Роль субдомена инозин-5-монофосфат-дегидрогеназы в процессах обмена пуриновых нуклеотидов

Тип работы:
Диссертация
Предмет:
Биохимия
Страниц:
111


Узнать стоимость

Детальная информация о работе

Выдержка из работы

Актуальность темы. Пуриновые нуклеотиды — важнейшие компоненты клетки, участвующие в процессах хранения и передачи наследственной информации, хранения и передачи энергии, сигнальной трансдукции [206]. Клетка осуществляет строгий контроль биосинтеза и деградации пуриновых нуклеотидов, что является необходимым условием адекватного функционирования всех клеточных процессов, происходящих с их участием [205]. Однако значительная часть механизмов этого контроля остаётся неизученной [16]. Роль гуаниловых нуклеотидов в клетке многогранна и включает синтез ДНК, РНК, белка, процессы G-трансдукции и многочисленные ферментативные реакции, в ходе которых GTP выступает в качестве

I ! ' j энергодонора [2,10]. Инозин-5'-монофосфат-дегидрогеназа (ИМФДГ- Е.С. I

1.1.1. 205) — фермент de novo синтеза гуаниловых нуклеотидов, катализирующий превращение инозин-5'-монофосфата (IMP) в ксантозин-5' 1 монофосфат (ХМР) [79]. Клетки ряда опухолей, а также эмбриональные ткани характеризуются повышенной& raquo- экспрессией ИМФДГ, что свидетельствует о важной роли фермента в процессах канцеро- и эмбриогенеза. Ингибиторы ИМФДГ снижают клеточный пул гуаниловых нуклеотидов и обладают антипролиферагивным действием, что является основой их клинического применения для иммунносуппрессивной, противоопухолевой и антивирусной терапии [155]. Более глубокое понимание регуляторных процессов, протекающих с участием ИМФДГ, может способствовать дальнейшей разработке и совершенствованию лекарственных препаратов-ингибиторов фермента [155].

В дополнение к коровому (каталитическому) домену в структуре ИМФДГ выделяют эволюционно консервативный домен Бейтмана (субдомен), функциональное назначение которого в настоящее время не установлено [160]. I

Мутации последовательности гена ИМФДГ-1 человека, кодирующей субдомен, вызывают наследственную форму пигментного ретинита — тяжелого дегенеративного заболевания сетчатки, приводящего к слепоте. Патогенетические механизмы развития этого заболевания неизвестны [14]. Аминокислотные замены в субдомене ИМФДГ, как и полное удаление субдомена, не вызывают изменений каталитической активности фермента in vitro [78]. Данный факт свидетельствует, что развитие пигментного ретинита, по-видимому, не связано с недостатком гуаниловых нуклеотидов в клетках сетчатки, и субдомен ИМФДГ может выполнять какую-то регуляторную роль в, обмене пуриновых нуклеотидов, не связанную с основной функцией фермента.

Целью настоящего исследования явилось изучение функциональной роли субдомена ИМФДГ в процессах обмена пуриновых нуклеотидов. Согласно'

• «» ' '. («! поставленной цели было предусмотрено решение следующих задач:

1. Сконструировать мутант Escherichia• coli с удаленной последовательностью субдомена ИМФДГ на хромосоме.

2. Исследовать влияние мутации на способность клетки к. поддержанию нормального внутриклеточного пула свободных пуриновых, нуклеотидов Е. coli, а также на распределение потока

IMP в направлении синтеза гуаниловых и адениловых нуклеотидов. i

3. Изучить изменения протеома Е. coli в ответ на-удаление субдомена ИМФДГ.

1 «

4. Найти & laquo-неожиданные»- фенотипические проявления мутации с помощью методов метаболического фетотипического скрининга.

5. Изучить влияние точковых мутаций гена ИМФДГ, ассоциированных с пигментным ретинитом, на нуклеотидный метаболизм Е. coli.

Научная новизна. Впервые сконструированы бактериальные штаммы, позволяющие прицельно изучать физиологическую роль субдомена ИМФДГ in vivo. Впервые описан эффект удаления субдомена ИМФДГ in vivo на нуклеотидые пулы клетки и распределение потоков IMP в направлении синтеза адениловых и гуаниловых нуклеотидов. Впервые показана роль субдомена ИМФДГ в процессах регуляции синтеза адениловых нуклеотидов. Впервые исследован in vivo эффект мутаций, ассоциированных с пигментным. ретинитом.

Теоретическое и практическое значение работы.

Теоретическое значение работы состоит в создании новых представлений, о роли субдомена ИМФДГ в обмене пуриновых нуклеотидов клетки.

Результаты, исследования позволяют рекомендовать сконструированную нами мутантную форму Е. coli как модель для исследования функциональной значимости субдомена ИМФДГ.

Полученные данные могут быть использованы при рассмотрении патогенетических механизмов развития пигментного ретинита.

Личный^ вклад автора заключается в* самостоятельном — проведении всех представленных экспериментальных исследований, за исключением^ синтеза олигонуклеотидов (синтез, выполнен в& quot- Fannie Rippel DNA Synthesis and Biotechnology Facility, Fox Chase Cancer Center), автоматического ДНК-сиквенирования (выполнено в DNA Sequencing Facility, Fox Chase Cancer Center), пептидного! синтеза и. приготовления антител (выполнены в компании 21st Century Biochemicals, USA), метаболического скрининга (компания Biolog, USA) и,. • дифференциального гель-дисплея" с последующей масс-спектрометрической детификацией белков (компания Applied Biomics, USA).

Внедрение результатов исследования. Основные положения диссертационной работы используются в научно-исследовательской работе, а также в лекционном курсе и на практических занятиях Ha кафедрах биологической химии и медицинской биологии Смоленской государственной медицинской академии.

-, i: ¦? 1 '

Апробация работы. Основные положения диссетрации- доложены и обсуждены на заседаниях проблемной- комиссии (иммунология, иммунопатофизиология, иммунопатоморфология) Смоленской государственной, медицинской, академии (2006−2009) — доложены на 36-й конференции молодых ученых Смоленской государственной' медицинской академии (Смоленск, 2008 г.), 12-й конференции молодых ученых онкологического центра Fox Chase (Филадельфия, США, 2007 г.), 13-й конференции молодых ученых онкологического центра Fox Chase (Филадельфия, США, 2008 г.), 2-й конференции & laquo-Интеграция метаболизма и геномики& raquo- Американской микробиологической ассоциации (Монреаль, Канада, 2007 г.).

Положения, выносимые на защиту:

1. Штамм Е. coli MP 101 (мутация guaB^CBS) может быть использован для изучения in vivo физиологической роли субдомена ИМФДГ.

2. Субдомен ИМФДГ является транс-регулятором de novo синтеза адениловых нуклеотидов из IMP.

3. Мутации гена ИМФДГ, ассоциированные с развитием пигментного ретинита, вызывают снижение пула адениловых нуклеотидов клетки, но не оказывают влияния на пул гуаниловых нуклеотидов.

выводы

1. Гуанин-прототрофный штамм МР101 с удаленной хромосомной ДНК-последовательностью, кодирующей субдомен (мутация guaBACBS), может быть использован для изучения функциональной роли субдомена ИМФДГ.

2. Субдомен ИМФДГ является транс-регулятором синтеза адениловых нуклеотидов из IMP. Удаление субдомена релаксирует синтез адениловых нуклеотидов из IMP при росте на минимальной среде, что приводит к увеличению пула АТР.

3. Мутация guaB является условно-летальной. Штамм MP 101 aCBS guaBr) не способен к росту на минимальной среде в присутствии I предшественников IMP (аденозина, инозина, гипоксантина) за счет 1 > бесконтрольного увеличения пулов адениловых нуклеотидов, приводящего к дефициту пиримидиновых нуклеотидов и остановке г роста. i 1.

