Опыт молекулярно-генетической диагностики острых кишечных инфекций

Тип работы:
Реферат
Предмет:
Медицина


Узнать стоимость

Детальная информация о работе

Выдержка из работы

тельно 50% конкрементов, не соответствую- патогенеза данного заболевания, в основе ко-
щих типичным метаболическим нарушениям торого лежат нарушения пуринового обмена,
крови и мочи, затрудняет понимание процес- так и с внедрением в терапию препаратов, об-
сов, этиологически значимых в мочевом кам- ладающих литолитическим действием, и ме-
необразовании. РФА конкрементов позволяет дикаментозных средств, которые устраняют
наиболее точно идентифицировать кристал- факторы, способствующие камнеобразованию
лическую составляющую почечных камней, из мочевой кислоты.
что является важным в определении условий, Таким образом, изучение метаболиче-
при которых возможны литогенез, профилак- ских нарушений крови и мочи и их корреля-
тика и прогнозирование рецидива нефроли- ции с химическим составом конкрементов
тиаза. позволяет снизить степень литогенных суб-
Гиперурикоземия и гиперурикозурия — станций в крови и моче и повысить концен-
наиболее часто выявляемый патологический трацию ингибиторов кристаллизации и агре-
субстракт в соответствии с уратным КН. Это гации, а также избежать дополнительных
позволяет надеяться на более благоприятный этиопатогенетически не обоснованных инст-
прогноз лечения, связанный как с уточнением рументальных и лекарственных назначений.
Сведения об авторах статьи:
Коган Михаил Иосифович, директор НИИ урологии и нефрологии Ростовского государственного медицинского университета. Заведующий кафедрой урологии и репродуктивного здоровья человека ФПК и ППС с курсом детской урологии ан-дрологии ГОУ ВПО РостГМУ Минздравсоцразвития России. Заслуженный деятель науки РФ, д.м.н., профессор.
Адрес: 344 022, г. Ростов-на-Дону, пер. Нахичеванский 29. E-mail: dept_kogan@mail. ru
Хасигов Алан Владимирович, докторант кафедры урологии и репродуктивного здоровья человека ФПК и ППС с курсом детской урологии андрологии ГОУ ВПО РостГМУ Минздравсоцразвития России, кандидат медицинских наук Адрес: 344 022, г. Ростов-на-Дону, пер. Нахичеванский 29. E-mail: alan_hasigov@mail. ru
Белоусов Игорь Иванович, доцент кафедры урологии и репродуктивного здоровья человека ФПК и ППС с курсом детской урологии андрологии ГОУ ВПО РостГМУ Минздравсоцразвития, кандидат медицинских наук Адрес: 344 022, г. Ростов-на-Дону, пер. Нахичеванский 29. E-mail: belrost_dept@mail. ru
ЛИТЕРАТУРА
1. Аляев Ю. Г., Руденко В. И., Газимиев М. С. Мочекаменная болезнь. Актуальные вопросы диагностики и выбора метода лечения.
— М. -Тверь: «Триада», 2006. — 236с.
2. Дзеранов, Н. К. Лечение мочекаменной болезни комплексная урологическая проблема /Н.К. Дзеранов, Д. А. Бешлиев // Consilium medicum: приложение. Урология. — 2003. -С. 18−22.
3. Вощула, В. И. Мочекаменная болезнь: этиотропное и патогенетическое лечение, профилактика. — Минск.: ВЭВЭР, 2006. -268с.
4. Campbell’s UROLOGY, 2007- 3227−3267.
5. Ситдыкова, М. Э. Метафилактика мочекаменной болезни с учетом риска рецидива заболевания /М.Э. Ситдыкова, Ф. М. Кузьмина // Саратовский научно-медицинский журнал (приложение). — 2011. T. 7, № 2. -С. 85−87.
6. Sakhaee L, Adams-Huet В, Мое OW, Рак CYC. Pathophysiologic basis for normouricosuric uric acid nephrolithiasis. Kidney Int 2002−62: 971−9.
7. Baldwin DN, Spencer JL, Jeffries-Stokes CA Carbohydrate intolerance and kidney stones in children in the Goldfields. J Paediatr Child Health 2003- 39: 381−5.
