Эндофитные бактерии семян сосны обыкновенной (Pinus sylvestris L.) и ели гибридной (Picea abies (L.) Karst ? Picea obovata Ledeb)

Тип работы:
Реферат
Предмет:
Биология


Узнать стоимость

Детальная информация о работе

Выдержка из работы

УДК 579. 64
С. Н. Масленникова, А. И. Шургин, В. К. Чеботарь,
А. В. Щербаков, А. В. Канарский
ЭНДОФИТНЫЕ БАКТЕРИИ СЕМЯН СОСНЫ ОБЫКНОВЕННОЙ
(Pinus sylvestris L.) И ЕЛИ ГИБРИДНОЙ (Picea abies (L.) Karst x Picea obovata Ledeb)
Ключевые слова: семена сосны и ели, эндофиты, фунгицидная и ростостимулирующая активность.
Исследован видовой и количественный состав микрофлоры семян сосны обыкновенной и ели гибридной и оценены их хозяйственно ценные свойства. При исследовании микрофлоры семян сосны обыкновенной и ели гибридной выделены эндофитные бактерии и определена их средняя численность в расчете на одно семя (3,13*105 и 2,4*106КОЕ соответственно). Среди выделенных штаммов чаще встречаются бактерии рода Бациллы (Bacillus). Исследуемые бактериальные штаммы проверены на способность подавлять в тестах in vitro рост фитопатогенных грибов и стимулировать рост редиса сорта «Ранний красный». Штаммы эндофитных бактерий с хозяйственно ценными свойствами рекомендованы для получения биопрепаратов и их применения в лесном хозяйстве.
Key words: seeds of pine and spruce, endophytes, fungicidal and growth stimulating activity.
In the research species and quantitative composition and economically valuable properties of the microflora of Pinus sylvestris L. and Picea abies (L.) Karst. x Picea obovata Ledeb. were investigated. In the study of the microflora ofpine and spruce seeds endophytic strains were isolated and the average number of bacteria per seed was 3,13×105 and 2,4×106 CFU, respectively. Among the isolated strains bacteria of the genus Bacillus were more common. Bacterial strains under study were tested for the ability to inhibit the growth ofpathogenic fungi and stimulate the growth of radish («The Early Red» variety). Strains of endophytic bacteria with economically valuable properties recommended for production of biological preparations and application forestry.
Введение
В настоящее время наблюдается тенденция развития микробных биопрепаратов на основе эндофитных бактерий, которые населяют внутренние ткани растений без вреда для хозяина [1].
Известно, что бактериальные симбионты оказывают стимулирующее воздействие на рост и развитие растения-хозяина, продуцируя биологически активные вещества и ингибируя фитопатогенные микроорганизмы. В связи с этим эндофитные бактерии являются перспективными агентами в биологической защите растений [2], а также и биопрепаратов другого назначения [3, 4, 5, 6].
Большинство экспериментальных работ посвящено анализу эндофитных популяций микроорганизмов на вегетативных органах растений. Бактериальные эндофиты были выделены из корней, стеблей и листьев многих двудольных и однодольных растений. Особенно активно в настоящее время ведется изучение эндофитов злаков [7, 8, 9, 10]. Проникая во внутреннюю среду растения-хозяина, эндофитные бактерии способны расселятся по организму растений и достигать его репродуктивной структуры, в том числе и по семенам. Анализ публикаций в этой области исследований свидетельствует о присутствии эндофитных бактерий в семенах риса [11], кукурузы [12], пшеницы [13], и хлопка [12] и других важнейших сельскохозяйственных культур. Для стимулирования развития и роста сельскохозяйственных культур созданы и применяются соответствующие биопрепараты на основе эндофитных бактерий.
Однако, этот положительный опыт до сего времени не нашел применения в лесоводстве. Причиной тому является, прежде всего, отсутствие систематических исследований, отражающих симбио-
тическую взаимосвязь лесных культур и эндофитных бактерий. Фрагментарная и недостаточная информация о симбионтах лесных культур не позволяет определить механизмы повышения устойчивости растений-хозяев к неблагоприятным факторам среды и увеличения их продуктивности [14]. До настоящего времени не созданы и биопрепараты для стимулирования развития и роста лесных культур.
