение. — М., 2002.
11. Погорелов В. М., Козинец Г. И., Ковалева Л. Г. Лабораторно-клиническая диагностика анемий. — М., 2004.
12. Рекормон. Инструкция по медицинскому применению препарата. Регистрац. номер 14 262/02. Одобрено Ф К МЗ РФ 14. 03. 02, прил. № 5.
13. CoiffierB, Guastalla J. P., Pujade-LauraineE. et al. // Eur. J. Cancer. — 2001. — Vol. 37. — P. 1617−1623.
14. Glaspy J. A., Jadeja J. S., Justice G. et al. // Cancer. — 2003. — Vol. 97. — P. 1312−1320.
15. Hguyen N. B., Callaghan K. D., Ghio A. J. et al. // Am. J. Physiol. Lung Cell. Mol. Physiol. — 2006. — Vol. 291, N 3. — P. 417−425.
16. Thews O, KelleherD., VaupelP. // Cancer Res. — 2001. — Vol. 61. — P. 1358−1361.
Поступила 24. 03. 11
© КОЛЛЕКТИВ АВТОРОВ, 2012 УДК 616. 15. 191−092:612.6. 05]-074
А. О. Абдуллаев, О. А. Глинщикова, С. А. Суслова, Н. X. Шадиева, Л. Ю. Колосова, Л. М. Мещерякова, М. В. Вахрушева, А. Б. Судариков
количественная оценка мутации V617 °F гена JAK2 при хронических миелопролиферативных заболеваниях
ФГБУ Гематологический научный центр Минздравсоцразвития Р Ф, Москва
Мутацию V617 °F гена JAK2 выявляют у 95% пациентов с истинной полицитемией, у 50% с эссенциальной тромбоцитемией и идиопатическим миелофиброзом. Мутация V617 °F может использоваться как молекулярный маркер ответа на лечение у больных с хроническими миелопролиферативными заболеваниями (ХМПЗ), ассоциированными с этой мутацией. Мы описываем метод количественного определения V617 °F (с чувствительностью до 0,01%) с помощью полимеразно-цепной реакции, который применим для оценки минимальной остаточной болезни у больных с ХМПЗ.
Ключевые слова: хронические миелопролиферативные заболевания, мутация V167 °F гена JAK2, количественная ПЦР
A.O. Abdullayev, O.A. Glinschikova, S.A. Suslova, N. Kh. Shadiyeva, L. Yu. Kolosova, L.M. Mescheryakova, M.V. Vakhrusheva,
A.B. Sudarikov
THE QUANTITATIVE EVALUATION OF MUTATION V617 °F OF GENE JAK2 UNDER CHRONIC MYELOPROLIFERATIVE DISEASES
The mutation V617 °F of gene JAK2 is detected in 95% of patients with genuine polycythemia, in 50% of patients with essential thrombocytemia and idiopathic myelofibrosis. The mutation V617 °F can be applied as a molecular marker of response to treatment in patients with chronic myeloproliferative diseases associated with this mutation. The technique of quantitative evaluation of V617 °F (sensitivity up to 0. 01%) using polymerase chain reaction is described. This method can be applied to assess the minimal residual disease in patients with chronic myeloproliferative diseases.
Key words: chronic myeloproliferative diseases, mutation V617 °F of gene JAK2, quantitative polymerase chain reaction
Введение. Хронические миелопролиферативные заболевания (ХМПЗ) — группа Ph-негативных заболеваний, характеризующихся клональными нарушениями гемопоэтической полипотентной стволовой клетки и физиологически невостребованной клональной гиперпролиферацией одного, двух-или трех ростков миелопоэза с образованием очагов экстрамедуллярного кроветворения.
