Генодиагностика оспы овец в Кыргызской республике

Тип работы:
Реферат
Предмет:
Сельскохозяйственные науки


Узнать стоимость

Детальная информация о работе

Выдержка из работы

УДК 619: 578. 821. 21
ГЕНОДИАГНОСТИКА ОСПЫ ОВЕЦ В КЫРГЫЗСКОЙ РЕСПУБЛИКЕ
Р. З. Нургазиев R.Z. Nurgaziyev
GENE DIAGNOSTICS OF SHEEP POX IN THE KYRGYZ REPUBLIC
-v/-
Ключевые слова: оспа, вирус, геном, поли-меразная цепная реакция, иммуноферментный анализ, фрагмент ДНК, праймер, изолят, штамм.
Были изложены результаты оптимизации проведения ПЦР с использованием одной пары прай-меров. Используемые параметры ПЦР приведенные в статье были самыми оптимальными, что привело к успешному генетическому исследованию полученных изолятов. Исследование ПЦР на специфичность дало возможность нам понять, что использованные нами праймеры специфичны только для вирусов оспы овец и коз. Было изучено генетическое соответствие вакцинного штамма SP к вирусу оспы овец и коз. С помощью ПЦР был исследован материал от больных животных из разных областей республики и определена специфичность оптимизированной ПЦР. Данная работа поможет внедрить в ветеринарную практику наиболее специфичный метод диагностики оспы овец и коз. Ветеринарная служба Кыргызской республики нуждается в современных экспресс-методах исследования, гарантирующих получение результатов на молекулярном уровне. Результаты генетических исследований позволяют на территории республики производить диагностические и вакцинные препараты. Для широкого применения ПЦР в республике необходимы высококвалифицированные специалисты, которые нуждаются в научнообоснованных результатах молекулярно-биологических и генетических исследований. Используя оптимизированные параметры ПЦР в исследованиях, ветеринарные специалисты Кыргызской республики будут иметь возможность своевременно выявлять этиологию болезней и осуществлять профилактические мероприятия. Использование местных штаммов вируса оспы овец и коз для изготовления вакцинных препаратов приведет к стабилизации эпизоотического состоя-
ния в республике, так как использование зарубежных вакцин в настоящее время имеет отрицательные результаты как с финансовой, так и с противоэпизоотической точки зрения.
Keywords: sheep pox, virus, genome, polymerase chain reaction (PCR), enzyme immunoassay, DNA fragment, primer, isolate, strain.
Optimized PCR results with the use of one primer pair are presented. The used PCR parameters described in the paper were the most optimal and that led to successful genetic investigation of the obtained isolates. The PCR specificity study revealed that the used primers were specific only to sheep and goat pox virus. The genetic fitness of the vaccine strain SP to the sheep and goat pox virus was investigated. By means of the PCR the pathological materials from sick animals from different regions of the Republic were investigated in and the specificity of the optimized PCR was determined. This study will help to introduce the most specific method for diagnosis of sheep pox and goat pox to veterinary practice. The Veterinary Service of the Kyrgyz Republic needs new and rapid diagnostic techniques that ensure the results at the molecular level. The results of our genetic investigations enable the production of diagnostic and vaccine preparations in the Republic. The wide use of PCR in the Republic requires qualified professionals who need evidence-based results of molecular biology and genetic investigation. By using the optimized PCR parameters the veterinary specialists will be able to timely identify the disease etiology and implement preventive measures. The use of local strains of sheep pox and goat pox virus for the production of vaccines will lead to the stabilization of the epizootic situation in the Republic as the current use of foreign vaccines has negative results both financially and in terms of animal disease control.
Нургазиев Рысбек Зарылдыкович, д.в.н., проф., член-корр. НАН КР, ректор, Кыргызский национальный аграрный университет им. К. И. Скрябина, г. Бишкек, Кыргызская республика. Тел.: +996 (312) 54-52-10. E-mail: knau-info@mail. ru.
