Генетическая характеристика вирулентного потенциала энтерококков, выделенных из разных биотопов тела человека, и модификация факторов персистенции Candida albicans под их влиянием

Тип работы:
Реферат
Предмет:
Медицина


Узнать стоимость

Детальная информация о работе

Выдержка из работы

ISSN 2304−9081
Учредители: Уральское отделение РАН Оренбургский научный центр УрО РАН
Бюллетень Оренбургского научного центра
УрО РАН

2015 * № 4
Электронный журнал On-line версия журнала на сайте http: //www. elmag. uran. ru
© Коллектив авторов, 2015 УДК 579. 25
1 12 12 1 О. А. Пашинина, М. В. Сычева, , О. Л. Карташова, , Л. П. Попова ,
Т.М. Пашкова1
ГЕНЕТИЧЕСКАЯ ХАРАКТЕРИСТИКА ВИРУЛЕНТНОГО ПОТЕНЦИАЛА ЭНТЕРОКОККОВ, ВЫДЕЛЕННЫХ ИЗ РАЗНЫХ БИОТОПОВ ТЕЛА ЧЕЛОВЕКА, И МОДИФИКАЦИЯ ФАКТОРОВ ПЕРСИСТЕНЦИИ CANDIDA ALBICANS ПОД ИХ ВЛИЯНИЕМ
1 Институт клеточного и внутриклеточного симбиоза УрО РАН, Оренбург, Россия
2 Оренбургский государственный аграрный университет, Оренбург, Россия
Цель. Изучение особенностей влияния энтерококков, выделенных из разных биотопов тела человека при патологии и отличающихся по наличию генетических детерминант вирулентности, на персистентные свойства Candida albicans.
Материалы и методы. В исследовании использовали 64 штамма C. albicans и 17 штаммов энтерококков, выделенных из кишечника людей при обследовании на дисбиоз, и репродуктивного тракта женщин при гинекологической патологии. Идентификацию грибов рода Candida осуществляли общепринятыми методами, бактерий рода Enterococcus -с помощью мультиплексной ПЦР. Антилизоцимную активность C. albicans определяли по О. В. Бухарину с соавт. (1999), образование биопленок — по G.A. O'-Toole et al. (2000). Гены, кодирующие синтез факторов вирулентности бактерий рода Enterococcus (gelE, cylM, cylB, cylA, esp, hyl, asa), выявляли с помощью ПЦР. Взаимодействие C. albicans и бактериями рода Enterococcus исследовали при совместном культивировании в бульоне. Статистическую обработку результатов проводили с использованием t-критерия Стьюдента.
Результаты. Генетические детерминанты вирулентности выявлены только у представителей вида Enterococcus faecalis. Установлены особенности межмикробного взаимодействия вирулентных и авирулентных штаммов Enterococcus spp. с грибами C. albicans: выявлено преимущественное подавление персистентных характеристик Candida spp. под воздействием E. faecium и повышение — при сокультивировании с E. faecalis.
Заключение. Полученные данные о подавлении факторов персистенции C. albicans авирулентными штаммами E. faecium открывают перспективу для их дальнейшего изучения в качестве основы антимикотического биопрепарата.
Ключевые слова: C. albicans, E. faecalis, E. faecium, факторы персистенции, ПЦР, гены вирулентности, межмикробные взаимодействия.
1 12 12 1 O.A. Pashinina, M. V. Sycheva '-, O.L. Kartashova '-, L.P. Popova ,
T.M. Pashkova 1
THE GENETIC CHARACTERISTIC OF VIRULENCE POTENTIAL OF ENTERO-COCCI ISOLATED FROM DIFFERENT MICROBIOTAS WITHIN HUMAN BODY AND THE MODIFICATION OF PERSISTENCE FACTORS OF CANDIDA ALBICANS UNDER THEIR EFFECT
1 Institute of Cellular and Intracellular Symbiosis, UrB RAS, Orenburg, Russia
2 Orenburg State Agrarian University, Orenburg, Russia
Objective. The objective was to study the effect of Enterococci, which were isolated from human microbiotas at different body sites in pathological conditions and were featured with genetic virulence determinants, on the persistent properties of Candida albicans.