4. Каталитическая активность корового домена ИМФДГ и регуляторная i I роль субдомена ИМФДГ функционально независимы. Присутствие субдомена ИМФДГ является необходимым и достаточным условием нормального контроля синтеза адениловых нуклеотидов, вне зависимости от того, прикреплен ли субдомен к каталитически активному или инактивированному коровому домену.

5. Возможным эффектом мутации guaBACBS могут являться изменения посттрансляционной модификации а-АТР синтетазы, а также увеличение экспрессии GMP-синтетазы, фактора элонгации Ти и 3-ф ос ф оглицерат-киназы.

6. Точковые мутации в гене ИМФДГ, ассоциированные с пигментным ретинитом, снижают синтез адениловых нуклеотидов. Это t w [ ,) I 1 свидетельствует о двустороннем эффекте субдомена ИМФДГ на биосинтез аденилатов.

1.3 Заключение

По данным литературы, интактность субдомена ИМФДГ не является обязательным условием для’сохранения нормальной каталитической функции фермента in vitro [56,97,149]. Однако в литературе не представлено данных об in vivo эффекте удаления субдомена. Согласно принципу A. Krogh, для изучения любой физиологической функции существует или может быть создан оптимальный организм [125]. Почти абсолютная эволюционная консервативность путей синтеза пуриновых нуклеотидов и структуры ИМФДГ оставляет широкие возможности выбора модельного организма. По ряду причин, наиболее оптимальной моделью, очевидно, является Е. coli: во-первых, в отличие от эукариот, у бактерий имеется лишь один ген ИМФДГ (геном человека кодирует 2 изофермента, геном дрожжевых грибов — 4 изофермента) — i 4 во-вторых, бактерии, и в особенности Е. coli, являются наиболее легким объектом для генетического манипулирования- в-третьих, в силу своей

1) относительной простоты, Е. coli — наиболее глубоко охарактеризованный клеточный организм планеты. Очевидно, для изучения функции субдомена ИМФДГ, оптимальным организмом являлся бы бактериальный штамм, у которого хромосомная последовательность, кодирующая CBS домен ИМФГ

1 ¦ i * «располагающаяся внутри последовательности корового домена), была бы i ' i i i i, удалена без смещения рамки считывания корового домена. Ожидается, что i t подобный мутант (назовем его guaBACBs) будет способен к de novo синтезу пуриновых нуклеотидов и, как следствие, росту на минимальной среде (т.е. прототрофии). Сравнительное изучение пуринового обмена мутанта guaBACBS и дикого штамма может пролить свет на возможные функции субдомена ИМФДГ in vivo.

ГЛАВА II. МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

Эксперименальная часть работы выполнена в лаборатории биохимии и молекулярной биофизики онкологического центра Fox Chase (Филадельфия, США), руководимой профессором Джорджем Дугласом Маркамом.

2.1 Микробиологические методы

Бактериальные клетки выращивались на минимальных средах MOPS [147] и М9 [141,173]. Рост культуры клеток оценивался путем измерения оптической плотности культуры спектрофотометром Hewlett Packard 8452А при длине волны 600 нм. Антибиотики добавляли в среду роста в следующих

• «> i * концентрациях: тетрациклин — 20 мкг/мл- канамицин — 35 мкг/мл- хлорамфеникол, 12,5 мкг/мл- ампициллин- - 100 мкг/мл. Все минимальные среды приготавливались с добавлением 1 мкг/мл тиамина. Пуриновые основания и нуклеозиды добавлялись в среду в концентрациях, указанных в описаниях отдельных экспериментов.

2.2 Молекулярно-генетические методы

Синтез олигонуклеотидов осуществлялся на автоматическом ДНК' 1 ч i синтезаторе- последовательности использованных олигонуклеотидов приведены в Табл. 4. Основные молекулярно-генетические процедуры& laquo- (ПЦР, очистка продуктов амплификации, лигирование, приготовление компетентных клеток, трансформация, выделение плазмид, автоматическое сиквенирование, Р1 шУ-трансду кция) осуществлялись в соответствии со стандартными протоколами и рекомендациями [141,173]. Все вновь сконструированные плазмиды и штаммы подвергались автоматическому сиквенированию для проверки соответствия ДНК-конструкции ожидаемому результату.

Табл. 4. Олигонуклеотиды, использованные в исследовании. Мутагенные последовательности, а также химерные последовательности, содержащие промоторы и участки для рекомбинирования с хромосомой, обозначены подчеркиванием.

Олигонуклеотид Последовательность нукпеотидов

DM373 5'-CAGG CAG AAG AAGTTCGCCGTGTG ААААААС ACG AATCTG GTGG AG CTG CT TCGAAGTTCC

DM374 5'-ACCCGCACCTGCGCCAACCGCTGCACCAACACGCAGACGGCCATGAATATC CTCCTTAGTTCC

DM378 5'-ATTCAGTCGATAGTAACCCGCCCT

DM416 5 '-GTG AGCG AG ATCAAATTCTAAATCAG CAG G

DM417 5 '-TC AG GAG С CCAG ACG GTAGTTC

DM429 5'-CGGCATTGGCCCTGGCTCTATCGCGACAACTCGTATCGTGACTGGCG

DM430 5'-CGCCAGTCACGATACGAGTTGTCGCGATAGAGCCAGGGCCAATGCCG

DM457 5 '-ACCCCAG G CTTTAC ACTTTATG CTTC С G G CTC GTATAATGTGTG GACAATATT TATTAACCACTCTGGTCGAG

DM465 5'-GAGCGTTGACTCCGCCTTTGTTATGTCACAAAAAGGATAAAACACACCAAAC ACCCCCCAAAACC

DM466 5'-CTCCCGCTCCGGCTTCACAAGGCAATCGCCTTGCAGCGAAACACAACACAC AACCACACCACACCAC

DM475 5'-CTCAG G С AAAAC AAATTCTTGCTCATTTAACCCCG GAGTTGTG ATCTG GAG С TGCTTCGAAGTTCC

DM476 5'-CTTAATAAGCAGGCCGGACAGCATCGCCATCCGGCACTGATACGAGGTATG AATATCCTCCTTAGTTCC

DM479 5'-TCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGTTTCAAT AATTTCACACAGGAAACAGCTATGAAATTTCCCGGTAAACGTA

DM480 5'-TTAACGATCCCAGTAAGACTCTTCC

DM481 5 '-GCCAAAAAG GTC AATAGAAACGTTG

DM482 5'-GCATAGGTCATACAAATGGATATTACAGAC

DM483 5'-CGGTGTTGACCGTGTGCTGACAGTGGCTCTGCACGCTGAACAGATTCAGGG TTTC

DM484 5'-GAAACCCTGAATCTGTTCAGCGTGCAGAGCCACTGTCAGCACACGGTCAAC ACCG

DM498 5'-CAGATAATATAAATCGCCCGACATGAAGTCGGGCGAAGAGAATCAGGAGCC CAGACGGTAGTTC

IDT-1 5'-CGGCATTGGCCCTGGCTCTATCGCGACAACTCGTATCGTGACTGGCG

IDT-2 5'-CGCCAGTCACGATACGAGTTGTCGCGATAGAGCCAGGGCCAATGCCG

2.2.1 Gam-Bet-Exo рекомбинирование

Штамм Е. coli MPI Ol (guaBACBS) был сконструирован на основе штамма Е. coli BW25113 [40] с применением технологии рекомбинирования [40,52,203]. На первом этапе, нуклеотидная последовательность, кодирующая CBS-домен в стуктуре хромосомного гена gnaB (аминокислотные остатки №№ 116−238 в структуре ИМФДГ), замещалась геном канамицин фосфотрансферазы {кап), фланкированным FRT-последовательностями (сайтами распознавания. FRT-рекомбиназы). Для этого ген кап, фланкированный FRT-последовательностями, ПЦР-амплифицировали с плазмиды pKD4, используя химерные праймеры (DM373, DM374),, содержащие на 5'-концах ДНК-последовательности, гомологичные последовательностям, фланкирующим сайт рекомбинации на хромосоме. Как и следовало ожидать, полученный штам (МР41) был