В этой связи является весьма актуальным и своевременным изучение симбиотических отношений экономически важных лесных культур сосны и ели с эндофитными бактериями.
Целью настоящих исследований явилось изучение видового и количественного состава эндофитных бактерий семян сосны обыкновенной и ели гибридной и оценка их фунгицидной и ростостимулирующей активности.
Материалы и методы
В работе использовали семена сосны обыкновенной (Pinus sylvestris L.), собранные в Бушков-ском участковом лесничестве Сернурского лесничества и семена ели гибридной (Picea abies (L.) Karst.* Picea obovata Ledeb.), собранные в Сернурском лесничестве республики Марий Эл.
Для поверхностной стерилизации отбирали по 50 семян сосны обыкновенной и ели гибридной и помещали их в стерильные колбы объёмом 50 мл. Для каждой повторности использовали один из четырех вариантов стерилизации (табл. 1), отличающиеся по времени инкубирования в стерилизующем агенте. Эффективность метода стерилизации оценивали по всхожести семян и отсутствию бактериального роста на питательной среде. Для этого поверхностно стерилизованные семена подсушивали на стерильной фильтровальной бумаге, раскладывали на агаризованной среде R2A [15] и культивировали
в течение 2-х суток при температуре 28 °C. На третьи сутки регистрировали наличие или отсутствие бактериального роста вокруг семян.
Таблица 1 — Варианты поверхностной стерилизации
Процедура Время инкубации (мин)
A B C D
1) 70% этанол 2
2) Промыть стерильной водой 1
3) 5 — 15% гипохлорит натрия (NaCЮ) 7 20 30 40
4) Промыть стерильной водой 1
5) 5 — 15% гипохлорит натрия (NaCЮ) 7 20 30 40
6) 5 — кратно промыть стерильной водой 1
Далее по 20 стерильных семян сосны обыкновенной и ели гибридной помещали в стерильные ступки, добавляли по 10 мл стерильного физиологического раствора и асептически разрушали, используя стерильные пестики. Далее готовили ряд последовательных разведений (10−2, 10−3, 10−4). Затем из каждого полученного разведения отбирали по 40 мкл суспензии и поверхностно высевали на питательный агар (Биокомпас-С, Россия) и среду R2A. Посевы культивировали в течение 3-х суток при 28 °C. На четвёртые сутки проводили подсчет выросших колоний и выделение различных по морфологии изолятов.
Бактериальную ДНК выделяли стандартным щелочным методом [16, 17]. Для наработки участков 16S рРНК гена использовали прямой праймер BD (AGAGTTTGATCCTGGCTCAG) и обратный праймер FD (AAGGAGGTGATCCAGCCGCA) [18]. Этапы полимеразной цепной реакции включали начальную денатурацию цепей ДНК при 94 °C в течение 1 мин- 30 циклов, каждый из которых состоял из 30 секунд при 94 °C, 30 секунд при 55 °C и 1 мин при 72 °С- и финальную стадию 5 мин при 72 °C. Амплифицированные участки ДНК выявляли с помощью горизонтального гель-электрофореза (BioRad, США).
Для RFLP-анализа (Restriction fragment length polymorphism) использовали рестриктазы Msp I и Hae III (FastDigest). Рестрикционные фрагменты выявляли с помощью горизонтального гель-электрофореза. В качестве маркера использовали Ladder (50 — 1000 п. н.). Электрофорез проводили в течение 1 ч при постоянном напряжении 130 В.
После проведения рестрикционного анализа для идентификации отобрали 7 бактериальных штаммов. Повторно проводили полимеразную цепную реакцию и гель-электрофорез, после чего под УФ вырезали полоску геля с ДНК и очищали от агарозы.