Materials and Methods. In carrying out the research, 64 strains of C. albicans and 17 strains of Enterococcus genus were isolated from human gastrointestinal (GI) tract examined for dysbiosis and from reproductive tracts of women experiencing pathological conditions. Identification of Candida albicans was carried out using standard methods- and bacteria of Enterococ-cus genus were detected by multiplex-PCR analysis. Anti-lysozyme activity of C. albicans was assessed using the method by O.V. Bukharin et al (1999), and biofilm formation was assayed following the method by G.A. O'-Toole et al. (2000). Genes encoding the synthesis of virulence factors of Enterococcus bacteria (gelE, cylM, cylB, cylA, esp, hyl, asa) were revealed using PCR detection. Bacterial-fungal interactions between C. albicans and Enterococcus spp. were studied during co-isolation in common broth. Statistically, the results were treated using t-Student'-s test.
Results. Virulence determinants have been detected in Enterococcus faecalis only. Characteristic features have been established for the intermicrobial interactions of virulent and avirulent isolates of Enterococcus spp. with C. albicans: it has been established that the persistent characteristics of Candida spp. exhibit prevalent inhibition under the effect of E. faecium and show an increase when co-isolated with E. faecalis.
Conclusion. The data obtained on the inhibition of C. albicans persistence factors by avirulent strains of E. faecium open up a prospect of further studying the strain as a basis for antimycotic bio-based agents.
Key words: C. albicans, E. faecalis, E. faecium, persistence factors, PCR, virulence genes, intermicrobial interactions.
Введение
Энтерококки, входящие в состав нормальной микрофлоры тела человека, играют важную роль в обеспечении колонизационной резистентности слизистых оболочек. В то же время они являются представителями условно-патогенных бактерий, способных вызывать аутоинфекцию [1]. В последние годы изучение бактерий рода Enterococcus как биологических объектов и оценка их роли в физиологии и патологии человека чаще всего рассматриваются сквозь призму участия энтерококков в возникновении инфекционных заболеваний, количество которых постоянно увеличивается [2, 3]. Охарактеризован вирулентный потенциал энтерококков, выделенных из клинического материала и кишечника, на фено- и генотипическом уровне [4, 5].
Вместе с тем, присутствуя в микробиоценозе, бактерии рода Enterococcus взаимодействуют с другими условно-патогенными микроорганизмами, в том числе с грибами рода Candida, что может оказать существенное влияние как на колонизацию слизистой, так и на течение инфекционного процесса [6]. Не случайно пристальное внимание исследователей в последнее время направлено на изучение взаимодействия симбионтов в микросимбиоценозе при инфекции [7].
В связи с этим целью работы явилось изучение особенностей влияния энтерококков, выделенных из разных биотопов тела человека при патологии
Бюллетень Оренбургского научного центра УрО РАН (электронный журнал), 2015, № 4 и отличающихся по наличию генетических детерминант вирулентности, на персистентные свойства C. albicans.
Материалы и методы
Материалом для исследования явились культуры Candida albicans (n=64), изолированные из фекалий пациентов с дисбиозом кишечника I-III степени и из репродуктивного тракта женщин, страдающих кольпитом и сальпингоофоритом. Выделение и идентификацию грибов рода Candida проводили по общепринятым методикам [8]. У выделенных штаммов грибов определяли антилизоцимную активность (АЛА) по методике О. В. Бухарина [9], образование биопленок (ОБ) по методике G. O'-Toole et al. [10].
Параллельно, путем посева исследуемого материала на желчно-эскулиновый агар с азидом натрия («Hi Media», Индия) из кишечника и репродуктивного тракта были выделены энтерококки (10 и 7 штаммов, соответственно), которые идентифицировали до вида с помощью мультиплексной полимеразной цепной реакции (ПЦР) по наличию видовых генов [11]. Гены, кодирующие факторы вирулентности энтерококков: цитолизины — cylA, cylB, cylM, желатиназу — gelE, гиалуронидазу — hyl, поверхностные белки, участвующие в адгезии и инвазии — esp, asa, определяли с помощью ПЦР.