1 • 1 ауксотрофен по отношению к гуанину. На втором этапе рекомбинации ген канамицин фосфотрансферазы & laquo-вырезали»- действием FRT рекомбиназы [40]. I

Рекомбинанты селектировали на минимальной среде как колонии, вновь I приобредшие способность к прототрофии. Данный метод оставляет на месте замещаемого сегмента хромосомной ДНК т.н. & laquo-шрам»-: нуклеотиную I последовательность одной копии FRT сайта, соответствующую открытой рамке

I ' ' I считывания из 24 аминокислотных остатков

I. • <

GAASKFLYFLENRNFGIGTKEDIH). Таким образом, полученный штамм, обозначенный МР101, содержал делецию субдомена ИМФДГ с сохранением рамки считывания каталитического домена (здесь и далее мутация обозначена как «guaBuCBS»), г ' (ч

Табл. 5. Штаммы, сконструированные и использованные в ходе исследования

Штамм Материнский штамм/Генотип Стратегия конструкции/Ссылку"

BW25113 lacP rrnBrl4 AlacZwn6 hsdR514 [40]

AaraBADAm3 ArhaBADLD1 $

MP41 [BW25113] guaB: :kan рекомбинирование- замена последовательности субдомена на кап

I I • * I с С0ХРанением последовательности 'корового домена- KanR, > - •

Штамм Материнский штамм/Генотип Стратегия конструкции/Ссылки

МР101 [МР41] guaBACBS удаление кап FRT-рекомбиназой [161]

JW1615 [BW25113] add: :кап Keio collection [17]

JW5401 [BW25113] guaB: :kan Keio collection [17]

JW0466 [BW25113] gsk: :kan Keio collection [17]

JW4135 [BW25113] purAr. kan Keio collection [17]

JW0101 [BW25113] guaCr. kan Keio collection [17]

ТТ25 401 tet TetR- лаборатория J. Roth

МР310 [BW25113] guaBACBS addr. kan MP101 x P1(JW1615), Kan'

МРЗЗО [BW25113] guaBACBS gsk: :kan MP101 x Pl (JW0466), Kanr

МР255 [BW25113] deoDr. tet рекомбинирование, BW25113 deoD-btet, Tetr

МР350 [BW25113] guaBACBS deoDr. tet рекомбинирование, MP101 deoD-^tet, Tetr

МР2501 [BW25113] deoDr. tet purAr. kan MP255 x P1(JW4135), Kanr Tetr

МР3501 [BW25113] guaBACBS deoDr. tet purAr. kan MP350 x P1(JW4135), Kanr Tetr

МР402 [B W25113] purBr. kan рекомбинирование, BW25113 purB-Ъкап, Kanr

МР4021 [BW25113] deoDr. tet purBr. kan MP255 x P1(MP402), Kanr Tetr

МР4022 [BW25113] guaBACBS deoDr. tet purBr. kan MP350 x P1(MP402), Kanr Tetr

МР2502 [BW25113] deoDr. tet guaCr. kan MP255 x P1(JW0101), Kanr Tetr

МР3502 [BW25113] guaBACBS deoDr. tet guaCr. kan MP350 x P1(JW0101), Kanr Tetr

МР501 [MP41] рекомбинирование, ИМФДГК84У-

МР502 [MP41] ' - рекомбинирование, ИМФДГТ95М

МР503 [MP41] рекомбинирование, ИМФДГШ38Ы

МР504 [MP41] рекомбинирование, ИМФДГШ00Ы

МР505 [MP41] рекомбинирование, ИМФДГЕ205Р

МР506 [MP41] рекомбинирование, ИМФДГК212Е

МР507 [MP41] рекомбинирование, ИМФДГУ2421

Штаммы МР255 (deoD: :tet)' к МР350 (guaB*CBS deoD: :tet) получали

1 «рекомбинированием, путем замены открытой рамки считывания гена deoD на ген tet, являющийся детерминантой устойчивости к тетрациклину (см. Табл. 5). Для ПЦР-амплификации гена tet с хромосомной ДНК штамма ТТ25 401 воспользовались химерными олигонуклеотидами DM465 и DM456 (см: Табл. 4). Аналогичным образом был сконструирован штамм МР402: последовательность гена ригВ была замещена геном канамицин фосфотрансфразы, амплифицированным с плазмиды pKD4 с помощью химерных олигонуклеотидов DM475 и DM475. Во всех случаях использовался стандартный протокол рекомбинирования [40].

Штаммы МР501, МР502, МР503, МР504, МР505, МР506, МР507,-несущие точковые мутации в хромосомном гене giiaB, конструировали на основе штамма МР41 (см. Табл. 5). На первом этапе точечные мутации вносили в плазмиду pGUAB (Табл. 7), содержащую дикий ген giiaB под контролем нативного промотора. Для мутагенеза использовали процедуру QuikChange (Stratagene) и мутагенные олигонуклеотиды, последовательности которых даны, в Табл. 6. Таким образом, полученные промежуточные плазмиды содержали I нужные мутантные аллели guaB, кодирующие гены ИМФДГ с аминокислотными заменами, указанными в Табл: 6 и Табл. 12. На втором этапе мутированные аллели guaB ПЦР-амплифицировали с промежуточных плазмид t >, и gam-йе/'-е. хо-рекомбинировали в штамм МР41, замещая ген канамицин-фосфотрансферазы нужным аллелем guaB. Для амплификации использовались праймеры DM378 и DM498 (Табл. 4). v ' 1

Табл 6. Олигонуклеотиды, использованные для сайт-направленного мутагенеза в ходе конструкции промежуточных плазмид, несущих гены ИМФДГ с аминокислотными заменами, ассоциированными с пигментным ретинитом. Подчеркиванием отмечены мутагенные кодоны & laquo-+»--нитевых праймеров. замена Олигонуклеотиды для мутагенеза.

R84W DM486: 5'-TGAACGCCAGGCAGAAGAAGTTTGGCGTGTGAAAAAACACGAATCTG

DM487: 5'-CAGATTCGTGTTTTTTCACACGCCAAACTTCTTCTGCCTGGCGTTCA t

T95М DM488: 5' AAAACACGAATCTGGTGTGGTGATGGATCCGCAGACTGTTCTGCCAA DM489: 5' TTGGCAGAACAGTCTGCGGATCCATCACCACACCAGATTCGTGTTTT

D138N DM490: 5' GGTGGGTATTATCACCGGTCGTAACGTGCGTTTTGTTACCGACCTGA DM491: 5' TCAGGTCGGTAACAAAACGCACGTTACGACCGGTGATAATACCCACC

D200N DM503: 5' GATCGGCATGATCACCGTGAAAAACTTCCAGAAAGCGGAACGTAAAC DM504: 5' GTTTACGTTCCGCTTTCTGGAAGTTTTTCACGGTGATCATGCCGATC

А/к замена Олигонуклеотиды для мутагенеза

Е205Р DM502: 5' CGTGAAAGACTTCCAGAAAGCGCCGCGTAAACCGAACGCCTGTAAAG

DM501: 5' CTTTACAGGCGTTCGGTTTACGCGGCGCTTTCTGGAAGTCTTTCACG

V242I DM496: 5' TGACGCGCTGGTTGCCGCAGGCATTGACGTTCTGCTGATCGACTCCT DM497: 5' AGGAGTCGATCAGCAGAACGTCAATGCCTGCGGCAACCAGCGCGTCA

2.2.2 Конструкция плазмид

Однокопийные плазмиды, несущие гены guaB+ и guaBACBS под контролем нативного промотора, конструировали на основе вектора pCCl (Copy Control PCR Cloning Kit, компания Epicentre, США). Гены guaB+ и guaBACBS с 5' регуляторными последовательностями амплифицировали с геномной ДНК штаммов Е. coli BW25113 и Е. coli МР101, соответственно. Геномную ДНК Е. coli выделяли с помощью набора PureLink™ Genomic DNA Purification Kit (кат. < I I ' V I ill''. 4 ¦ 45−7005, Invitrogen, USA)., Для амплификации использовали олигонуклеотиды DM417 и DM417. ПЦР-продукты клонировали в вектор pCCl в соответствии с рекомендациями фирмы-производителя (см. Табл. 7).