8. Mollerup CL, Vestergaard P, Frokjaer VG, Mosekil-de L, Christiansen P, Blichert-Toft M. Risk of renal stone events in primary hyper-parathy-roidism before and after parathyroid surgery: controlled retrospective follow up study. BMJ 2002- 325: 807.
9. Mattix Kramer HJ, Grodstein F, Stampfer MJ, Curhan GC. Menopause and postmenopausal hormone use and risk of incident kidney stones. J Am Soc Nephrol 2003- 14: 1272−7.
УДК616. 34−002. 153
© Б. Р. Кулуев, Д. Я. Хайдарова, Д. Н. Дубровская, А. Р. Мавзютов, Р. Ш. Магазов, Н. Н. Ворошилова, 2012
Б.Р. Кулуев1,2, Д.Я. Хайдарова2, Д.Н. Дубровская2,
А.Р. Мавзютов2, Р.Ш. Магазов2, Н.Н. Ворошилова3 ОПЫТ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКОЙ ДИАГНОСТИКИ ОСТРЫХ КИШЕЧНЫХ ИНФЕКЦИЙ
1 Учреждение Российской академии наук Институт биохимии и генетики Уфимского научного центра РАН, г. Уфа 2ГБОУ ВПО «Башкирский государственный медицинский университет» Минздравсоцразвития России, г. Уфа 3НПО «Микроген», г. Уфа
Острые кишечные инфекции остаются серьезной проблемой здравоохранения. Для повышения эффективности их диагностики и этиологической расшифровки нами были подобраны и применены в ходе исследования клинического материала видоспецифичные праймеры для полимеразной цепной реакции к наиболее эпидемиологически значимым представителям Enterobacteriaceae (Citrobacterspp., Hafniaspp., Klebsiellaspp., Proteusspp. и Escherichiacoli). Проведена оптимизация условий выделения ДНК и постановки полимеразной цепной реакции (ПЦР), позволяющая рекомендовать выбранные пары для создания диагностических систем.
Ключевые слова: условно-патогенные микроорганизмы, ЕП-егоЬас1епасеае, острые кишечные инфекции, ПЦР-диагностика, олигонуклеотидные праймеры.
B.R. Kuluyev, D. Ya. Khaidarova, D.N. Dubrovskaya,
А.R. Mavzyutov, R. Sh Magazov, N.N. Voroshilova DIAGNOSTIC IMPLICATION OF MOLECULAR-GENETIC TECHNIQUES IN ACUTE INTESTINAL INFECTIONS
Acute intestinal infections have remained a pressing issue to be solved by the public health service. In order to enhance the diagnostic efficacy and etiology interpretation potentials, species-specific primers for polymerase chain reaction (PCR) were selected and employed in the course of clinical material examination of most clinically significant representatives: Enterobacteriaceae (Citrobacter spp., Hafnia spp., Klebsiella spp., Proteus spp. and Escherichiacoli). Refinements of DNA isolation and PCR techniques were made, which allowed us to recommend the selected pairs for diagnostic systems development.
Key words: opportunistic microorganisms, Enterobacteriaceae, acute intestinal infections, polymerase chain reaction (PCR), oligonucleotide primers.
Инфекционная заболеваемость остается высокой и определяет социальную, экономическую и эпидемиологическую значимость этой проблемы. При этом в её структуре наиболее высок удельный вес острых кишечных инфекций (ОКИ), которыми по данным ВОЗ ежегодно заболевает свыше 2 млрд человек [41]. Клинический полиморфизм ОКИ обусловливает первостепенное значение лабораторных методов в расшифровке их этиологии, среди которых наиболее широко применяется бактериологический. Однако продолжительность культурального исследования, его невысокая чувствительность и ресурсоемкость определяют непрерывные попытки исследователей внедрить новые методы, лишенные указанных недостатков. Это становится еще более актуальным в связи изменением роли отдельных возбудителей и появлением новых, широким распространением устойчивости к антибактериальным препаратам и растущими требованиями к сокращению сроков исследования. Указанное имеет особенное значение применительно к патологическим состояниям, ассоциируемым с условно-патогенными микроорганизмами нормофлоры человека.
Среди наиболее перспективных при этом рассматриваются молекулярногенетические методы, среди которых уже нашли применение анализ плазмидного профиля, определение полиморфизма длины рестрикционных фрагментов (ПДРФ), пульс-электрофорез, саузерн-блоттинг, риботипиро-вание, ДНК-чипы, секвенирование ДНК. Однако наиболее дешевой, быстрой, надежной и воспроизводимой методикой остается ПЦР с использованием высокоспецифических праймеров.