Для постановки ПЦР бактериальные лизаты получали с помощью реагента «ДНК-экспресс» («Литех», Россия). Детерминанты вирулентности энтерококков обнаруживали с помощью известных праймеров, представленных в таблице [12−14]. Синтез праймеров осуществлен компанией «Синтол» (Москва).
Амплификацию проводили с 1 мкл лизата в термоциклере «Терцик» (ДНК технология, Россия) по следующему протоколу: 1 цикл — 92 °C 3 мин- 5 циклов — 92 °C по 5 с, 59 °C по 5 с, 72 °C по 5 с- 25 циклов — 1 мин при 92 °C, 1 мин при 59 °C, 1 мин при 72°С- последний цикл включал 20 с при 92 °C, 1 мин — 59 °C и элонгацию в течение 10 мин при 72 °C. Для обнаружения генов, кодирующих синтез hyl, asa и esp, проводили мультиплексную ПЦР с 1 мкл ли-зата в термоциклере «Терцик» по следующему протоколу: 1 цикл — 95 °C 15 мин- 30 циклов денатурации при 94 °C по 1 мин, отжиг при 56 °C по 1 мин и элонгация при 72 °C по 1 мин- последний цикл включал элонгацию в течение 10 мин при 72 °C.
Таблица. Праймеры, использованные для обнаружения детерминант вирулентности энтерококков [12−14]
Размер
Ген Праймеры Последовательность 5'- -3'- продукта реакции, п.н.
hyl hyl1 ACAGAAGAGCTGCAGGAAATG 276
hyl2 GACTGACGTCCAAGTTTCCAA
asa asa1 GCACGCTATTACGAACTATGA 375
asa2 TAAGAAAGAACATCACCACGA
esp esp1 AGATTTCATCTTTGATTCTTA-G 510
esp2 AATTGATTCTTTAGCATCTGG
gelE te9 ACCCCGTATCATTGGTTT 419
te10 ACGCATTGCTTTTCCATC
cylM te13 CTGATGGAAAGAAGATAGTAT 742
te14 TGAGTTGGTCTGATTACATTT
cylB te15 ATTCCTACCTATGTTCTGTTA 843
te16 AATAAACTCTTCTTTTCCAAC
cylA te17 TGGATGATAGTGATAGGAAGT 517
te18 TCTACAGTAAATCTTTCGTCA
Продукты амплификации генов анализировали путем электрофорети-ческого разделения в горизонтальном 1% или 2% агарозном геле, содержащем бромистый этидий. Результаты визуализировали в ультрафиолетовом свете. В качестве маркеров использовали GeneRuler 1 kbp DNA Ladder и GeneRuler 100 bp DNA Ladder (Fermentas, Литва). Положительное заключение о наличии гена делали при обнаружении в дорожке специфической светящейся полосы определенной массы, которую устанавливали по линейке молекулярных масс (рис. 1).
Взаимодействие грибов и бактерий исследовали при совместном культивировании в бульоне Шедлера («Hi Media», Индия) [15]. Для этого по 0,05 мл взвеси суточных агаровых культур C. albicans и Enterococcus sp. (мутность 2 по шкале Мак Фарланда) вносили в 5,0 мл жидкой культуральной среды, инкубировали при 370С в течение 24 часов, затем высевали грибы в объеме 0,01 мл на среду Сабуро, вновь инкубировали при 370С 24 ч и определяли у выросших C. albicans АЛА и ОБ. Контролем служили чистые культуры C. albicans.
Статистическую обработку данных осуществляли с использованием параметрических методов. Достоверность различий оценивали по t-критерию Стъюдента [16].
Рис. 1. Результат мультиплексной ПЦР по выявлению генов hyl, esp и asa у вагинальных изолятов E. faecalis. Примечание: дорожка 1 — маркер молекулярного веса (GeneRuler 100 bp DNA Ladder (Fermentas, Литва)) — дорожка 2 — отрицательный контроль- штаммы 1, 2, 3, 4 -специфический продукт реакции (510 bp), соответствующий гену esp- штаммы 1, 2, 3 — специфический продукт реакции (375 bp), соответствующий гену asa.