ПоказатьСвернуть

Содержание

ГЛАВА I. ИНОЗИН-5 '-МОНОФОСФАТ-ДЕГИДРОГЕНАЗА И ОБМЕН ПУРИНОВЫХ НУКЛЕОТИДОВ (ОБЗОР ЛИТЕРАТУРЫ).

1.1 Обмен пуриновых ну клеотидов.

1.1.1 Фосфорибозил-пирофосфат-синтетаза.

1.1.2 Регуляция синтеза IMP fife novo.

1.1.3 Синтез адениловых и гуаниловых нуклеотидов из IMP.

1.1.4 Утилизация пуриновых оснований и нуклеозидов.

1.1.5 Взаимопревращения пуриновых нуклеотидов.

1.2 Инозин-5'-монофосфат-дегидрогеназа. 20-

1. 2:1 Место ИМФДГ в биосинтезе пуриновых нуклеотидов. 20"-

1.2.2 Структура и механизм ферментативного катализа ИМФДГ.

1.2.3 Ингибиторы ИМФДГ: клиническое значение и роль в изучении ферментативного механизма.

1.2.4 Структура субдомена ИМФДГ и его роль в развитии аутосомно-доминантного пигментного ретинита.

Список литературы

1. Дудиньска, В., Хлыпчак, А. Й., Скотницка, Е., Суска, М. Метаболизм пуринов в эритроцитах человека. // Биохимия. — 2006. — Т. 71. — №. 5. — С. 581−591.

2. Жаров, С. Н., Лучшев, В. Н. Комплексная терапия больных хроническимгепатитом С с применением препарата рибавирин медуна. // Российский. j ', медицинский журнал. 2006. — Т. 2. — С. 37−38.

3. Мауриня, X. А. Использование и трансформация пуриновых и пиримидиновых соединений микроорганизмами. // Межвуз. сб. науч. тр. ЛГУ, Рига- 1981. '

4. Медик, В. А., Токмачев, М. С., Фишман, Б. Б. Статистика в медицине иг ^ *. *. !биологии. М.: Медицина, 2000. — 412 с.

5. Северин- Е. С. Биохимия. М.: Гэотар-Медиа, 2008. — 759 с.

6. Фатеев, И. В., Константинова, И. Д., Швец, В- И. Биотехнологический способ синтеза новых аналогов рибавирина. // Вестник МИТХТ им. М: В- Ломоносова. 2008: — Т. 3. — №. 4. — С. 56−60.

7. Шницын, А. В, Широкова, Е. А. Рибонуклеозид-5-монофосфаты с дизамещенным фосфатом не взаимодействуют с инозин монофосфат дегидрогеназой: // Биоорганическая химия. — 1997. Т. 23. — №. 1. — С. 45.

8. Abrahams, J. Р-, Leslie, A. G-, Lutter, R., Walker, J. E. Structure at 2.8 A resolution of Fl-ATPase from bovine heart mitochondria. // Nature. 1994. -V 370: — N. 6491- - P. ?621−628-

9. Ataullakhanov, F. I,. Yitvitsky, V. Mi What determines the intracellular ATP concentration. // Biosci Rep. 2002. — V. 22. — N. 5−6. — P. 501−511.

10. Bateman, A. The structure of a domain common to archaebacteria and the homocystinuria disease protein. // Trends Biochem Sci: 1997. — V. 22. — N. 1. -P. 12−13.

11. Benson, G. E., Gots, J. S. Regulation of GMP reductase in Salmonella typhimurium: // Biochim Biophys Acta. 1975. — V. 403. — N. 1. — P. 47−57.

12. Berry, R. M. ATP synthesis: the world’s smallest wind-up toy. // Curr Biol. -2005, — V. 15. N. 10. -P. R385−387.

13. Biemans-Oldehinkel, E., Mahmood, N. A., Poolman, B. A sensor, for intracellular ionic strength. //Proc Natl Acad Sci U S A. 2006. — V. 103. — N. 28. -P. 10 624−10 629.

14. Bochner, B. R., Gadzinski, P., Panomitros, E. Phenotype microarrays for high-throughput phenotypic testing and' assay of gene function: II- Genome Res. -2001. -V. ll. -N. 7. -P. 1246−1255.

15. Bradford, M. M. A rapid and sensitive method for the quantitation ofi > microgram quantities of protein utilizing the principle of protein-dye binding. //1 hi V-!. i •. -

16. Anal Biochem. 1976. — V. 72. — N. — P. 248−254..

17. Brox, L. W., Hampton, A. Inosine 5-phosphate dehydrogenase. Kinetic mechanism and evidence for selective reaction of the 6-chloro analog of inosine 5'-phosphate with a cysteine residue at the inosine 5-phosphate site. //1 r ' '

18. Biochemistry. 1968. — V. 7. — N. 7. — P. 2589−2596.i i '

19. Butland, G., Peregrin-Alvarez, J. M., Li, J., Yang, W., Yang, X., Canadien, V., i

20. Cashel, M., Gallant, J. Two compounds implicated in the function of the RCi ' '. i i i i •gene of Escherichia coli. // Nature. 1969. — V. 221. -N. 5183. — P. 838−841.

21. Chapman, A. G., Atkinson, D. E. Adenine nucleotide concentrations and turnover rates. Their correlation with biological activity in bacteria and yeast. // Adv Microb Physiol: -1977. V. 151 — P. 253−306.

22. Escherichia coli K-12 using PCR product^. II, Proc Natl Acad Sci U S A,.. 'i, > i. !. '•:. •. 2000. V. 97. — N. 12. — P. 6640−6645.

23. Davies, I. J., Drabble, W. T. Stringent and growth-rate-dependent control of the gua operon of Escherichia coli K-12. // Microbiology. 1996. — V. 1421. N. 9-P. 2429−2437..

24. Deckers-Hebestreit, G., Greie, J., Stalz, W., Altendorf, K. The ATP synthase of'. i * «i.. i ••<' I*"'»

25. Escherichia coli: structure and function of F (0) subunits. // Biochim Biophys Acta. 2000. — V. 145.8. -N. 2−3. -P. 364−373.

26. Derreumaux, P., Schlick, T. The loop opening/closing motion of the enzyme triosephosphate isomerase. // Biophys. J. 1998. — V. 74. — N. 1. — P. 72−81.

27. Di Bisceglie, A. M., McHutchison, J., Rice, C. M. New therapeutic strategies' i, 1 for hepatitis C. // Hepatology. 2002. — V. 35. — N. 1. — P. 224−231.

28. Digits, J. A., Hedstrom, L. Kinetic mechanism of Tritrichomonas foetus inosine 5-monophosphate dehydrogenase. // Biochemistry. 1999: — V. 38.1. N. 8. -P. 2295−2306.t ,

29. Digits, J. A., Hedstrom, L. Kinetic mechanism of Tritrichomonas foetus inosine 5-monophosphate dehydrogenase. // Biochemistry. 1999. — V1. 38. -N. 8. -P. 2295−2306.