В этой связи целью настоящего исследования явились конструирование тест-систем для надежной видоспецифической детекции и оценка этиологической значимости ряда условно-патогенных представителей Еп-1егоЬа^ег1асеае при диагностике ОКИ.
Материал и методы
Под нашим наблюдением находилось 79 больных среднетяжелыми формами острой
кишечной инфекции в возрасте от 20 до 35 лет. При микробиологическом исследовании испражнений этих больных высевались представители условно-патогенной микрофлоры. Во всех случаях ОКИ протекала в виде диареи осмотического типа, по типу гастроэнтерита. Больные поступали в стационар в первые два дня от начала заболевания в состоянии средней тяжести с умеренно выраженными симптомами интоксикации (вялость, слабость, отсутствие аппетита, дискомфорт в животе, сопровождающийся болями и т. д.). Заболевание начиналось у большинства больных с повышения температуры тела до 38,1−39 С (75,9%) и выше (12,7%), реже — до 37,2−38 0С (11,4%). Одновременно в 69,6% (у 55 больных) случаев имела место повторная рвота от 2−4 раз в сутки одновременно или несколько часов спустя от начала лихорадки, появлялся жидкий, обильный, водянистый стул с частотой от 5−7 (63,3%) до 8−10 (36,7%) и более раз в сутки. Практически у всех больных (92,4%) имели место явления метеоризма и абдоминальные боли уже в первые сутки от начала заболевания. Для постановки диагноза использовались клинические, бактериоскопиче-ские и иммунологические методы. Клинический материал, полученный от больных (испражнения, рвотные массы и промывные воды желудка) исследовали на наличие условнопатогенной флоры: бактериологическим методом согласно общепринятым методикам выявляли условно-патогенные Enterobacteria-ceae. В целом из клинического материала культуральным методом было выделено и идентифицировано 79 клинических штаммов условно-патогенных энтеробактерий, представленных преимущественно Klebsiellapneu-moniae, Proteusmirabilis и Morganella (Proteus) morganii. В работе также использовали лабораторные штаммы E. coli штамма XL 1-Blue. Тотальную бактериальную ДНК выделяли из суточной агаровой культуры, используя стандартные наборы для выделения ДНК («Ин-терлабсервис», Россия). Для подбора праймеров использовали последовательности нуклеотидов 16S РНК генов, обнаруженные в
GenBank. Номера доступа в GenBank для исследуемых нуклеотидных последовательностей следующие: Citrobacterspp. -
GU458292. 1, Hafniaspp. — EU196322. 1, Kleb-siellaspp. — GU458293. 1, Proteusspp. -
FJ711760.1 и Escherichiacoli — AB548582.1. Поиск гомологичных генов осуществляли при помощи программ MegAlighn пакета Lasergene (DNASTAR, США) и MegaBlast, доступных через сайт http: //www. ncbi. nlm. nih. gov. Для подбора оптимальных и высокоспецифичных праймеров использовали программу PrimerSelect пакета Lasergene (DNASTAR, США). Для проведения ПЦР использовали амплификаторы «МС-2» («ДНК -технология», Россия). Качество и количество амплифици-рованных фрагментов ДНК определяли аналитическим электрофорезом в 1% агарозном геле. Агарозный гель-электрофорез проводили в приборах модели Sub-CellGTWIDEMINI (Bio-Rad, США). После окончания электрофореза гели окрашивали бромистым этидием и фотографировали на фотодокументацион-ной системе GelCameraSystem (UVP, Inc. США).
Результаты и бсуждение
Подбор праймеров для амплификации специфичных участков ДНК представителей Enterobacteriaceae.