Результаты и обсуждение
Выделенные энтерококки были идентифицированы с помощью мультиплексной ПЦР по наличию видовых генов, кодирующих синтез суперок-сиддисмутазы: 12 штаммов (70,5%) были отнесены к виду Enterococcus faecalis, 5 (29,5%) — к виду Enterococcus faecium. Все штаммы E. faecium и 5 штаммов E. faecalis были выделены из кишечника, 7 штаммов E. faecalis — из репродуктивного тракта.
Детерминанты вирулентности с помощью ПЦР были обнаружены только у изолятов вида E. faecalis (рис. 2).
Комплекс генов, кодирующих синтез цитолизина (cylA, cylB, cylM), обнаружен у всех штаммов E. faecalis, выделенных из кишечника, причем 60% штаммов содержали ген cylM, обеспечивающий посттрансляционную модификацию, а гены cylA (отвечающий за активацию цитолизина) и cylB (необходимый для транспорта цитолизина), выявлены у 80% штаммов. Ни у одного из изученных энтерококков, изолированных из репродуктивного тракта женщин, не обнаружен ген су1А, а комплекс остальных генов су1-оперона встречался у 86% штаммов. У всех штаммов, выделенных из обоих биотопов, отсутствовал ген, ответственный за продукцию гиалуронидазы (hyl).
500 400
300
№ штамма
%
90 80 70 60
50
40
30
20
10
cylA
cylB cylM
Кишечник
hyl esp asa gelE
Репродуктивный тракт
Рис. 2. Распространенность генетических детерминант вирулентности изученных штаммов Enterococcus faecalis.
Ген, кодирующий белки клеточной стенки, ответственные за уклонение от иммунных механизмов макроорганизма (esp), содержали 80% штаммов, выделенных из кишечника, и 86% культур, изолированных из репродуктивного тракта. Установлено, что ген asa, отвечающий за синтез поверхностного белка-адгезина, и ген gelE, обусловливающий протеолитическую активность, содержали 60% штаммов E. faecalis, выделенных из кишечника, и 57% и 86% изолятов, выделенных из репродуктивного тракта, соответственно.
На следующем этапе работы изучено влияние бактерий рода Enterococcus на способность C. albicans инактивировать лизоцим. Установлено, что штаммы E. faecium снижали антилизоцимную активность у фекальных изолятов C. albicans с 0,7±0,02 мкг/мл*ОП до 0,5±0,01 мкг/мл*ОП, (p& lt-0,01), а штаммы E. faecalis стимулировали способность к инактивации лизоцима как у фекальных (с 0,7±0,02 мкг/мл*ОП до 0,8±0,02 мкг/мл*ОП), так и у вагинальных изолятов C. albicans (с 0,5±0,02 мкг/мл*ОП до 0,6±0,03 мкг/мл*ОП) (p& lt-0,01).
При изучении влияния бактерий рода Enterococcus на способность C. albicans образовывать биоплёнки установлено, что E. faecalis стимулировали способность к ОБ как у фекальных (с 1,5±0,07 до 1,7±0,05), так и у вагинальных изолятов C. albicans (с 1,2±0,04 до 1,5±0,08), тогда как E. faecium -снижали способность к ОБ с 1,5±0,07 до 1,1±0,01 (p& lt-0,01).
0
Таким образом, при изучении межмикробных взаимодействий энтерококков и C. albicans, выделенных из кишечника и репродуктивного тракта при дисбиозе и инфекционно-воспалительных заболеваниях, установлено преимущественное подавление факторов персистенции C. albicans под действием E. faecium и повышение персистентного потенциала C. albicans под действием E. faecalis.
Заключение
Определение генов, контролирующих синтез известных факторов вирулентности, у клинических изолятов E. faecalis и E. faecium имеет важное значение для дифференциации симбиотических и патогенных штаммов энтерококков [17]. В отличие от E. faecаlis, среди выделенных нами культур E. faecium не обнаружено ни одного штамма, обладающего генами патогенно-сти. Полученные результаты подтверждают существующее мнение о том, что бактерии вида E. faecalis характеризуются большей вирулентностью [18, 19].