30. Digits, J. A., Hedstrom, L. Species-specific inhibition of inosine 5'-monophosphate dehydrogenase by mycophenolic acid. // Biochemistry. 1999. -V. 38. -N. 46. -P. 15 388−15 397.

31. Dimroth, P. Operation of the F (0) motor of the ATP synthase. // Biochim. i

32. Biophys Acta. 2000, — V. 1458. -N. 2−3. — P. 374−386. i

33. Elion, G. B. The purine path to chemotherapy. // Science. 1989. — V*. 244. -N. 4900. -P. 41−47.i. i >. i

34. Ellis, H. M., Yu, D., DiTizio, T., Court, D: L. High efficiency mutagenesis, repair, and engineering of chromosomal DNA using single-strandedoligonucleotides. // Proc Natl Acad Sci U S A. 2001. — V. 98: — N. 12. — P. 6742−6746-

35. Eriksen- T. A., Kadziola, A., Bentsen, A. K., Harlow, K. W., Larsen, S. Structural basis for the function of Bacillus subtilis- phosphoribosyl-pyrophosphate synthetase. // Nat Struct Biol. 2000. — V. 7. — N. 4. — P. 303 308:. •

36. Farber, G. K., Petsko, G. A. The evolution ofv alpha/beta* barrel enzymes- // Trends Biochem. Sci: 1990-- V. 15. -N-.6.- P- 228−234-

37. Goldstein, B. M., Bell, J. E., Marquez, V. E. Dehydrogenase binding by tiazofurin anabolites. // J. Med- Chem. 1990- - V. 33: — N: 4. -P. 1123−1127.

38. Goldstein- B: M., Pankiewicz, K. W., (Eds.), Inosine Mophosphate Dehydrogenases, Oxford University Press, 2002. '

39. Green, S. Mi,. Malik, T., Giles, I. G-, Drabble, W. T. The purB gene of• • • ¦.

40. Escherichia coli K-12 is located in an- operon. // Microbiology: — 1996. — V. 142. -N. 11 P. 3219−3230,.

41. Grifantini- M. Tiazofiirine ICN Pharmaceuticals. // Curr. Opin. Invest. Drugs. -2000. V. 1. N. 2, — P: 257−262.

42. Gu, J. J., Stegmann- S., fGathy, K., Murray, R, Laliberte, J., Ayscue, L., Mitchell, B. S, Inhibition of T lymphoc^e activation in mice heterozygous for loss of the IMPDH II gene. // J. Clin. Invest. 2000. — V. 106. — N. 4. — P: 599 606. ,

43. Guillen Schlippe, Y. iV., I ledstrom, L. Is Arg418 the catalj^tic base required for the hydrolysis step- of- the IMP dehydrogenase reaction? // Biochemistry. -2005- -V,'44: -N. 35: P. 11 700−11 707:

44. Guillen Schlippe, Y. V., Riera, T. V., Seyedsayamdost, M. R., Hedstrom- L. Substitution of the conserved Arg-Tyr dyad «selectively disrupts the hydrolysis phase of the IMP dehydrogenase reaction. // Biochemistry. 2004- - V. 43. -N. 15. -P. 4511−4521.

45. Hammer-Jespersen, K., Buxton, R. S., Hansen, T. D. A second purine nucleoside phosphorylase in Escherichia coli K-12. II: Properties of xanthosine Phosphorylase and its induction by xanthosine. // Mol Gen Genet. 1980. — V. 179. -N. 2. -P. 341−348.

46. Hammer-Jespersen, K., Munch-Petersen, A., Schwartz, M., Nygaard, P. Induction of enzymes involed in the catabolism of deoxyribonucleosides and ribonucleosides in Escherichia coli K 12. // Eur J Biochem. 19 711 — V. 19. -N. 4. -P. 533−538.

47. Harlow, K. W., Nygaard, P., Hove-Jensen, B. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli. // J Bacteriol. — 1995- - Vs. 177. -N. 8. P. 2236−2240-

48. He, B., Zalkin, H. Regulation of Escherichia coli purA by purine repressor, one component of a dual control*mechanism: // J Bacterid. 1994! -V. 176. — N. 4. -P. 1009−1013.

49. Hedstrom, L. IMP dehydrogenase-linked retinitis pigmentosa. // Nucleosides Nucleotides Nucleic Acids. 2008: — V. 27. — N. 6. — P. 839−849.

50. Hedstrom,. L., Gan, L. IMP dehydrogenase: structural schizophrenia' and an unusual base. // Curr Opin Chem Biol: -2006: V. 10. -K 5. -P. 520−525.

51. Hershey, H. V., Taylor, M. W. Nucleotide sequence and deduced amino acid sequence of Escherichia coli adenine phosphoribosyltransferase and comparison with other analogous enzymes. // Gene. 1986. — V. 43. — N*. 3. — P. 287−293..

52. Heyde, E., Morrison,. J- F. Studies on inosine monophosphate dehydrogenase. Isotope exchange at equilibriumi // Biochim Biophys Acta. 1976. -- V. 429. -N. 3. — -P. 661−67,1. ,

53. Heyde, E., Nagabhushanam, A., Vonarx, M., Morrison, J. F. Studies on inosine monophosphate dehydrogenase. Steady, state kinetics. // Biochim Biophys Acta: 1976- - V. 429L-N. 3. -P: 645−660: *

54. Ho, Y., Gruhler, A., Heilbut, A., Bader, G. D., Moore, L., Adams, S. L., Millar,

55. A., Taylor, P.,. Bennett, K., Boutilier, K., Yang, L., Wolting, C., Donaldson- I., Schandorff, S., Shewnarane, J., Vo, M., Taggart, J., Goudreault, M., Muskat,

56. Hochstadt, J. Adenine phosphoribosyltransferase from Escherichia coli- // Methods EnzymoL 1978--V. 51. -P. 558−567.

57. P binding site in. the IMP. dehydrogenase from Tritrichomonas foetus. // Biochemistry. 1995.- V. 34. -N. 42. -P. 13 889−13 894.

58. Huete-Perez, J. A., Wu, J. C., Whitby, F. G., Wang, C. C. Identification of the IMP binding site in the IMP dehydrogenase from Tritrichomonas foetus. // Biochemistry. 1995. — V. 34. — N. 42. — P. 13 889−13 894.

59. Husnain, S. I., Thomas, M. S. The UP element is necessary but not sufficient for growth rate-dependent control of the Escherichia coli guaB promoter. // J Bacterid. 2008. — V. 190. — N. 7. — P. 2450−2457.

60. Hyle, J. W., Shaw, R. J., Reines, D. Functional distinctions between IMP dehydrogenase genes in providing mycophenolate resistance and guanine prototrophy to yeast. // J Biol Chem. 2003. — V. 278. — N. 31. — P. 2 847 028 478.

61. Ignoul, S., Eggermont, J. CBS domains: structure, function, and pathology in human proteins. // Am J Physiol Cell Physipl. 2005. — V. 289. — N! 6. — P. C1369−1378.

62. Ikegami, T., Natsumeda, Y., Weber, G. Recovery of the activities of IMP dehydrogenase and GMP synthase after treatment with tiazofiirin and acivicin in hepatoma cells invito. //Adv. Exp. Med. Biol. 1989. — V. 253B. — P. 299−304.