Nurgaziyev Rysbek Zaryldykovich, Dr. Vet. Sci., Prof., Corresponding Member of Natl. Acad. of Sci. of Kyrgyz Republic, Rector, Kyrgyz National Agricultural University named after K.I. Skryabin, Bishkek, Kyrgyz Republic. Ph.: +996 (312) 54-52-10. E-mail: knau-info@mail. ru.
Введение
Диагностика на оспу основана на анализе эпизоотологических, клинических, эпидемиологических данных, патологоанатомических изменений, результатах лабораторных исследований и биопробы. При типичном течении болезни ее диагностировать не трудно. Так, при тщательном обследовании овец пораженной отары всегда можно найти отдельных
животных с типичными розеолами и папулами на бесшерстных участках кожи. Диагноз на оспу считают подтвержденным при получении положительного результата одним или несколькими лабораторными методами с учетом предварительного диагноза, поставленного на основании клинико-эпизоото-логических и патологоанатомических данных.
В Кыргызской республике для диагностики оспы из серологических методов используются: реакция связывания комплемента (РСК), реакция нейтрализации (РН), иммуно-ферментный анализ (ИФА) и полимеразная цепная реакция (ПЦР). Каждый метод наряду с положительными качествами имеет и отрицательные стороны в плане их экспрессности, технической простоты постановки.
Целью научной работы является проведение исследований по оптимизации полиме-разной цепной реакции с одной парой прай-меров для диагностики оспы овец и коз и дальнейшего изучения генома вируса (табл. 1).
Для достижения этих целей необходимо было решить следующие задачи:
1) подбор праймеров для ПЦР-
2) оптимизация параметров ПЦР-
3) секвенирование полученных фрагментов ДНК.
Объекты и методы
Объектами исследований служили больные животные из разных областей республики. Для исследований использовали пробы крови, кусочки пораженных участков кожи.
Выделение вируса оспы проводили коммерческим набором, изготовленным компанией «Ахудеп», также для постановки ПЦР были использованы реагенты компании «Qiagen», праймеры.
Таблица 1
Праймеры для ПЦР
Экспериментальная часть
Проведенный анализ генома ДНК вируса с помощью полимеразной цепной реакции был признан качественным тестом для сравнения родственных вирусов. Показали возможность применения метода ПЦР и уровень различий между различными изолятами вирусов рода сарпрох, как определено с помощью секве-нирования.
Эффективность разрабатываемой методики ПЦР во многом зависит от качества выделенной нуклеиновой кислоты. Для оптимизации условий пробоподготовки при проведении ПЦР было испытано несколько способов выделения ДНК из культуральных штаммов, патологического материала. Следует отметить, что причиной ложноотрицательных результатов ПЦР могут быть ингибиторы, присутствующие в некоторых биологических образцах, а также неправильная подготовка проб для выделения ДНК.
При оптимизации условий постановки ПЦР нами была проведена серия предварительных экспериментов, в ходе которых учитывались следующие факторы: температура отжига праймеров, время денатурации, синтеза, концентрация праймеров, ионов магния и количество матрицы. В ходе экспериментов был подобран оптимальный температурный режим ПЦР при проведении амплификаций фрагментов генома вируса оспы овец и коз. Анализ продуктов ПЦР проводили методом электрофореза в 2,5%-ном агарозном геле при напряжении 90−120 В до прохождения бромфеноловым синим 2−3 см от старта. Наличие фрагмента расчетной длины 194 п.н. свидетельствовало о присутствии ДНК вируса в исследуемой пробе.
Оптимизацию условий постановки ПЦР проводили с использованием ДНК, выделенной из чувствительной культуры клеток почки овец, зараженной вирусом оспы овец.
Таблица 2 Оптимальный температурный режим проведения ПЦР при амплификации фрагментов вируса оспы& gt-1 овец
Стадия реакции Температура Время Количество циклов
Денатурация 95оС 3 мин. 1
Денатурация 94оС 30 с 30
Отжиг 55оС 30 с
Синтез 73оС 30 с
Синтез 72оС 5 мин. 1
В последующих исследованих были выделены ДНК из вакцинного штамма & lt-^Р" оспы овец, двух штаммов оспы коз (ГК и Ре11ог). Кроме того, были использованы ДНК аденовируса КРС, герпесвируса КРС 1 типа (ин-фекционнный ринотрахеит КРС), герпесвируса КРС 4 типа, парвовируса КРС и лейкоза КРС, а также два штамма оспы птиц (КВ-ЭМ и К) в качестве контроля.