Для определения концентрации ДНК готовили 1% агарозу. В первую лунку геля вносили 2 мкл маркера BME, в последнюю лунку — 3 мкл
BME. Во все остальные лунки раскапывали по 2 мкл ДНК, выделенной из геля, предварительно смешав с раствором для нанесения на гель. Электрофорез проводили в течение 40 мин при 110 В. Концентрацию ДНК определяли на основании анализа гель-электрофореза с помощью программы TotalLab (USA).
Секвенирование выполнено согласно протоколу фирмы Beckman Coulter (США) для 8-и канального секвенатора SEQ8000 с использованием коммерческого набора для секвенаторов «SEQ Dye Terminator Cycle Sequencing (DTCS) with Quick Start Kit». Видовую принадлежность клонов определяли с использованием программ BLAST GenBank (http: //www. ncbi. nlm. nih. gov/blast/) и Ribosomal Database Project (http: //rdp. cme. msu. edu/).
Для того чтобы оценить фунгицидную активность выделенных штаммов, из мицелия активно растущего на чашке Петри гриба вырезали кусочек, равный 1/8 от общей площади, помещали в стерильную чашку Петри и добавляли 10 мл стерильной воды. Стерильным шпателем аккуратно смывали споры с поверхности гриба. Отбирали 20 мкл суспензии спор, добавляли в 200 мл растопленной среды PDA (OXOID Ltd., Англия) температурой 40 -45°C, перемешивали и разливали по чашкам Петри. В застывшей среде стерильным пробочным сверлом делали «колодцы» [4, 5, 6, 19], в которые добавляли по 100 мкл исследуемой бактериальной суспензии и инкубировали в течение одной недели при комнатной температуре, после чего регистрировали отсутствие или наличие зоны ингибирования роста гриба и измеряли радиус зон линейкой.
Для оценки ростстимулирующей активности выделенных штаммов использовали семена редиса (Raphanus sativus L.) сорта «Ранний красный». Поверхностно-стерилизованные семена редиса (70% этанол в течение 2 мин, затем промывали стерильной водой) замачивали в бактериальной суспензии на 30 мин, контрольный образец семян замачивали в стерильной воде. Затем в стерильные чашки Петри с фильтровальными дисками и ватой разливали по 15 мл стерильной воды и раскладывали по 16 стерильных семян. Чашки инкубировали в течение 2 суток при 28 °C. На третьи сутки измеряли длину корня и длину побега. Полученные данные обрабатывали с помощью программы Statistica v5.5 методом однофакторного дисперсионного анализа.
Результаты и обсуждение
Метод поверхностной стерилизации разработали на семенах сосны обыкновенной и ели гибридной. Для этого сравнивали четыре варианта стерилизации, которые отличались по времени инкубирования семян в гипохлорите натрия.
Эксперимент показал, что из четырёх исследованных вариантов стерилизации семян (табл. 1) наиболее эффективным оказался вариант «A»: бактериальный рост отсутствовал, и, кроме того, стерилизация не повлияла на всхожесть семян, а значит, не повредила семенные структуры и эндофитную микрофлору. Из всех вариантов вариант «А» предполагает наименьшее время инкубирования в стерилизующем агенте и, следовательно,
является оптимальным для стерилизации семян исследуемых растений.
Определена средняя численность эндофитов в семени сосны обыкновенной и ели гибридной, которая составила 3,13*105 и 2,4*106 КОЕ соответственно. Из общего числа эндофитов семян сосны обыкновенной было отобрано 5 различных по морфологии изолятов и из семян ели гибридной — 9 изо-лятов, которые были отсеяны на свежую питательную среду.
На основании полученных данных RFLP-анализа выделено 2 группы эндофитов (группа A: штаммы 2EP, 1EP, 3EP, 4EP, 4ES, 1ES- группа B: 5ES, 9ES, 7ES)1, в каждую из которых входят генетически сходные штаммы, и группа Unique, которую составляют 5 уникальных штаммов (5EP, 2ES, 3ES, 6ES, 8ES).
Результаты секвенирования позволили определить видовую принадлежность выделенных штаммов, одни из которых относятся к классу Бациллы (Bacilli) (уникальный штамм 5EP и штаммы группы A) и 1 штамм — к классу Актинобактерии (Actinobacteria) (уникальный штамм 8ES).