63. Ishikawa, H. Mizoribine and, mycophenolate mofetil. // Curr. Med. Chem.i. ¦ > > 1999. V. 6. -N. 7. — P. 575−597.

64. Ishikawa, H. Mizoribine and mycophenolate mofetil. 11 Curr Med Chem. 1999. V. 6. -N. 7. — P. 575−597.• t ' '

65. Jackson, R. C., Weber, G., Morris, H. P. IMP dehydrogenase, an enzyme linked with proliferation and malignancy. // Nature. 1975. — V. 256. — N. 5515. -P. 331−333.v «. • *., «

66. Jackson, R. C., Weber, G., Morris, H. P. IMP dehydrogenase, an enzyme linked with proliferation and malignancy. // Nature. 1975. — V. 256. — N. 5515. -P. 331−333. t

67. Jain, J., Almquist, S. J., Shlyakhter, D., Harding, M. W. VX-497: a novel, selective IMPDH inhibitor and immunosuppressive agent. // J Pharm Sci. -2001. -V. 90. -N. 5. P. 625−637.

68. Jensen, K. F. Apparent involvement of purines in the control of expression of Salmonella typhimurium pyr genes: analysis of a leaky guaB mutant resistant to pyrimidine analogs. // J Bacteriol. 1979.' - V. 138. — N. 3. — P. 731−738.

69. Jensen, K. F. Purine-nucleoside phosphorylase from Salmonella typhimurium and Escherichia coli. Initial velocity, kinetics, ligand banding, and reactionmechanism. // Eur J Biochem. 1976. — V. 61. — N. 2. — P. 377−386. i

70. Jensen, K. F. Regulation of Salmonella typhimurium pyr gene expression: effect, of changing both purine and pyrimidine nucleotide pools. // J Gen Microbiol. 1989. — V. 135. — N. 4. — P. 805−815.

71. Jensen, K. F., Nygaard, P. Purine nucleoside phosphorylase from Escherichia coli- and Salmonella typhimurium. Purification and some properties. // Eur J

72. Biochem. 1975. — V. 51. — N. 1. — P. 253−265. t

73. Jhee, K. H., Kruger, W. D. The role of cystathionine beta-synthase in homocysteine metabolism. // Antioxid Redox Signal. 2005. — V. 7. — N. 5−6. -P. 813−822.

74. Jochimsen, B. U., Hove-Jensen, B., Garber, B. B., Gots, J. S. Characterization1 tof a Salmonella typhimurium, mutant defective intiii 'phosphoribosylpyrophosphate synthetase. // J Gen Microbiol. 1985. -V. 131.^ ^ ¦-N. 2. -P. 245−252.r f I1. f

75. Juang, R. H., McCue, K. F., Ow, D. W. Two purine biosynthetic enzymes thati 1 •. i.. are required for cadmium tolerance in Schizosaccharomyces pombe utilizecysteine sulfinate in vitro. // Arch Biochem Biophys. 1993. — V. 304. — N. 2. -P. 392−401.

76. Kahn, B. B., Alquier, T., Carling, D., Hardie, D. G. AMP-activated protein kinase: ancient energy gauge provides clues to modern understanding of metabolism. // Cell Metab. 2005. — V. 1. — N. 1. — P. 15−25.

77. Kang, C., Kim, S., Fromm, H. J. Subunit complementation of Escherichia coli adenylosuccinate synthetase. // J Biol Chem. 1996. — V. 271. — N. 47. — P. 29 722−29 728.

78. Karlstrom, H. O. Inability of Escherichia coli B to incorporate addeddeoxycytidine, deoxyandenosine, and deoxyguanosine into DNA. // Eur J

79. Biochem. -1970. -V. 17. -N. l. -P. 68−71.

80. Kawasaki, H., Shimaoka, M., Usuda, Y., Utagawa, T. End-product regulation! •and kinetic mechanism of guanosine-inosine kinase from Escherichia coli. //

81. Biosci Biotechnol Biochem. 2000. — V. 64. — N. 5. — P. 972−979.i i <

82. Kennan, A., Aherne, A., Humphries, P. Light in retinitis pigmentosa. // Trends

83. Genet. -2005. -V. 21. -N. 2. -P. 103−110. i

84. Kerr, K. M., Cahoon, M., Bosco, D. A., Hedstrom, L. Monovalent cation activation in Escherichia coli inosine 5'-monophosphate dehydrogenase. // Arch Biochem Biophys. -2000. -V. 375. -N. l. -P. 131−137.

85. Keseler, I. M., Bonavides-Martinez, C., Collado-Vides, J., Gama-Castro, S., i

86. Gunsalus, R. P., Johnson, D. A., Krummenacker, M., Nolan, L. M., Paley, S., i i

87. Paulsen, I. T., Peralta-Gil, M., Santos-Zavaleta, A., Shearer, A. G., Karp, P. D. i ! i. < i

88. EcoCyc: a comprehensive view of Escherichia coli biology. // Nucleic Acids Res. 2009. — V. 37. -N. Database issue. — P. D464−470.

89. Kessler, A. I., Gots, J. S. Regulation of guaC expression in Escherichia coli. // J Bacteriol. 1985. — V. 164. -N. 3. -P. 1288−1293.

90. Krath, B. N., Hove-Jensen, B. Bacillus caldolyticus prs gene encoding phosphoribosyl-diphosphate synthase. // Gene. 1996. — V. 176. — N. 1−2. — P. 73−79.

91. Krogan, N. J., Peng, W. T., Cagney, G., Robinson, M. D., Haw, R., Zhong, G., Guo, X., Zhang, X., Canadien, V., Richards, D. P., Beattie, B. K., Lalev, A. ,

92. Zhang, W., Davierwala, A. P., Mnaimneh, S., Starostine, A., Tikuisis, A. P., i, i v > •

93. Grigull, J.,, Datta, N., Bray, J. E., Hughes, T. R., Emili, A., Greenblatt, J. F. High-de finition macromolecular composition of yeast RNA-processing complexes. // Mol Cell. 2004. — V. 13. — N. 2. — P. 225−239.

94. Krogh, A. Progress in physiology. // Am. J. Physiology. 1920. — V. 90. — N. -P. 243−251.

95. Lambden, P. R., Drabble, W. T. The gua operon of Escherichia coli K-12: evidence for polarity from guaB to guaA. // J Bacteriol. 1973. — V. 115. — N. 3. -P. 992−1002.

96. Leung, H. B., Schramni, V. L. Adenylate degradation in Escherichia coli. Therole of AMP nucleosidase and properties of the purified enzyme. // J Biol" I ' ' ! *

97. Chem. 1980. — V. 255. — N. 22. — P. 10 867−10 874.

98. Leung, H. B., Schramm, V. L. The structural gene for AMP nucleosidase. Mapping, cloning, and overproduction of the enzyme. // J Biol Chem. 1984. — Y. 259. — N. 11. — P. 6972−6978.

99. Lieberman, I., Kornberg, A., Simms, E. S. Enzymatic synthesis of pyrimidine nucleotides- orotidine-5'-phosphate and uridine-5-phosphate. // J Biol Chem. -1955. -V. 215. -N. l. -P. 403−451.

100. Liu, Y., Bohn, S. A., Sherley, J. L. Inosine-5-monophosphate dehydrogenase is a rate-determining factor for p53-dependent growth regulation. // Mol Biol Cell. 1998. — Y. 9. — N. 1. — P. 15−28.

101. Luecke, H., Prosise, G. L., Whitby, F. G. Tritrichomonas foetus: a strategy forstructure-based inhibitor design of a protozoan inosine-5-monophosphate1. ¦dehydrogenase. // Exp Parasitol. 1997. — V. 87. — N. 3. — P. 203−211.i: 1' i

102. Mager, J., Magasnik, B. Guanosine 5-phosphate reductase and. its role in the interconversion of purine nucleotides. // J Biol Chem. 1960. — V. 235. — P. 14 741 478. i i > i

103. Markham, G. D., Monovalent cation activation of IMP dehydrogenase, in: Pankiewicz, K.W., Goldstein, B.M., (Eds.), Inosine mophosphate dehydrogenase: a major theraputic target, Oxford University Press, 2002. s

104. Markovic, S., Dutzler, R. The Structure of the Cytoplasmic Domain of the

105. Chloride Channel CIC-Ka Reveals a Conserved Interaction Interface. //¦ i /!

106. Structure. 2007. — V. 15. — N. 6. — P. 715−725." ^ «

107. McLean, J. E., Hamaguchi, N., Belenky, P., Mortimer, S. E., Stanton, M., Hedstrom, L. Inosine 5-monophosphate dehydrogenase binds nucleic acids in vitro and in vivo. // Biochem J. 2004. — V. 379. — N. 2. — P. 243−251.