Для идентификации видового состава энтеробактерий методом ПЦР были выбраны консервативные участки ДНК, кодирующие 16S РНК. Эти гены являются наиболее удобными как для подбора праймеров, так и для проведения ПЦР. Это связано с тем, что гены 16S РНК представлены в виде нескольких копий и их последовательности для большинства видов энтеробактерий секвенированы и доступны через GenBank. В то же время последовательности этих генов для различных представителей энтеробактерий отличаются лишь единичными нуклеотидами, что вызывает дополнительные сложности при подборе оптимальных и специфичных праймеров для ПЦР. В GenBank нами было обнаружено большое количество нуклеотидных последовательностей различных энтеробактерий, среди которых были отобраны только те, которые получены из надежных источников и относятся к клинически важным видам: Citro-bacterspp., Enterobacterspp., Escherichiaspp., Hafniaspp., Klebsiellaspp., Morganellaspp. и Proteusspp. Последовательности генов 16S РНК этих энтеробактерий были вначале выравнены при помощи программы MegAlighn, что позволило определить все вариабельные участки ДНК, пригодные для подбора прай-
меров. Эти участки нами были выделены и использованы в дальнейшем для подбора видоспецифичных праймеров. Лишь несколько нуклеотидов составляли так называемые вариабельные участки, к которым соотносили З'--конец олигонуклеотидного праймера. 5'--конец олигонуклеотида в основном совпадал с консервативной частью ДНК, что не является помехой при подборе праймера. В качестве критериев при выборе отимальных вариантов использовали полное отсутствие димеров и шпилек праймеров, температуру отжига свыше 58 С и длину амплифицируемого участка 200−1000 п.н. Из-за очень высокой консервативности последовательностей ДНК генов 168 РНК и близости между собой у различных представителей энтеробактерий для ЕМегоЪаМвги Мо^апвПа не удалось подобрать эффективные для типирования праймеры. Для CitroЪacterspp. были подобраны праймеры CitroFttgtggttaataaccgcagca и Сйго-Racagttcccgaaggcaccctc (размер ампликонов 584 п.н.), для Hafniaspp- праймеры На?-Faaggccttcgggttgtaaa и HafRagttcccgaaggcactaag (размер ампликонов 625 п.н.), для KleЪsiel-1аирр. — праймеры
KleЬFgggaccttcgggcctcatgccatcaga и
KleЬRtctcacagttcccgaaggcaccaa (размер ампликонов 843 п.н.), для Proteusspp. — праймеры ProtFggcggccccctggacaaagac и
ProtRtctcagcgttcccgaaggcactcct (размер ампликонов 315 п.н.), для Escherichiacoli- праймеры ColEFagctaataccgcataacgtcgcaagaccaaagagg и ColERtctcacggttcccgaaggcacattctcatct (размер
ампликонов 878 п.н.).
Рис. 1. Электрофореграмма результата ПЦР участка гена 16S РНК Klebsiellaspp. Размер ампликона 843 п.н.: 1 — маркер молекулярного веса размером 850 п.н.- 2−9 — образцы ДНК Klebsiellasppm клинического материала
Амплификация участков гена 16S РНК Enterobacteriaceae и оптимизация условий ПЦР.
После выделения и очистки тотальной ДНК клинических штаммов проводили ПЦР. В первой серии исследований при температуре отжига 650С была протестирована ДНК 20 штаммов Klebsiellaspp., что показало их пригодность (рис. 1). В качестве отрицательного контроля использовали ДНК E. coli. Амплификация отсутствовала даже при температуре отжига 500С.
В дальнейшем аналогичный положительный результат был получен еще у 40 различных образцов ДНК Klebsiellaspp. Это говорит о том, что подобранные праймеры полностью подходят для ПЦР -анализа и могут быть использованы для создания диагностических систем в будущем. Эти праймеры также были проверены на Agrobacteriumtumefa-ciens, где они не сработали, что также говорит об их высокой специфичности. Далее была выделена тотальная ДНК E. coli и проведена ПЦР при помощи праймеров ColEF и Со1ЕЯ. Результаты амплификации представлены на рис. 2. Оптимальной и наиболее высокой для этой пары праймеров оказалась температура отжига 68 С. При использовании в качестве матрицы ДНК Klebsiellasppамплификация не происходила даже при низких температурах отжига (рис. 2).
850 п.н.
1 2 3 4 5
Рис. 2. Электрофореграмма результатов амплификации участка гена 16S РНК E. coli размером 878 п.н.: 1 — молекулярный маркер размером 850 п.н.- 2 — отсутствие специфического ампли-кона при использовании в качестве ДНК Klebsiellaspp. '-- 3−5 -образцы ДНК E. coli.