Генетические детерминанты вирулентности у E. faecаlis, выделенных как из кишечника, так и репродуктивного тракта, выявляли с различной частотой. В частности, для E. faecаlis, выделенных из репродуктивного тракта, характерна широкая распространенность генов, кодирующих протеолитиче-ские ферменты и белки, способствующие уклонению от иммунной системы, и генов cylB, cylM в комплексе (выявлены у 86% штаммов). В то же время штаммы, содержащие ген, отвечающий за синтез поверхностного белка-адгезина, с большей частотой выделялись из кишечника, поскольку адгезины им жизненно необходимы для нормальной колонизации желудочно-кишечного тракта [20]. Кроме того штаммы, выделенные из кишечника, характеризовались наличием генов cyl-оперона, в отличие от культур, выделенных из репродуктивного тракта.
Проведённые исследования по межмикробным взаимодействиям энтерококков, отличающихся по наличию генетических детерминант вирулентности, с C. albicans показали, что E. faecium способны подавлять биопленко-образование и антилизоцимную активность грибов C. albicans, тогда как E. faecаlis, выделенные из обоих изученных биотопов, напротив — повышать их персистентные свойства.
Полученные данные подтверждают выявленный ранее феномен оппо-зитного (усиление/подавление) влияния микроорганизмов на биологические свойства пары микросимбионтов в условиях микросимбиоценоза [21] и могут
Бюллетень Оренбургского научного центра УрО РАН (электронный журнал), 2015, № 4 быть важны для понимания патогенетических особенностей формирования эндогенных инфекций и дисбиозов различных биотопов организма человека.
Представленные материалы открывают перспективу для дальнейшего изучения штаммов E. faecium, не обладающих детерминантами вирулентности и эффективно подавляющих персистентный потенциал культур C. albicans, выделенных при патологии [22, 23], в качестве основы антимикоти-ческого биопрепарата.
ЛИТЕРАТУРА
1. Бухарин О. В., Валышев А. В. Биология и экология энтерококков. Екатеринбург: УрО РАН, 2012. 227 с.
2. Габриэлян Н. И., Горская Е. М., Спирина Т. С. и др. Энтерококки как возбудители послеоперационных инфекционных осложнений. Журнал микробиологии, эпидемиологии и иммунобиологии. 2007. 4: 50−53.
3. Kow N., Ferzandi T.R. Enterococcus osteomyelitis secondary to pyelonephritis. Int. Urogynecol. J. 2013. 24(4): 691−2.
4. Валышева И. В. Генетическая характеристика вирулентного потенциала энтерококков кишечной микробиоты человека. Журнал микробиологии, эпидемиологии и иммунобиологии. 2012. 4: 44−47.
5. Бухарин О. В., Валышева И. В., Карташова О. Л. и др. Характеристика вирулентного потенциала клинических изолятов энтерококков. Журнал микробиологии, эпидемиологии и иммунобиологии. 2013. 3: 13−18.
6. Cruz M.R., Graham C.E., Gagliano B.C. et al. Enterococcus faecalis inhibits hyphal morphogenesis and virulence of Candida albicans. Infect. Immun. 2013. 1 (81): 189−200.
7. Бухарин О. В., Валышев А. В., Иванова Е. В. и др. Взаимодействие возбудителя с ассоциативными бактериями при сальмонеллезной инфекции. Журнал микробиологии, эпидемиологии и иммунобиологии. 2008. 3: 3−6.
8. Реброва Р. Н. Грибы рода Candida при заболеваниях негрибковой этиологии. М.: Медицина, 1989. 128 с.
9. Бухарин О. В. Персистенция патогенных бактерий. М.: Медицина, 1999. 366 с.
10. O'-Toole G., Kaplan H.B., Kolter R. Biofilm formation as microbial development. Annu. Rev. Microbiol. 2000. 54: 49−79.
11. Jackson C.R., Fedorka-Cray P.J., Barrett J.B. Use of a genus- and species-specific multiplex PCR for identification of enterococci. J. Clin. Microbiol. 2004. 42 (8): 3558−3565.
12. Semedo T., Santos M.A., Martins P. et al. Comparative study using type strains and clinical and food isolates to examine hemolytic activity and occurrence of the cyl operon in entero-cocci. J. Clin. Microbiol. 2003. 6 (41): 2569−2576.