Штаммы эндофитных бактерий проверены на способность подавлять в тестах in vitro рост фитопатогенных грибов Fusarium graminearum Schwabe и Fusarium sporotrichioides Sherb. 35 108 (возбудители корневой гнили и фузариозов злаковых), взятые из рабочей коллекции лаборатории технологии микробных препаратов ГНУ ВНИ-ИСХМ Россельхозакадемии. В результате оценки фунгицидной активности выделенных эндофитных микроорганизмов показано, что штаммы 5EP, 2EP, 2ES не проявляют активности в отношении фитопатогена F. graminearum, однако обладают ингибирующим действием на F. sporotrichioides. Кроме того выделены перспективные штаммы, ингибирующие рост обоих патогенных грибов (8ES, 4ES, 3ES, 6ES), которые планируется использовать при разработке биопрепаратов.
Также выделенные штаммы бактерий проверены на способность стимулировать рост редиса (Raphanus sativus L.) сорта «Ранний красный». После обработки семян бактериальными суспензиями и инкубирования в течение 2 дней у каждого проростка определялась длина корня и побега. Достоверность различия с контролем оценивалась с помощью программы Statistica v5.5. Полученные данные представлены в таблице 2.
Однофакторный дисперсионный анализ полученных данных показал, что эндофитный штамм 2ES достоверно значимо (р = 0,024) стимулирует рост корня редиса. Также следует отметить штаммы 8ES и 2EP, имеющие тенденцию к стимуляции роста корня, и штамм 4ES, который наоборот угнетают его рост. Достоверно установлено, что ни один из исследованных штаммов не влияет на рост побега редиса.
1 Обозначение: E (endophyte) — эндофитный штамм- P (pine) — сосна, S (spruce) — ель.
Таблица 2 — Результаты оценки ростстимули-рующей активности выделенных штаммов бактерий на рост редиса сорта «Ранний красный»
Вариант Штамм Средняя длина корня, см Средняя длина побега, см
1 8ES 4,90±0,33 1,64±0,05
9ES 4,44±0,28 1,76±0,08
2EP 5,16±0,38 1,82±0,06
4ES 3,73±0,23 1,71±0,07
Контроль 1 4,69±0,36 1,97±0,06
2 6ES 4,85±0,35 1,78±0,07
5EP 4,60±0,47 1,64±0,06
2ES 6,16±0,34 (р=0,024)* 1,94±0,06
3ES 4,62±0,41 1,86±0,07
Контроль 2 5,00±0,42 1,91±0,08
* р — вероятность. Достоверно значимыми различия считаются при р & lt- 0,05.
Выводы
1. Выделено 5 штаммов эндофитных бактерий из семян сосны обыкновенной и 9 штаммов из семян ели гибридной. Средняя численность эндофитов в семенах сосны обыкновенной и ели гибридной составила 3,13*105 и 2,4*106 КОЕ соответственно.
2. Рестрикционный анализ гена 16S рРНК изученных бактерий позволил выявить группы идентичных RFLP-профилей и позволил разделить их на 3 обособленные группы. Последующая молекулярно-генетическая идентификация с использованием программ BLAST и RDP показала разнообразие в таксономическом положении изучаемых штаммов.
3. Исследование хозяйственно ценных свойств изучаемых микроорганизмов позволило выделить 3 перспективных штамма 2ES, 8ES, 3ES, проявляющих как фунгицидную, так и ростостимулирующую активности. Данные штаммы планируется использовать в дальнейшей работе при создании биопрепаратов для стимулирования развития и роста лесных культур.
Работа выполнена в рамках реализации ФЦП «Исследования и разработки по приоритетным направлениям развития научнотехнологического комплекса России на 2007−2013 годы» (государственный контракт №
16. 552. 11. 7089 от 12 июля 2012 г.) с использованием оборудования ЦКП «ЭБЭЭ» ФГБОУ ВПО «ПГТУ».