Наиболее распространенными среди ХМПЗ [4, 22] являются истинная полицитемия (ИП- описана в 1892—1903 гг. L. Vagues и W. Osler), распространенность которой составляет 1−1,5: 100 000 населения, далее идут идиопатический мие-лофиброз (ИМФ- описан в 1879 г. G. Heuck) и эссенциальная тромбоцитемия (ЭТ- описана в 1934 г Е. Epstein). Также по классификации ВОЗ (2008) к ХМПЗ относят казуистически редко встречаемый хронический нейтрофильный и эозино-фильный лейкозы, мастоцитоз и неидентифицируемые ХМПЗ,
Для корреспонденции:
Абдуллаев Адхам Одилович, науч. сотр. лаб. молекулярной гематологии
Адрес: 125 167, Москва, Новый Зыковский пр., 4 Телефон: (495) 612−65−11 E-mail: adham_abdullaev@mail. ru
а также PDGFRa, PDGFRp, FGFRl-генассоциированные лейкозы [10, 23, 24]. Относительная схожесть клинико-морфологической картины (клональная гиперпродукция клеток миелоидного ряда, приводящая к фиброзным изменениям и истощению ресурсов костного мозга), нарушение реологических и коагуляционных свойств крови, образование экстрамедуллярных очагов патологического гемопоэза и относительно медленное хроническое клиническое течение позволили предположить схожие механизмы лейкемогенеза перечисленных заболеваний [14, 15].
Существенный прогресс в понимании молекулярного лейкемогенеза ХМПЗ произошел в 2005 г, когда была обнаружена точечная мутация 184G/T в гене JAK2, приводящая к замене валина на фенилаланин в 617-м кодоне [3, 9, 11, 15, 19, 27].
JAK2 (Janus kinase, a protein tyrosine kinase) цитоплаз-матическая тирозинкиназа, участвующая в передаче сигнала по пути & quot-JAK-STAT"- (Signal transducers and activators of transcription) [5, 13, 21, 26]. После связывания рецепторов с лигандами (эритропоэтин, тромбопоэтин и факторы роста: интерлейкин (IL) 3 и G-CSF) активированный белок JAK2 инициирует процесс димеризации STAT белков, они проникают в ядро клетки и сами или с участием других белковых факторов индуцируют транскрипцию генов, являющихся
& amp-k$S Шк
Рис. 1. Кровь пациента (а) и клеточная линия UKE1 (б). Окраска по Паппенгейму. Ув. 1000.
мишенью соответствующего цитокина. Мутация V617 °F нарушает аутоингибиторное взаимодействие между JH2-доменом и киназной областью и повышает киназную активность JAK2 белка. Клинико-фенотипически это проявляется JAK2V617F-зависимой клональной пролиферацией клеток-предшественников миелоидного ростка кроветворения. Эти открытия убедительно подтвердили результаты предыдущих исследований, доказывающих наличие клональности [1, 6, 8] и эксперименты с JAK2-киназой на модели мышей [17, 25].
В дальнейшем начали появляться сообщения об использовании количественного измерения доли клеток с мутацией JAK2V617 °F при оценке молекулярного ответа на лечение [12, 16, 18].
В 2009 г. European LeukemiaNet [2] предложены новые критерии молекулярного ответа на лечение ЭТ и ИП, согласно которым различают три типа молекулярного ответа (полный, частичный и отсутствие). Полный молекулярный ответ — снижение количества клеток с мутацией до недетектируемого уровня. Частичный молекулярный ответ: 1) уменьшение более чем на 50% количества клеток с мутантным аллелем при первоначальном уровне мутации более 50%- 2) уменьшение более чем на 25% количества клеток с мутантным аллелем при первоначальном уровне мутации менее 50%. Отсутствие молекулярного ответа — это любой ответ, неудовлетворяющий критериям частичного молекулярного ответа.