На первом этапе исследований для проверки специфичности метода кроме штаммов оспы овец и коз мы включили в качестве отрицательного контроля два штамма вируса оспы птиц, которые являются представителями семейства poxviridae. Ранее с помощью данного метода нами была проверена его специфичность. В качестве отрицательного контроля были взяты вирусы других представителей семейства poxviridae (вирус контагиозного пустулезного дерматита овец, мик-сомы кроликов) и была показана высокая специфичность данного метода.
При тестировании проб использовали разное количество ДНК для проведения ПЦР. Результаты данных исследований представлены в таблице 3.
Название праймера Последовательность нуклеотидов 5'--3'- Положение в геноме*
КО-5 GTGTGACTTTCCTGCCGAAT 1249−1268
КО-6 TCTATTTTATTTCGTATATC 1398−1417
Из результатов исследований видно, что с помощью метода ПЦР удалось выявить специфический фрагмент ДНК оспы овец и коз (пробы 1−3). Как и следовало ожидать данный специфический фрагмент не был выявлен в отрицательных контролях (пробы 4, 5). Это еще раз подтверждает специфичность данного метода.
Таблица 3
Результаты исследования проб методом ПЦР
Для проверки специфичности оптимизированного метода ПЦР нами проведено выявление вирусспецифического фрагмента ДНК генома оспы овец в материалах, отобранных от 25 больных животных из различных регионов Кыргызской республики. В результате исследований во всех 25 исследуемых образцах патологического материала был выявлен вирусспецифический фрагмент ДНК генома оспы овец (табл. 4).
Определение первичной структуры продуктов ПЦР после амплификации ДНК, выделенной из культуры клеток почки овец, инфицированной вирусом оспы овец, или вирусом оспы коз, проводили с целью подтверждения специфичности полученных фрагментов. С использованием праймеров КО-5 и КО-6 были секвенированы фрагменты, полученные путем амплификации клеточной ДНК из вируспродуцирующей культуры.
Таблица 4 Результаты исследования проб в РДСК, ИФА и ЦПР
Район Поступило проб Методы
РДСК ИФА ПЦР
Тонский 2 — - +
Сокулукский 2 — - +
Жумгальский 3 + + +
Кочкорский 9 + + +
Нарынский 8 + + +
г. Бишкек 1 — + +
Всего 25
Результаты и их обсуждение
Таким образом, в работе был использован классический метод ПЦР для диагностики оспы овец, с использованием праймеров КО-5 и КО-6 из генома вируса оспы овец. Однако с помощью данного метода невозможно провести дифференциацию вируса оспы овец от вируса оспы коз. В связи этим были продолжены поиски и разработка более совершенных методик постановки диагностических реакций.
Результаты секвенирования показывают, что изоляты вирусов оспы овец и коз имеют большое генетические сходство, в этом заключается огромное практическое значение при изготовлении диагностических и профилактических препаратов.
Вирус Штамм Количество пробы
2,5 мкл 5 мкл 10 мкл
Оспа овец БР + + +
Оспа коз ГК + + +
Оспа коз Ре11ог — + +
Оспа птиц КВ-ЭМ — - -
Оспа птиц К — - -
ВОК РеИог1 (КНИИВ)
ВОК 0201^ (GENBANK) ВОО SP (КНИИВ)
ВОК Ре11ог (GENBANK) ВОК ОК (КНИИВ)
ВОО МБКН1 (GENBANK) ВОО, А (GENBANK) ВОО Ти-У2 127 (GENBANK) ВОО КБ (GENBANK)
3 2−1 0
процент нуклеотидных различии
Рис. Дендрограмма уровня отличий разных штаммов ВОО и ВОК, полученная сравнением нуклеотидны/х последовательностей участка гена Н1
Выводы
Исследованиями установлено, что вакцинный штамм SP вируса оспы овец больше соответствует группе оспы коз, нежели группе оспы овец. Как известно, данный штамм был получен при длительной адаптации полевого штамма к культуре клеток почки овец. Культура клеток получена из почки овец, и, возможно, при адаптации данного штамма к культуре клеток произошло изменение нук-леотидной последовательности штамма.