Для Proteusspp. эффективность ПЦР проверили в 10 образцах, температуру отжига увеличивали до 65 С. В качестве контроля специфичности ПЦР использовали ДНК E. coli, с которым изучаемые праймеры, как и следовало ожидать, не взаимодействовали.
400 п.н. ---------
300 п.н. ---------
200 п.н. ---------
Рис. 3. Электрофореграмма результата ПЦР участка гена 16S РНК Proteusspp. размером 315 п.н.: 1 — маркерная молекула ДНК, вторая полоска которой соответствует 300 п.н.- 2 — ПЦР с образцами ДНК E. coli- 3−6 — образцы ДНК Proteusspp.
К сожалению, из всех выделенных нами образцов ДНК нам не удалось обнаружить Citrobacterspp. и Hafniaspp. Для поиска данных энтеробактерий было проведено по пять ПЦР при различных условиях с 79 образцов ДНК. Однако в отобранном нами клиническом материале обнаружить эти микроорганизмы не удалось, и эти результаты совпадают с биохимическим определением родового состава, проведенного до ПЦР-анализа. Это доказывает, что нам удалось подобрать высокоспецифичные праймеры, но среди выделенных нами ДНК не оказалось этих энтеробактерий. Поэтому существует необходимость в продолжении исследований. Необходимо выделить еще больше клинических штаммов с целью обнаружения Citrobacterspp. и Haf-niaspp.
Итак, нами были испытаны праймеры для идентификации Klebsiellaspp., Proteusspp, E. ^/методом ПЦР, однако для создания тест-системы должны быть оптимизированы условия реакции. В первую очередь необходимо уменьшать время реакции, для чего мы увеличивали температуру отжига и во всех случаях удалось его довести до 65 С. Также мы уменьшали время элонгации и довели его до 15 секунд, то есть этого времени было достаточно для получения полноразмерного ам-пликона, хорошо видимого в агарозном геле. В дальнейшем были проведены работы по уменьшению количества добавляемой полимеразы и нуклеотидов, чтобы сократить расходы на реактивы при постановке ПЦР. Таким образом, нами созданы и испытаны на клиническом материале диагностические системы для одновременной высокочувствительной детекции в клиническом материале и видоспецифичной идентификации Klebsiellaspp. ,
12 3 4 5 6
Proteusspp., Е. соИ. Оптимизированы условия поможет подобрать адекватную раннюю ан-
ПЦР, что позволяет проводить реакцию в те- тибактериальную терапию.
чение 40−50 минут, а также дает надежду на Работа выполнена при поддержке ФЦП
проведение множественной ПЦР, так как тем- «Научные и научно-педагогические кадры
пературы отжига всех праймеров почти сов- инновационной России на 2009−2013 гг.» в
падают, а размеры ампликонов различаются. рамках реализации мероприятия 1.2.1 (ГК
Быстрая этиологическая диагностика ОКИ П385 от 30. 07. 2009).
Сведения об авторах статьи:
Кулуев Булат Резяпович — доцент кафедры фундаментальной и прикладной микробиологии БГМУ, Е-mail: Kuluev@bk. ru Хайдарова Джамиля Якуповна — аспирант кафедры кафедры фундаментальной и прикладной микробиологии БГМУ.
Е-mail: Dislam. 86@mail. ru
Дубровская Дина Наилевна — аспирант кафедры инфекционных болезней БГМУ. Е-mail: Dina_8383@mail. ru Мавзютов Айрат Радикович — д.м.н., профессор, зав. кафедрой фундаментальной и прикладной микробиологии БГМУ.
Е-mail: Ufalab@mail. ru.
Магазов Риза Шаихьянович — д.м.н., профессор кафедры эпидемиологии БГМУ Ворошилова Наталья Николаевна — д.м.н., профессор, зав. лабораторией НПО «Микроген».
ЛИТЕРАТУРА
1. Инфекционная заболеваемость в Российской Федерации за 2005 год // Детские инфекции. — 2006. — № 1. — С.3.
2. Учайкин, В. Ф. Решенные и нерешенные проблемы инфекционной патологии у детей / В. Ф. Учайкин // Педиатрия. — 2004. — № 4.
— С. 7−11.
3. Покровский, В. И. Актуальные проблемы инфекционной патологии // В. И. Покровский, В. В. Малеев // Эпидемиология и инфекционные болезни. — 1999. — № 2. — С. 17−20.