В том же в 2009 г. были опубликованы [20] результаты сравнительного изучения эффективности различных методов количественной оценки JAK2V617 °F мутации, проводимых в европейских странах. Работа шла в два этапа в 16 исследовательских центрах Европы с использованием различных методов (Tagman qPCR, TagMan AS-qPCR, AS-PCR и DNA sequencing) и стандартов (клеточная линия HEL, ДНК пациентов, плазмиды с фрагментом гена JAK2V617 °F, клеточная линия UKE1). На первом этапе проводили количественную оценку JAK2V617 °F — мутации в 29 образцах (26 положительных и 3 отрицательных) ДНК пациентов с ЭТ и ИП. На следующем этапе с целью стандартизации применяемых методов и стандартов в исследование были включены ДНК больных, плазмиды, клеточные линии (HEL/Karpas 199 и UKE1). Из клеток UKE1 и лейкоцитов здоровых лиц были получены пулы клеток (с содержанием клеток UKE1: 100, 75, 50, 25, 10 и 1%) для дальнейшего выделения с вышеуказанным содержанием количества JAK2V617F-копий ДНК UKE1. Из всех проанализированных методов количественной оценки мутации JAK2V617 °F наиболее высокоспецифичным и высокочувствительным (0,2%) оказался метод Tagman As-qpcR с обратными аллельспецифичными праймерами и одним мисматч-нуклеотидом. Сиквенсовые методы по специфичности (1 ложноположительный и 6 ложноотрицательных
результатов в двух центрах) и чувствительности (5%) значительно уступали TagMan AS-qPCR.
Учитывая назревшую клинико-диагностическую необходимость количественной оценки мутации JAK2V617 °F у наших больных, а также высокую стоимость импортных ПЦР тест-систем для таких целей (Ipsogen), мы решили разработать собственную тест-систему ПЦР в реальном времени (РВ) для количественной оценки мутации V617 °F гена JAK2.
Материалы и методы. Всего обследовано 244 пациента с направительным диагнозом ИП (n-31), ИМФ (n-59) и ЭТ (n-54), а также 100 с различными миелопролиферативными нарушениями симптоматического характера в возрасте от 5 до 80 лет.
В качестве положительного контроля использовали ДНК клеточной линии UKE1. Клеточная линия UKE1 (предоставлены проф. В. Fehse из Uniclinik Eppendorf, Германия) представляет собой культуру клеток с гомозиготной мутацией V617 °F гена JAK2.
Лейкемические клетки UKE1 получены от пациента с миелодиспластическим синдромом, и по данным FISH, ПЦР и иммуногистологических исследований для них характерны эндотелиальные, гематопоэтические и лейкемогенные свойства [7]. Морфологически эти клетки могут быть подразделены на большие, прикрепляющиеся к стенкам флакона клетки с видными вакуолями, и меньшие, не прикрепляющиеся. Некоторые клетки напоминают зрелые гранулоциты и способны дифференцироваться спонтанно по миелоидной линии (рис. 1- с изменениями [7]).
Клетки UKE1 выращивали в С02-инкубаторе (5% CO2) в модифицированной среде (Iscove modified Dulbecco medium, IMDM) Dulbecco, содержащей эмбриональные 10% сыворотки теленка (fetal calf serum, FCS) и лошади, а также 1 мМ гидрокортизона.
Отрицательным контролем служила ДНК, выделенная из ядерных клеток периферической крови донора.
Выделение ДНК. Взвесь ядерных клеток крови была получена методом лизиса эритроцитов. Далее к взвеси клеток добавляли 600 мкл лизирующего буфера (Tris-Cl (pH 7,6) 1М — 100 мл, EDTA (pH 8,0) 0,5 М — 80 мл, NaCl 1М — 50 мл, SDS 10% - 20 мл, вода 750 мл) и полученную смесь доводили до гомогенного состояния. Осаждение белков осуществляли добавлением 200 мкл насыщенного раствора NH4CL и центрифугированием 10 мин при 13 400 об/мин. Образовавшийся супернатант (300 мкл) переносили в заранее приготовленную пробирку, содержащую 300 мкл изопропанола, и для осаждения ДНК центрифугировали 10 мин при 12 000 g. Осадок ДНК дважды промывали 70% этиловым спиртом (500 мкл), высушивали при комнатной температуре с открытой крышкой и растворяли в 200 мкл деионизированной во-
Рис. 2. Электрофореграмма. K- - отрицательный контроль (вода) — Р1 и Р2 — ДНК больных ИП- D и D2 — ДНК доноров- UKE1 ДНК из клеток UKE1- UKEl+Dj — смесь (1: 5) ДНК UKEI и донора- MW (molecular weight) — маркер молекулярной массы.