13. Vankerckhoven V., Van Autgaerden T., Vael C. et al. Development of a Multiplex PCR for the Detection of asal, gelE, cylA, esp, and hyl Genes in Enterococci and Survey for Virulence Determinants among European Hospital Isolates of Enterococcus faecium. J. Clin. Microbiol. 2004. 10(42): 4473−4479.
14. Reviriego C., Eaton T., Martin R. et al. Screening of virulence determinants in Enterococcus faecium strains isolated from breast milk. J. Hum. Lact. 2005. 21 (2): 131−137.
15. Ермоленко Е. И., Ждан-Пушкина С.Х., Суворов А. Н. Взаимодействие C. albicans и Lactobacillus plantarum in vitro. Проблемы медицинской микологии. 2004. 6: 49−54.
16. Ашмарин И. П., Воробьёв А. А. Статистические методы в микробиологии. Л.: Гос. изд. мед. лит, 1962. 177 с.
17. Бондаренко В. М., Суворов А. Н. Симбиотические энтерококки и проблемы энтерокок-ковой оппортунистической инфекции. Журнал микробиологии, эпидемиологии и им-
мунобиологии. 2008. 3: 14−27.
18. Mundy L.M., Sahm D.F., Gilmore M. Relationships between enterococcal virulence and antimicrobial resistence. Clin. Microbiol. Rev. 2000. 13 (4): 513−522.
19. Eaton T.J., Gasson M.J. Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates. Appl. Envir. Microbiol. 2001. 67: 1628−35.
20. Olmsted S.B., Dunny G.M., Erlansen S.L. et al. 1994. A plasmid encoded surface protein on Enterococcus faecalis augments its internalization by cultured intestinal epithelial cells. J. Infect. Dis. 170: 1549 -1556.
21. Бухарин О. В., Лобакова Е. С., Перунова Н. Б. и др. Симбиоз и его роль в инфекции. Екатеринбург: УрО РАН, 2011. 300 с.
22. Капустина О. А., Карташова О. Л., Потехина Л. П. и др. Биопленкообразование Candida sp., выделенных из разных биотопов тела человека. Проблемы медицинской микологии. 2011. 13(2): 81.
23. Капустина О. А., Карташова О. Л., Чайникова И. Н. Факторы персистенции грибов рода Candida, выделенных из разных биотопов. Проблемы медицинской микологии. 2010. 12(2): 92.
Поступила 1. 12. 2015
(Контактная информация: Карташова Ольга Львовна — доктор биологических наук, зав. лабораторией по изучению механизмов и регуляции персистенции бактерий Института клеточного и внутриклеточного симбиоза УрО РАН- адрес: 460 000, г. Оренбург, ул. Пионерская, 11- тел. /факс (3532)774463- e-mail: labpersist@mail. ru)
LITERATURA
1. Buharin O.V., Valyshev A.V. Biologija i jekologija jenterokokkov. Ekaterinburg: UrO RAN, 2012. 227 s.
2. Gabrijeljan N.I., Gorskaja E.M., Spirina T.S. i dr. Jenterokokki kak vozbuditeli posleoperacionnyh infekcionnyh oslozhnenij. Zhurnal mikrobiologii, jepidemiologii i immunobiologii. 2007. 4: 50−53.
3. Kow N., Ferzandi T.R. Enterococcus osteomyelitis secondary to pyelonephritis. Int. Urogynecol. J. 2013. 24(4): 691−2.
4. Valysheva I.V. Geneticheskaja harakteristika virulentnogo potenciala jenterokokkov kishechnoj mikrobioty cheloveka. Zhurnal mikrobiologii, jepidemiologii i immunobiologii. 2012. 4: 44−47.
5. Buharin O.V., Valysheva I.V., Kartashova O.L. i dr. Harakteristika virulentnogo potenciala klinicheskih izoljatov jenterokokkov. Zhurnal mikrobiologii, jepidemiologii i immunobiologii. 2013. 3: 13−18.
6. Cruz M.R., Graham C.E., Gagliano B.C. et al. Enterococcus faecalis inhibits hyphal morphogenesis and virulence of Candida albicans. Infect. Immun. 2013. 1 (81): 189−200.