108. McMillan, F. M., Cahoon, M., White, A., Hedstrom, L., Petsko, G. A., Ringe,

109. D. Crystal structure at 2.4 A resolution of Borrelia burgdorferi inosine 5'. N '. ,> i >' i i ¦ i monophosphate dehydrogenase: evidence of a substrate-induced hinged-lid motion by loop 6. // Biochemistry. 2000. — V. 39. — N. 15. — P. 4533−4542.

110. Meng, L. M., Kilstrup, M., Nygaard, P. Autoregulation of PurR repressor synthesis and involvement of purR in the regulation of purB, purC, purL, purMN and guaBA expression in Escherichia coli. // Eur J Biochem. 1990. -V. 187. -N. 2. -P. 373−379. '

111. Messenger, L. J., Zalkin, H. Glutamine phosphoribosylpyrophosphate amidotransferase from Escherichia coli. Purification and properties. // J Biol

112. Chem. 1979. — V. 254. — N. 9. — P. 3382−3392. i

113. Meyer, S., Savaresi, S., Forster, I. C., Dutzler, R. Nucleotide recognition by the cytoplasmic domain of the human chloride transporter C1C-5. // Nat Struct Mol Biol. 2007. — V., 14. -N. 1. — P. 60−67.

114. Miller, J. H. A short course in bacterial genetics. A laboratory manual and' -'. i t, i 'handbook for Escherichia coli and related bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1992. c.

115. Miller, M. D., Schwarzenbacher, R., von Delft, F., Abdubek, P., Ambing, E. ,

116. Biorac, T., Brinen, L. S., Canaves, J. M., Cambell, J., Chiu, H. J., Dai, X., i 1 i i ,

117. H., Velasquez, J., Vincent, J., Wang, X., West, B., Wolf, G., Xu, Q., Hodgson,!i. i. j,. i —

118. K. O., Wooley, J., Wilson, I. A. Crystal structure of a tandem cystathionine-beta-synthase (CBS) domain protein (TM0935) from Thermotoga maritima at

119. A resolution. // Proteins. 2004. — V. 57. — N. 1. — P. 213−217.

120. Minden, J. Comparative proteomics and difference gel electrophoresis. // Biotechniques. 2007. — V. 43. — N. 6. — P. 739, 741, 743 passim.

121. Mori, H., Iida, A., Teshiba, S., Fujio, T. Cloning of a guanosine-inosine kinase gene of Escherichia coli and characterization of the purified gene product. // J Bacteriol. 1995: — V. 177. — N. 17. — P. 4921−4926.

122. Mortimer, S. E., Hedstrom, L. Autosomal dominant retinitis pigmentosa mutations in inosine 5-monophosphate dehydrogenase type I disrupt nucleic acid binding. //Biochem J. -2005. -V. 390. -N. 1. P. 41−47.

123. Nakamura, H., Natsumeda, Y., Nagai, M., Shiotani, T., Weber, G. Direct assay method for guanosine 5-monophosphate reductase activity. // Anal Biochem. i V ^ I1992. -V. 206. -N. l. -P. 115−118. I

124. Nilsson, D., Hove-Jensen, B. Phosphoribosylpyrophosphate synthetase of Bacillus subtilis. Cloning, characterization and chromosomal mapping of the1 ' 4 jprs gene. // Gene. 1987. — V. 53. — N. 2−3. — P. 247−255.

125. Nimmesgern, E., Black, J., Futer, O., Fulghum, J. R., Chambers, S. P. ,

126. Brummel, C. L., Raybuck, S. A., Sintchak, M. D. Biochemical analysis of thetmodular enzyme inosine 5-monophosphate dehydrogenase. // Protein Expr

127. Purif. 1999. — V. 17. — N. 2. — P. 282−289.

128. Nimmesgern, E., Fox, T., Fleming, M. A., Thomson, J. A. Conformational changes and stabilization of inosine 5-monophosphate dehydrogenaseassociated with ligand binding and inhibition by mycophenolic acid. // J Biolt

129. Chem. 1996. — V. 271. -N. 32. — P. 19 421−19 427.t. '

130. Nygaard, P., Multiple functions of purine nucleoside phosphorylase andvadenosine deaminase in Escherichia coli. in: Barth, A., Haschen, R., Laibach, j < i

131. F.H., Possin, H., Schowen, R.L., (Eds.), Molecular and cellular regulation of enzyme activity, Martin-Luther-Universitat, Halle, Germany, 1984, pp. 96

132. Pankiewicz, K. W., Goldstein, B. M. Inosine monophosphate dehydrogenase. A major therapeutic target. Oxford University Press, Washington, DC, 2003. c.

133. Pankiewicz, K. W., Patterson- Sv E., Black, P. L., Jayaram, IT. N., Risal, D:, 1. N. .,.. ' ,. '

134. Goldstein- B. M., Stuyver, L. J., Schinazi, R. E. Cofactor mimics as selective inhibitors! of NAD-dep. endent inosine monophosphate dehydrogenase (IMPDH)--the major therapeutic target. II Cuit Med Chem. 2004: — V. 11. — N. 7. — P. 887−900.

135. Pimkin, M., Markham, G. D. Inosine 5-monophosphate dehydrogenase. // Adv Enzymol Relat Areas Mol Biol. 2009. — V. 76. — P. 1−53.

136. Pimkin, M., Markham, G. D. The CBS subdomain of inosine 5'-monophosphate dehydrogenase regulates purine nucleotide turnover. // Molecular Microbiology. 2008. — V. 68. -N. 2. — P. 342−359. ,

137. Poland, B. W., Brans, C., Fromm, H. J., Honzatko, R. B. Entrapment of 6-thiophosphoryl-IMP in the active site of crystalline adenylosuccinate synthetase from Escherichia coli. // J Biol Chem. 1997. — V. 272. — N. 24. -P. 15 200−15 205.

138. Prosise, G. L., Luecke, H. Crystal structures of Tritrichomonasfoetus inosine monophosphate dehydrogenase in complex with substrate, cofactor andanalogs: a structural basis for the random-in ordered-out kinetic mechanism. //i. '

139. J Mol Biol. -2003. TV. 326. -N. 2. -P. 517−527.

140. Robertson, B. C., Hoffee, P. A. Purification and properties of purine nucleoside phosphorylase from Salmonella typhimurium. // J Biol Chem. 1973. — V. t V i i i248. -N. 6. -P. 2040−2043.

141. Rolfes, R. J., Zalkin, H. Autoregulation of Escherichia coli purR requires two11. ¦¦ i i > i 11control sites downstream of the promoter. // J Bacteriol. 1990. — V. 172. — N. 10. -P. 5758−5766.^ i ,' i 1

142. Rudolph, M- J.,. Amodeo, G. A., Iram, S. H., Hong, S. P., Pirino, G., Carlson, M., Tong, L. Structure of the Bateman2 domain of yeast Snf4: dimeric association and relevance for AMP binding. // Structure. 2007. — V. 15. — N. 1. — P. 65−74.

143. Sambrook, J., Russell, Dl W. Molecular cloning. A laboratory mainual: Cold Spring Harbor Laboratory Press, Cold Spring I larbor, New York, 2001. c.