дой. Концентрацию ДНК определяли на спектрофотометре Beckman DU-64.
Real-time TaqMan PCR. Количественную ПЦР в реальном времени проводили с использованием набора реактивов и ам-плификатора АНК-32 (& quot-Синтол"-, Россия). ПЦР осуществляли в смеси растворов с конечным объемом 25 мкл: ПЦР буфер 10×2,5 мкл- dNTP (& quot-Promega"-) 50×0,5 мкл- 2 пары праймеров по 7,5 пкмоль каждый- 2 флюоресцентные ПЦР зонды по 3 пкмоль- ДНК Taq полимеразы 5 ед/мкл (& quot-Синтол"-, Россия) 0,25 мкл- ДНК матрица 125 нг Амплификации проводили в следующем режиме: при 95 °C 300 с, 50 циклов при 95 °C 15 с и при 60 °C 60 с. Использовали олигонуклеотиды: Fw primer (общий) 5'--CTTTCTTTGAAGCAGCAAGTATGA-3'--Probe (зонд) 6-FAM-TGAGCAAGCTTTCTCACAAGCATTTGGTTT-TAMRA- Wd_R primer 5'--GTAGTTTTACTTACTCTCGTC-TCCACAtAC-3'-- Mt_R primer 5'--GTAGTTTTACTTACTCT-CGTCTCCACAtAA-3'-.
Для расчета количества копий ДНК использовали ген ин-
сулиноподобного фактора роста (insulinlike growth factor, IGF) человека.
Для расчета количества копий ДНК использовали праймеры к гену инсу-линоподобного фактора роста (insulinlike growth factor, IGF) человека: IGF (forvard) 5'--ccacacaagatggagaagca-3'-- IGF (reverse) 5'--ctgaatgggaaggaaactgg-3'-- IGF (probe) 5'-R& amp-G_aagctgtcctctctctgtgggggc_ BHQ3'-.
Оценку аллельспецифичности праймеров для мутантного участка гена JAK2V617 °F осуществляли с проведением качественной ПЦР, с внутренним контролем к гену гормона роста человека: GH_F 5'--tgccttcccaaccattccctta 3'- и GH_R 5'--ccactcacggatttctgttgtgtttc-3'- (400 пн). Продукты ПЦР анализировали методом горизонтального электрофореза в 2% агарозном геле, содержащем бромистый этидий в электрофорети-ческой камере типа Gel Electrophoresis Apparatus GNA-200 и визуализировали в УФ-свете (рис. 2).
Далее для калибровки количества копий гена приготовили 5-кратные разведения ДНК UKE1 и здоровых лиц (рис. 3).
Как видно из рис. 3, метод имеет чувствительность ниже 0,01% (3 копии V617V мутантного гена JAK2 из 37 500 исследованных).
Для расчета количества копий мутантной ДНК к общему количеству использовали известную формулу: 2(ct UKE-ct IGF+Act400%, где Ct UKE, Ct, IGF и ACt — пороговые циклы амплификации для отдельных генов и разница между ними.
Каждый эксперимент включал контрольные реакции с ДНК UKE1, содержащей 100% копии V617 °F мутантного гена JAK2, и ДНК здоровых лиц. Каждую реакцию (контрольную и опытную) ставили параллельно в двух пробирках.
Результаты и обсуждение. Из 244 пациентов у 75 (29 мужчин и 46 женщин) обнаружили мутации V617 °F гена JAK2. Распределение пациентов по полу, возрасту и нозоло-гиям представлено в табл. 1, 2 и рис. 4.
Рис. 3. Кинетические кривые ПЦР с 5-кратными разведениями ДНК ЦКЕ1 в ДНК здорового донора.
Таблица 1
распределение больных по полу и нозологии
Половой состав ИП ЭТ ИМФ Итого
Мужчины 10 7 12 29 (38,7)
Женщины 8 19 19 46 (61,3)
Всего 18 (24) 26 (34,7) 31 (41,3) 75(100)
Мужчины Женщины Всего
Рис. 4. Распределение больных по полу и нозологии. 1 — мужчины- 2 — женщины- 3 — всего.