4. Учайкин, В. Ф. Новые технологии в диагностике, лечении и профилактике инфекционных болезней у детей / В. Ф. Учайкин // Педиатрия. — 1995. — № 4. — С. 37−44.
5. Нисевич, Н. И. Современные проблемы инфекционной заболеваемости у детей / Н. И. Нисевич // Педиатрия. — 1995. — № 4. -С. 67−69.
6. Farmer J.J., Davis B.R., Hickman-Brenner F.W. Biochemical identification of new species and biogroups of Enterobacteriaceae isolated from clinical specimens // J. Clin. Microbiol. 1985. Vol. 21. P. 46−76.
7. Ющук, Н. Д. Острые кишечные инфекции: актуальные проблемы клиники и диагностики / Н. Д. Ющук, Я.М. Еремушкина// Инфекционные болезни.- 2006.- Т. 4,№ 1.- С. 76−78.
8. Покровский, В. И. Актуальные проблемы инфекционной патологии / В. И. Покровский, В. В. Малеев // Эпидемиология и инфекционные болезни. -1999. -№ 2. -С. 17−20.
9. Генетический контроль некоторых факторов патогенности Citrobacter spp. / М. М. Туйгунов, З. Г. Габидуллин, А. Р. Мавзютов [и др.] // Актуальные вопросы инфекционной патологии: c6. научн. тр. — Уфа, 1998. — С. 101−103.
10. Soto, G.E. Bacterial adhesins: common themes and variations in architec-ture and assembly / G.E. Soto, S.J. Hultgren // J. Bacteriol. -1999. — Vol. 181, No. 4. — P. 1059−1071.
11. Брюсова, М. Б. Идентификация энтерогеморрагических E. coli и дифференциация E. coli 0157: Н7 методом полимеразной цепной реакции/М.Б. Брюсова, И. Л. Обухов, О. А. Тугаринов, М. К. Пирожков, [и др.] // Ветеринария.- 2008. -№ 12.- C. 42−49.
УДК 616−022. 363
© Г. Ф. Хасанова, А. Р. Мавзютов, И. А. Мирсаяпова, С. Г. Хасанова, Г. Д. Хазеева, Р. Ш. Магазов, Н. Н. Ворошилова, 2012
Г. Ф. Хасанова, А. Р. Мавзютов, И. А. Мирсаяпова,
С. Г. Хасанова, Г. Д. Хазеева, Р. Ш. Магазов, Н. Н. Ворошилова ЭТИОЛОГИЧЕСКОЕ ЗНАЧЕНИЕ И АНТИБИОТИКОЧУВСТВИТЕЛЬНОСТЬ НЕФЕРМЕНТИРУЮЩИХ ГРАМОТРИЦАТЕЛЬНЫХ БАКТЕРИЙ В КЛИНИЧЕСКОЙ ПРАКТИКЕ ГБОУ ВПО «Башкирский государственный медицинский университет» Минздравсоцразвития Росии. г. Уфа
Исследовано 719 клинических штаммов неферментирующих грамотрицательных бактерий, выделенных из клинического материала (образцы отделяемого ран, мокроты, мочи). Установлено, что удельный вес случаев выделения в клиническом материале неферментирующих грамотрицательных бактерий составили в 2009 году 4,45%, в 2010 году 5,5%, в 2011 году 6,7%. Наиболее часто неферментирующие грамотрицательные бактерии выявлялись при инфекциях нижних дыхательных путей-7,1%, при гнойно-септических процессах-5,1%, при урогенитальной патологии 4,33%. По видовому составу в киническом материале чаще обнаруживались Pseudomonas aeruginosa и Acinetobacter baumanii, при этом отмечена тенденция к увеличению количества случаев выявления Pseudomonas alcaligenes, Stenotrophomonas maltophylia, Acinetobacter christensenii, Pseudomonas putida. Исследованные штаммы P. aeruginosa отличались высокой резистентностью к пипера-циллину, цефепиму, цефтазидиму, цефоперазону, цефотаксиму. В отношении Acenitobacter spp. наибольшую активность проявляли меропенем, тобрамицин, нетилмицин и амикацин.
Ключевые слова: неферментирующие грамотрицательные бактерии, Pseudomonas aeruginosa, Acinetobacter baumanii, антибиотикорезистентность.

ПоказатьСвернуть
Заполнить форму текущей работой