144. Schumacher, M. A., Choi, K. Y., Lu, F., Zalkin, Hi, Brennan, R. G. Mechanism of corepressor-mediated specific. DNA binding by the. purine repressor. //Celli 1995. -V- 83. — Ni l. — P- 147−155:

145. Seeger, C., Poulsen, C., Dandanell, G. Identification and characterization of genes (xapA, xapB, and xapR) involved in xanthosine catabolism in Escherichia coli. // J Bacterid. 1995. -V. 177. -N. 19. — P. 5506−5516.

146. Shad, J. A., McHutchison, J. G. Current and future therapies of hepatitis C. // Clin. Liver Dis. 2001. — V. 5. — N. 2. — P. 335−359.

147. Sherley, J. L. Guanine nucleotide biosynthesis is regulated by the cellular p53 concentration. // J Biol Chem. 1991. — V. 266. -N. 36. — P. 24 815−24 828.

148. Sin, I. L., Finch, L. R. Adenine phosphoribosyltransferase in Mycoplasma mycoides and Escherichia coli. // J Bacteriol. 1972. — V. 112. — N. 1. — P. 439−444.i 1

149. Sintchak, M. D., Fleming, M. A., Futer, O., Raybuck, S. A., Chambers, S. P., f i

150. Caron, P. R., Murcko, M. A., Wilson, K. P. Structure and mechanism ofi iinosine monophosphate dehydrogenase in complex with thei11. > >. I ', «immunosuppressant mycophenolic acid. // Cell. 1996. — V. 85. — N. 6. — P. 921−930.

151. Sintchak, M. D., Nimmesgern, E. The structure of inosine 5'-monophosphate dehydrogenase and the design of novel inhibitors. // Immunopharmacology. 2000. -V. 47. -N. 2−3. -P. 1. 63−184. i

152. Sokoloski, J. A., Blair, O. C., Carbone, R., Sartorelli, A. C. Induction of the differentiation of synchronized HL-60 leukemia cells by tiazofiirin. // Exp. Cell. Res. 1989. -V. 182. -N. 1. — P. 234−241.

153. Stayton, M. M., Rudolph, F. B., Fromm, H. J. Regulation, genetics, and properties of adenylosuccinate synthetase: a review. // Curr Top Cell Regul. -1983. -V. 22. -P. 103−141.

154. Tesfa-Selase, F., Drabble, W. T. Regulation of the gua operon of Escherichiacoli by the DnaA protein. // Mol Gen Genet. 1992. — V. 231. — N. 2. — P. 256 264.

155. Timms, J. F., Cramer, R. Difference gel electrophoresis. // Proteomics. 2008.• V (- V. 8. N. 23−24. — P. 4886−4897. i

156. Townley, R., Shapiro, L. Crystal structures of the adenylate sensor from fission yeast AMP-activated protein kinase. // Science. 2007. — V. 315. -N. 5819. -P. 1726−1729.

157. Valentin-Hansen, P., Hammer, K., Love Larsen, J. E., Svendsen, I. The internalregulated promoter of the deo operon of' Escherichia coli K-12. // Nucleict< >

158. Acids Res. 1984. — V. 12. — N. 13. — P. 5211−5224.1 i • i i i > i, 1190. van Alphen, W., van Seim, N., Lugtenberg, B. Pores in the outer membrane of1. I 1 !, • I ,

159. Escherichia coli K12: involvement of proteins b and e in the functioning of pores for nucleotides. // Mol Gen Genet. 1978. — V. 159. — N. 1. — P. 75−83.1 '. t !. i '. i v ' i * <)

160. Vasantha, N., Freese, E. Enzyme changes during Bacillus subtilis sporulationi icaused by deprivation of guanine nucleotides. // J Bacterid. 1980. — V. 144. -N. 3. -P. 1119−1125.1 '..

161. Verham, R., Meek,, T. D.,. Hedstrom, L., Wang, C. C. Purification, characterization, and kinetic analysis of inosine 5-monophosphate dehydrogenase of Tritrichomonas foetus. // Mol Biochem Parasitol. 1987. -V. 24. -N. l. -P. 1−12.

162. Wang, C. C., Verham, R., Rice, A., Tzeng, S. Purine salvage byr

163. Tritrichomonas foetus. // Mol. Biochem. Parasitol. 1983. — V. 8. — N. 4. — P.1 ' t *325. 337.

164. Wang, G. P., Cahill, S. M., Liu, X., Girvin, M. E., Grubmeyer, C. Motional dynamics of the catalytic loop in OMP synthase. // Biochemistry. 1999. — V. 38. -N. l. -P. 284−295. i

165. Wang, W., Hedstrom, L. Kinetic mechanism of human inosine 5'-'i. monophosphate dehydrogenase type II: random addition of substrates andordered release of products. // Biochemistry. 1997. — V. 36. — N. 28. — P. 8479−8483.

166. Wang, W., Hou, Z., Honzatko, R. B., Fromm, H. J. Relationship of conserved residues in the IMP binding site to substrate recognition and catalysis in Escherichia coli adenylosuccinate synthetase. // J Biol Chem. 1997. — V. 272. -N. 27. -P. 16 911−16 916.

167. Watterson, S: H., Chen, P., Zhao, Y., Gu, H. H., Dhar, T. G., Xiao, Z., Ballentine, S. K., Shen, Z., Fleener, C. A., Rouleau, K. A., Obermeier, M., Yang, Z., Mclntyre, K. W., Shuster, D. J., Witmer, M., Dambach, D., Chao, S. ,

168. Mathur, A., Chen, B. C., Barrish, J. C., Robl, J. A., Townsend, R., Iwanowicz, 1 >

169. Weber, G. Enzymes of purine metabolism in cancer. // Clin. Biochem. 1983. -V. 16. -N. l. -P. 57−63.i < ', ' / >

170. Xiang, B, Taylor, J. C., Markham, G. D. Monovalent cation activation and kinetic mechanism of inosine 15-monophosphate dehydrogenase. // J Biol Chem. 1996. — V. 271. -N. 3. -P. 1435−1440.

171. Yamada, Y., Natsumeda, Y., Weber, G. Action of the active metabolites of tiazofurin and ribavirin on purified IMP dehydrogenase. // Biochemistry.1 1 I '. IS. I1988. -V. 27. -N. 6. P. 2193−2196.i ' 1: .' !'

172. Yu, D., Ellis, H. M., Lee, E. C., Jenkins, N. A., Copeland, N. G., Court, D. L. An efficient recombination system for chromosome engineering in Escherichia coli. // Proc Natl Acad Sci USA.- 2000. V. 97. — N. 11. — P. 5978−5983.

173. Yuan, J., Fowler, W. U., Kimball, E., Lu, W., Rabinowitz, J. D. Kinetic flux profiling of nitrogen assimilation in Escherichia coli. // Nat Chem Biol. — 2006. -V. 2. -N. 10. -P. 529−530.

174. Zalkin, H., Dixon, J. E. De novo purine nucleotide biosynthesis. // Prog Nucleic Acid Res Mol Biol. 1992. — V. 42. — N. — P. 259−287.

175. Zhang, R., Evans, G., Rotella, F. J., Westbrook, E. M., Beno, D., Huberman, i

176. E., Joachimiak, A., Collart, F. R1. Characteristics and crystal structure of bacterial inosine-5'-monophosphate dehydrogenase. // Biochemistry. 1999. -V. 38. — N. 15. — P. 4691−4700.

177. Zhou, X., Cahoon, M., Rosa, P., Hedstrom, L. Expression, purification, and characterization of inosine 5'-monophosphate dehydrogenase from Borrelia burgdorferi. // J Biol Chem. 1997. — V. 272. — N. 35. — P. 21 977−21 981.

Заполнить форму текущей работой