При распределении по нозологиям отметили положительный результат с предварительным диагнозом ИП у 18 (58%) из 31 пациента, с ИМФ у 31 (53%) из 59, с ЭТ у 26 (48%) из 54 (см. табл. 1).
Возрастной пик обнаружения мутации V617 °F гена JAK2 у заболевших находится между 40 и 70 годами с преобладанием заболеваемости у женщин после 60 лет (см. табл. 2).
При анализе зависимости количества копии мутантного V617 °F гена JAK2 от нозологии (проведен у 75 JAK2V617 °F положительных пациентов) установили, что более 80% клеток с мутацией имеют в основном больные ИП (п-5) и ИМФ (п-7) (табл. 3, рис. 5).
В качестве клинического примера получения большого молекулярного ответа приводим истории болезни больной с эритремией 1Б стадии.
Пациентка П., 53 года, обратилась в поликлиническое отделение с жалобами на постоянные головные боли и снижение остроты зрения с 21. 11. 09.
Лабораторные данные. Общий анализ крови: гемоглобин 184 г/л, эр. 6,13 • 1012/л, тр. 861 • 109/л, л. 12 • 109/л, п.я. 67%, э. 3%, б. 0%, лимф. 17%, мон. 10%- СОЭ 1 мм/ч. Биохимический анализ крови (10. 12. 09): общий белок 72 г/л, креатинин 101 мкмоль/л, общий билирубин 16 г/л, лактатдегидрогеназа 435 ед/л, железо 21 мкмоль/л.
Ультразвуковое исследование органов брюшной полости (26. 11. 09): размеры селезенки 136×80 мм.
Гистологическое исследование костного мозга: деятельный костный мозг значительно преобладает над жировым- миело-кариоциты лежат плотно- эритропоэз расширен, много молодых форм- количество мегакариоцитов умеренно увеличено, они расположены поодиночке и группами возле синусов, наряду с клетками обычного вида много гигантских форм, много плео-морфных голо- и безъядерных- выявленные в трепанбиопта-те изменения соответствуют наблюдаемым при эритремии.
Для подтверждения диагноза провели количественный ПЦР РВ (10. 12. 09): копии V617 °F мутантного гена JAK2 составляют 81% из общего количества исследованных копий генов.
Таким образом, на основании клинической картины заболевания (плеторический синдром, увеличение размера селезенки), двухростковой гиперплазии в гемограмме (повышения уровня НЬ, эритроцитов, тромбоцитов, нейтрофиллеза в лей-коформуле), увеличения эритроидного и мегакариоцитарного ростков, анаплазии мегакариоцитов, а также положительного молекулярного маркера мутации V617 °F гена JAK2 (81%) у больной верифицирован диагноз эритремии НА стадии.
В дальнейшем пациентка получала следующее лечение: 3 сеанса (420, 720 и 690 мл) эритроцитафереза в течение 3 нед
Примечание. В скобках указан процент.
даже нарастающий тромбоцитоз (до 950 тыс) больной начали терапию препаратами а-интерферона (роферон по 3 000 000 ед 3 раза в день, подкожно).
После 6 мес лечения у больной наблюдали полную гематологическую ремиссию (размер селезенки 111×71 мм, в анализе крови: НЬ 136 г/л, эр. 4,2 • 1012/л, л. 6,3 • 1012/л, тр. 336 • 109/л, СОЭ 5 мм/ч, Н 45%).
Для выяснения минимальной остаточной болезни (24. 01. 11) провели ПЦР РВ анализ: копии V617 °F мутантного гена JAK2 составили 7% от общего количества исследованных копий генов.
За время терапии (с 10. 12. 09 по 24. 01. 11) количество копий V617 °F мутантного гена JAK2 снизилось с 81 до 7%, что по критериям ЕЬИ соответствует частичному молекулярному ответу.