7. Buharin O.V., Valyshev A.V., Ivanova E.V. i dr. Vzaimodejstvie vozbuditelja s associativnymi bakterijami pri sal'-monelleznoj infekcii. Zhurnal mikrobiologii, jepidemiologii i immunobiologii. 2008. 3: 3−6.
8. Rebrova R.N. Griby roda Candida pri zabolevanijah negribkovoj jetiologii. M.: Medicina, 1989. 128 s.
9. Buharin O.V. Persistencija patogennyh bakterij. M.: Medicina, 1999. 366 s.
10. O'-Toole G., Kaplan H.B., Kolter R. Biofilm formation as microbial development. Annu. Rev. Microbiol. 2000. 54: 49−79.
11. Jackson C.R., Fedorka-Cray P.J., Barrett J.B. Use of a genus- and species-specific multiplex PCR for identification of enterococci. J. Clin. Microbiol. 2004. 42 (8): 3558−3565.
12. Semedo T., Santos M.A., Martins P. et al. Comparative study using type strains and clinical
and food isolates to examine hemolytic activity and occurrence of the cyl operon in entero-cocci. J. Clin. Microbiol. 2003. 6 (41): 2569−2576.
13. Vankerckhoven V., Van Autgaerden T., Vael C. et al. Development of a Multiplex PCR for the Detection of asa1, gelE, cylA, esp, and hyl Genes in Enterococci and Survey for Virulence Determinants among European Hospital Isolates of Enterococcus faecium. J. Clin. Microbiol. 2004. 10(42): 4473−4479.
14. Reviriego C., Eaton T., Martin R. et al. Screening of virulence determinants in Enterococcus faecium strains isolated from breast milk. J. Hum. Lact. 2005. 21 (2): 131−137.
15. Ermolenko E.I., Zhdan-Pushkina S.H., Suvorov A.N. Vzaimodejstvie C. albicans i Lactobacillus plantarum in vitro. Problemy medicinskoj mikologii. 2004. 6: 49−54.
16. Ashmarin I.P., Vorob'-jov A.A. Statisticheskie metody v mikrobiologii. L.: Gos. izd. med. lit, 1962. 177 s.
17. Bondarenko V.M., Suvorov A.N. Simbioticheskie jenterokokki i problemy jenterokokkovoj opportunisticheskoj infekcii. Zhurnal mikrobiologii, jepidemiologii i immunobiologii. 2008. 3: 14−27.
18. Mundy L.M., Sahm D.F., Gilmore M. Relationships between enterococcal virulence and antimicrobial resistence. Clin. Microbiol. Rev. 2000. 13 (4): 513−522.
19. Eaton T.J., Gasson M.J. Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates. Appl. Envir. Microbiol. 2001. 67: 1628−35.
20. Olmsted S.B., Dunny G.M., Erlansen S.L. et al. 1994. A plasmid encoded surface protein on Enterococcus faecalis augments its internalization by cultured intestinal epithelial cells. J. Infect. Dis. 170: 1549 -1556.
21. Buharin O.V., Lobakova E.S., Perunova N.B. i dr. Simbioz i ego rol'- v infekcii. Ekaterinburg: UrO RAN, 2011. 300 s.
22. Kapustina O.A., Kartashova O.L., Potehina L.P. i dr. Bioplenkoobrazovanie Candida sp., vydelennyh iz raznyh biotopov tela cheloveka. Problemy medicinskoj mikologii. 2011. 13(2): 81.
23. Kapustina O.A., Kartashova O.L., Chajnikova I.N. Faktory persistencii gribov roda Candida., vydelennyh iz raznyh biotopov. Problemy medicinskoj mikologii. 2010. 12(2): 92.
Образец ссылки на статью:
Пашинина О. А., Сычева М. В., Карташова О. Л., Попова Л. П., Пашкова Т. М. Генетическая
характеристика вирулентного потенциала энтерококков, выделенных из разных биотопов
тела человека, и модификация факторов персистенции Candida albicans под их влиянием.
Бюллетень Оренбургского научного центра УрО РАН. 2015. 4: 1−10 [Электронный ресурс]
(URL: http: //elmag. uran. ru: 9673/ magazine/Numbers/2015 -4/Articles/OAP-2015−4. pdf).

ПоказатьСвернуть
Заполнить форму текущей работой