Литература
1. J. Hallman, A. Quadt-Hallmann, W.F. Mahaffee, J.W. Kloepper, Can. J. Microbiol. — 43. — 1997. — Р. 895 — 914.
2. Н. В. Мальфанова. Магистер. дисс. ГНУ ВНИИСХМ, Санкт-Петербург. — 2008. — с. 94.
3. З. А. Канарская, А. В. Канарский, Д. А. Дулькин, Э. И. Семенов, В. К. Чеботарь, А. В. Щербаков, Вестник Казанского технологического университета. — № 14. — 2012. — с. 186 — 190.
4. J. Magnusson, J. Schnurer, Applied and Environmental Microbiology. — 67. 1. — 2001. — с. 1 — 5.
5. А. Г. Воржецов. Вестник Казанского технологического университета. — № 6. -2012. — с. 125 — 128.
6. Т. А. Скотникова, Л. А. Неминущая, Н. К. Еремец, О. В. Провоторова, И. В. Бобровская, М. А. Малышева,
З. А. Канарская, Вестник Казанского технологического университета. — № 4. — 2012. — с. 82 — 87.
7. Е. Ю. Благовещенская. Дисс. канд. биол. наук. Московский гос. ун-т им. М. В. Ломоносова, Москва. — 2006. с. 138.
8. Т. В. Шеленга, А. В. Конарев, Н. И. Дзюбенко. Санкт-Петербург: ГНУ ГНЦ РФ ВИР. — 2007. — с. 35.
9. Р. М. Хайруллин, Т. С. Минина, Р. Ш. Иргалина, И. А. Загребин, Н. А. Уразбахтина. Вестник Оренбургского гос. ун-та. — 2. — 2009. — с. 133 — 137.
10. А. А. Егоршина. Дисс. канд. биол. наук. Саратов, 2012.
11. S. Okunish, S. Sako, H. Mano, A. Imamura, H. Morisaki, Microbes Environ. — 20. — 2005. — Р. 168 — 177.
12. J. Mclnrov, J. Kloepper, Plant and Soil. — 173. — 1995. — Р. 337 — 342.
13. J. Coombs, C. Franco, Appl. Environ. Microbiol. — 69. 7 -2003. — Р. 4260 — 4262.
14. Р. И. Гвоздяк, А. Ф. Гойчук, В. В. Розенфельд. Плодоводство, семеноводство, интродукция древесных растений. — 12. 24. — 2009. с. 28.
15. D. J. Reasoner, E. E. Geldreich, Appl. Environ. Microbiol. — 49. 1. — 1985. — Р. 1 — 7.
16. S. Y. Lee, S. Rasheed, Biotechniques. — 9. 6. — 1990. — Р. 676 — 679.
17. Е. Е. Андронов, А. Г. Пинаев, Е. В. Першина, Е. П.
Чижевская. Выделение ДНК из образцов почвы. Санкт-Петербург. — 2011.
18. Е. В. Коростик, А. Г. Пинаев, Г. А. Ахметова, Е. Е.
Андронов. Экологическая генетика. — 4. 4. — 2006. — с. 32 -37.
19. Л. А. Неминущая, Т. А. Скотникова, Е. И. Титова, О. В. Провоторова, Н. К. Еремец, И. В. Бобровская, З. А. Канарская, Вестник Казанского технологического университета. — № 4. — 2012. — с. 69 — 74.
© С. Н Масленникова — магистрант каф. лесной селекции, недревесных ресурсов и биотехнологии ПГТУ, snmaslennikova@gmail. com- А. И. Шургин — канд. с/х наук, доц., зам. дир. ЦКП ЭБЭЭ, ashurgin@pochta. ru- В. К. Чеботарь -канд. биол. наук, зав. лаб. технологии микробных препаратов, ГНУ ВНИИСХМ Россельхозакадемии, bisolbi-inter@rambler. ru- А. В. Щербаков — инж. той же лаборатории, avsherbakov@bisolbi. ru- А. В. Канарский — д-р техн. наук, проф. каф. пищевой биотехнологии КНИТУ, alb46@mail. ru.

ПоказатьСвернуть
Заполнить форму текущей работой