Из данных дендрограммы (рис.) следует, что секвенированный нами фрагмент штамма ГК практически полностью совпадает с опубликованными последовательностями оспы коз, за исключением одной замены в положении 73.
Таким образом, проведенные исследования по оптимизации простого метода ПЦР с одной парой праймеров показали пригодность данного метода для выявления вирус-специфического фрагмента ДНК генома оспы овец простой в технологическом отношении его постановке. Определение первичной последовательности показало наличие последовательности, характерной для вирусов оспы овец и оспы коз.
Библиографический список
1. Керембекова У. Ж. Совершенствование средств и методов лабораторной диагностики оспы овец: автореф. дис. канд. вет. наук. — Алматы, 1994.
2. Carn V.M. Control of capripoxvirus infections // Vaccine. — 1993. — Vol. 11 (13). — P. 1275−1279.
3. Gershon P.D., Ansell D.M., Black D.N. A comparison of the genome organization of capripoxvirus with that of orthopoxviruses / / J. Virol. — Vol. 63 (11). — P. 4703−4708.
4. Mangana-Vougiouka O., Markoulatos P., Koptopoulos G., Nomikou K., Bakandritsos N., Papadopoulos O. Sheep poxvirus identification by PCR in cell cultures // J. Virol. Methods. — 1999. — Vol. 77 (1). — P. 75−79.
5. Mangana-Vougiouka O., Markoulatos P., Koptopoulos G., Nomikou K., Bakandritsos N., Papadopoulos P. Sheep poxvirus identification from clinical specimens by PCR, cell culture, im-munofluorescence and agar gel immunoprecipi-tation assay // Mol. Cell Probes. — 2000. -Vol. 14 (5). — P. 305−310.
6. Rao T.V., Bandyopadhyay S.K. A comprehensive review of goat pox and sheep pox and their diagnosis // Anim. Health Res. Rev.
— 2000. — Vol. 1 (2). — P. 127−136.
7. Tsotsos A. Developments in taxonomy of viruses. Present status // Hellenic Virol. -1996. — Vol. 1 (2). — P. 175−183.
References
1. Kerembekova U. Zh. Sovershenstvovanie sredstv i metodov laboratornoi diagnostiki ospy ovets: avtoref. diss. … kand. vet. nauk. — Almaty, 1994.
2. Carn V.M. Control of capripoxvirus infections // Vaccine. — 1993. — Vol. 11 (13). -P. 1275−1279.
3. Gershon P.D., Ansell D.M., Black D.N. A comparison of the genome organization of capripoxvirus with that of orthopoxviruses // J. Virol. — Vol. 63 (11). — P. 4703−4708.
4. Mangana-Vougiouka O., Markoulatos P., Koptopoulos G., Nomikou K., Bakandritsos N., Papadopoulos O. Sheep poxvirus identification by PCR in cell cultures // J. Virol. Methods. -1999. — Vol. 77 (1). — P. 75−79.
5. Mangana-Vougiouka O., Markoulatos P., Koptopoulos G., Nomikou K., Bakandritsos N., Papadopoulos P. Sheep poxvirus identification from clinical specimens by PCR, cell culture, im-munofluorescence and agar gel immunoprecipi-tation assay // Mol. Cell Probes. — 2000. -Vol. 14 (5). — P. 305−310.
6. Rao T.V., Bandyopadhyay S.K. A comprehensive review of goat pox and sheep pox and their diagnosis // Anim. Health Res. Rev.
— 2000. — Vol. 1 (2). — P. 127−136.
7. Tsotsos A. Developments in taxonomy of viruses. Present status // Hellenic Virol. -1996. — Vol. 1 (2). — P. 175−183.
+ + +

ПоказатьСвернуть
Заполнить форму текущей работой