Таблица 2
распределение больных по возрасту и полу
Половой состав Возраст, годы
до 10 11−20 21−30 31−40 41−50 51−60 61−70 80 Всего
7 6 13
12 12 24
2 9 11
29 46 75
Таблица 3
содержание (в %) копии генов JAK2V617 °F в зависимости от нозологии
Нозо- Копии гена JAK2V617 °F (в %)
логия до 10 11−20 21−30 31−40 41−50 51−60 61−70 71−80 80
ИП 3 1 4 2 2 1 5
ИМФ 9 3 3 5 3 1 7
ЭТ 9 6 2 4 1 1 1
91 876 543 210-
& lt-10
I -г
21−30
л
ИП
41−50 Ц ИМФ
61−70? ЭТ
& gt-80
на фоне приема дезагрегантов. Учитывая сохраняющийся и
Рис. 5. Содержание (в %) JAK2V617 °F в зависимости от нозологии.
По оси абсцисс (в %) — JAK2V617 °F, по оси ординат — количество пациентов.
Заключение. Таким образом, разработанная нами методика количественного определения V617 °F мутантного гена JAK2 с помощью ПЦР РВ является высокоспецифичной, чувствительной и может дополнять морфологические, ци-тогенетические и другие исследования, она позволяет более глубоко изучить динамику минимальной остаточной болезни на фоне лечения различными препаратами у пациентов с ХМПЗ, позволяя не только диагностировать, но и количественно оценить эффективность специфической терапии.
ЛИТЕРАТУРА
1. Adamson J. W, Fialkow P. J., Murphy S. et al. // N. Engl. J. Med. — 1976.
— Vol. 295. — P. 913−916.
2. Barosi G., Birgegard G., Finazzi G. et al. // Blood. — 2009. — Vol. 113. — P.
4829−4833.
3. Baxter E. J., Scott L. M., Campbell P. J. et al. // Lancet. — 2005. — Vol.
365. — P. 1054−1061.
4. Dameshek W. // Blood. — 1951. — Vol. 6. — P. 372.
5. Darnell J. E, Kerr I. M, Stark G. R. // Science. — 1994. — Vol. 264. — P.
1415−1421.
6. Fialkow P. J., Faguet G. B, Jacobson R. J. et al. // Blood. — 1981. — Vol.
58. — P. 916−919.
7. Fiedler W, Henke R. P., Ergun S. et al. // Cancer. — 2000. — Vol. 88. — P.
344−351.
8. Jacobson R. J., Salo A., Fialkow P. J. // Blood. — 1978. — Vol. 51, N 2. — P.
189−194.
9. James C, Ugo V et al. // Nature. — 2005. — Vol. 434. — P. 1144−148. 10. James W. Vardiman et al. // Blood. — 2009. — Vol. 114. — P. 937−951.
11. Jones A. V., Kreil S., Zoi K. et al. // Blood. — 2005. — Vol. 106. — P. 21 622 168.
12. Jones A. K, Silver R. T, Waghorn K. et al. // Blood. — 2006. — Vol. 107, N 8. — P. 3339−341.
13. KaushanskyK. // Blood. — 2005. — Vol. 105. — P. 4187−4190.
14. KralovicsR., Guana Y., Prchal J. T. // Exp. Hematol. — 2002. — Vol. 30. -P. 229−236.
15. KralovicsR, PassamontiF., BuserA. S. et al. // N. Engl. J. Med. — 2005. — Vol. 352. — P. 1779−1790.
16. Kroger N., BadbaranA., Holler E. et al. // Blood. — 2007. — Vol. 109. — P. 1316−1321.
17. Lacout C., Pisani D. F., TulliezM. et al. // Blood. — 2006. — Vol. 108. — P. 1652−1660.
18. Larsen T. S. et al. // Br. J. Haematol. — 2007. — Vol. 136, N 5. — P. 745−751.
19. Levine R. L., Wadleigh M., Cools J. et al. // Cancer Cell. — 2005. — Vol. 7. — P. 387−397.
20. Lippert E., Girodon F., Hammond E. et al. // Haematologica. — 2009. -Vol. 94, N 1. — P. 38−45.
21. O'-Shea J. J., GadinaM., SchreiberR. D. // Cell. — 2002. — Vol. 109. — P. 121−131.
22. Tefferi A. et al. // Blood. — 2007. — Vol. 110, N 4. — P. 1092−1097.
23. Tefferi A., Vardiman J. W. // Leukemia. — 2008. — Vol. 22. — P. 14−22.
24. Tefferi A., Thiele J., Vardiman J. W. et al. // Cancer. — 2009. — Vol. 1. — P. 3842−3847.
25. Wernig G., Mercher T., Okabe R. et al. // Blood. — 2006. — Vol. 107. — P. 4274−4281.
26. YamaokaK., SaharinenP., PesuM. et al. // Genome Biol. — 2004. — Vol. 5. — P. 1−253.
27. Zhao R., Xing S., Li Z. et al. // J. Biol. Chem. — 2005. — Vol. 280. — P. 22 788−22 792.
Поступила 30. 06. 11
© КОЛЛЕКТИВ АВТОРОВ, 2012
УДК 616. 36−053. 1−055. 5/. 7−074−078. 33
Р. М. Курабекова1, С. А. Луговская2, Е. В. Наумова2, О. М. Цирульникова1, И. Е. Цирульникова1, О. Е. Гичкун1, А. А. Андриянова1, Н. П. Шмерко1, О. П. Шевченко1
анализ связи количества гемопоэтических стволовых клеток крови с лабораторными показателями состояния гепатобилиарной системы у детей с врожденными и наследственными заболеваниями печени
1ФГБУ ФНЦ трансплантологии и искусственных органов им. акад. В. И. Шумакова Минздравсоцразвития Р Ф, 2ГБОУ ДПО Российская медицинская академия последипломного образования Минздравсоцразвития Р Ф, кафедра клинической лабораторной диагностики, Москва
Исследовано содержание CD34/CD45dim-no3umuBHbix клеток в периферической крови детей, страдающих врожденнъми и наследственнъми заболеваниями гепатобилиарной системы, и проведен анализ связи содержания исследуемъо: клеток с уровнем C-реактивного белка, sCD40L, sCD30, НП и лабораторных параметров, отражающих функции печени. Содержание CD34-позuтuвных ГСК у детей с циррозом печени коррелировало с уровнем CРБ, альбумина, концентрацией гемоглобина и количеством эритроцитов крови, но не бъто связано с уровнями sCD40L, sCD30 и НП. Количество исследованнъо: клеток у детей с заболеваниями печени бъто въше, чем у здоровъх взрослъх доноров.
Ключевые слова: CD34/CD45±клеткu, гемопоэтические стволовъе клетки, мобилизация стволовъо: клеток, заболевания гепатобилиарной системъ, трансплантация печени
R.M. Kurabekova, S.A. Lugovskaya, Ye.V. Naumova, O.M. Tzyrulnikova, I. Ye. Tzyrulnikova, O. Ye. Gitchkun, A.A. Andriyanova,
N.P. Shmerko, O.P. Shevtchenko THE ANALYSIS OF RELATIONSHIP BETWEEN NUMBERS OF HEMOPOIETIC HEMATOBLASTS AND LABORATORY INDICATORS OF STATE OF HEPATOBILIARY SYSTEM IN CHILDREN WITH CONGENITAL AND HEREDITARY DISEASES OF LIVER The content of CD34/CD45dim-positive cells in peripheral blood of children with congenital and hereditary diseases of hepatobiliary system is studied. The analysis of relationship between numbers of studied cells and level of C-reactive protein, sCD40L, sCD30 and laboratory parameters specific to liver functions is applied. The number of CD34-positive hemopoietic hematoblasts in children with hepatocirrhosis correlated with the level of C-reactive protein, albumin, hemoglobin concentration and quantity of blood erythrocytes. No relationship was established with the levels of sDC40L and sDC30. The number of studied cells in children with liver diseases was higher than in healthy adult donors.
Key words: CD34/CD45-positive cells, hemopoietic hematoblasts, mobilization of hemopoietic hematoblasts, diseases of hepatobiliary system, transplantation of liver

ПоказатьСвернуть
Заполнить форму текущей работой